авторефераты диссертаций БЕСПЛАТНАЯ БИБЛИОТЕКА РОССИИ



Pages:     | 1 |   ...   | 7 | 8 || 10 | 11 |   ...   | 13 |


-- [ Страница 9 ] --

длительностью от 3 до 10 лет, превалировала Результатом явилось восстановление репро клиническая картина хронического воспаления дуктивной функции у 383 больных (41,5%), придатков матки. В структуре воспалительных из них у 13 (3,3%) — внематочная беремен заболеваний отмечался высокий удельный вес ность.

хламидийной (35%) и микоплазменной (29%) Таким образом, мы можем говорить о высо инфекций, что привело к выраженному спаеч- кой эффективности лапароскопической хирур ному процессу малого таза. Из общей группы гии при дифференцированном подходе, пра (n=922) выделили 689 пациенток, перенесших вильном отборе пациенток для операции инфекцию мочеполовых органов: гонорея, кан- и качественной реабилитации.

дидоз, трихомоноз, бактериальный вагиноз (хламидиоз, гарднереллез).

Для повышения эффективности лапароско- Ch. G. Alyeva, p.SH. Alieva, D. H. Alieva пических реконструктивно — пластических STAGED MANAGEMENT OF TuBAL операций важное значение уделялось отбору pERITONEAL INFERTILITY пациенток для операций на догоспитальном Dagestan Scientific Center RAMS этапе, при лечении ТПБ, а также качеству Makhachkala, Russia послеоперационного лечения.

Having performed for 4 years 922 laparoscopic Предоперационная подготовка пациенток procedures for tubal-peritoneal infertility, acute с ТПБ к лапароскопии включала инфекцион PID, peritoneal endometriosis, ectopic pregnancy ный скрининг, что позволило при выявлении and adnexal masses, the authors have achieved воспалительного процесса провести адекват the total pregnancy rate of 41.5%, providing evi ную предоперационную терапию.

dence of high effectiveness of staged management По объему лапароскопических вмешательств of infertility.

пациентки распределились следующим образом:

сальпингоовариолизис — у 570, фимбриолизис, фимбриопластика — у 270, энуклеация кист — у 103, пластика труб по Бруа — у 170, удаление гидатид — у 48, коагуляция эндометриоидных очагов — у 105.

NEW TECHNOLOGIES FOR DIAGNOSIS AND TREATMENT OF GYNECOLOGIC DISEASES к. б. большакова, М. п. крамаренко, Е. н. карева, с помощью метода полимеразной цепной реак Д. а. тихонов ции в реальном времени. Так были определены ЭкспрЕссИя ГЕнов рЕцЕпторов уровни экспрессии мРНК Bact (бета-актин), PR-A стЕроИДных ГорМонов (рецептор прогестерона типа А), PR-B (рецептор прогестерона типа В), ER- (рецептор эстради в МононуклЕарной фракцИИ ола альфа), ER- (рецептор эстрадиола бета), AR пЕрИфЕрИчЕской кровИ у жЕнщИн (андрогеновый рецептор).

Для определения экс старшЕГо возраста, вклЮчЕнных прессии генов рецепторов стероидных гормонов в проГраММу Эко использовались ниже приведенные праймеры Кафедра акушерства и гинекологии педиатрического факуль Bact тета (зав. кафедры профессор Г. М. Савельева), (up–CGTACCACTGGCATCGTGAT, low Кафедра молекулярной фармакологии и радиобиологии МБФ GTGTTGGCGTACAGGTCTTTG), PR-A (зав.кафедры профессор Н. Л. Шимановский) ГОУ ВПО РГМУ им. Н. И. Пирогова Росздрава (up-GGTCTACCCGCCCTATCTCA, low Москва, Россия GGCTTGGCTTTTCATTTGGAA), PR-B В настоящее время особую актуальность при- (up-GAGGGGGCAGTGGAACTCAG, обрела проблема бесплодия у женщин старшего low-AGGGGAACTGTGGCTGTCGT), возраста (СВ) — после 37 лет. Ранее нами было ER- (up-TGCCAAGGAGACTCGCTACT, показано, что рецепция прогестерона в имму- low-CTGGCGTTGTGTTTCAAC), ER (up-TCAGCTTGTGACCTCTGTGG, low нокомпетентных клетках периферической TGTATGACCTGCTGCTGGAG), AR крови тесно связана с эффективностью вспомо (up-TTAGATTGGGCTTTGGAACC, low гательных репродуктивных технологий (ВРТ) GCTTCCTGAATAGCTCCTGCT (Г. М. Савельева и др. 2011 г.). В то же время были синтезированы компанией «Синтол».

рецепция половых стероидов в мононуклеар В работе применялись готовые наборы реак ной фракции клеток (МНФК) периферической тивов для ПЦР в реальном времени (2,5х крови может зависеть от сопутствующих забо Реакционная смесь для проведения ПЦР-РВ с Taq леваний и возраста пациенток. Поэтому целью ДНК-полимеразой и ингибирующими актив нашего исследования явилось определение ность фермента антителами в присутствии SYBR экспрессии генов стероидных гормонов в рези Green І, «Синтол»). ПЦР в реальном времени дентных иммунокомпетентных клетках пери проводился на приборе iCycler iQ real-time PCR ферической крови (ПК) у женщин СВ, включен (BioRad, Германия). Для оценки числа копий ных в программу ЭКО.

мРНК применялся Сt-метод относительного Было обследовано 66 женщин с бесплодием, определения количества по формуле (1/2)Ct.

включенных в программу ЭКО, на базе Центра Статистическую обработку полученных данных Планирования и Репродукции Семьи (Москва, проводили с использованием программного главный врач центра — д. м.н. профессор пакета GraphPad Prism 5.

Курцер М. А.) и ОАО «Медицина» (Москва, прези В результате анализа клинических данных дент клиники — д. м.н., профессор Ройтберг Г. Е.).

показано, что у 24 (75%) пациенток первой Пациентки были разбиты на две группы: в пер группы наступила беременность, из них одно вую группу (сравнения) вошли 32 женщины плодные у 13 (64%), многоплодные (двойня) в возрасте от 27 до 36 лет (средний возраст у 11 (54%). При этом в основной группе бере 31,71±2,99);

во вторую, основную, группу — менность была обнаружена у 24 (82%) женщин, 29 женщин от 37 до 50 лет (41,75±4,23), из них из них одноплодные у 11 (45%), многоплодные у 5 изучалась экспрессия генов рецепторов сте у 13 (54%) (из них 12 двоен и 1 тройня);

у роидных гормонов в МНФК периферической (37%) из 29 пациенток использовались донор крови. У всех оценивались количество попыток ские яйцеклетки, у остальных получены свои ЭКО, вероятность наступления и течение бере яйцеклетки после стимуляции гонадотропи менности в первом триместре. Забор ПК произ нами. Среднее количество попыток ЭКО в пер водили из локтевой вены на 19–23 день менстру вой группе от 1 до 3, во второй — от 2 до 10.

ального цикла. МНФК получали стандартным методом на фиколле из ПК (по Boyum A. 1968 г.). Число копий мРНК в МНФК ПК у 5 женщин СВ составил: PR-A = 0,75 ± 0,45, PR-B = 2,14 ± Из полученной МНФК выделяли образцы мРНК 1,22, ER- = 14,61 ± 10,13, ER- = 2,32 ± 2,82, (комплект «Рибо-преп», AmpliSens), которые AR = 1,49 ± 1,45. Сравнительный анализ экс использовали для постановки реакций обрат прессии генов стероидных гормонов и гор ной транскрипции (комплект «Реверта-L», мональный статус пациенток с бесплодием AmpliSens). Полученные кДНК анализировали новыЕ тЕхнолоГИИ в ДИаГностИкЕ И лЕчЕнИИ ГИнЕколоГИчЕскИх заболЕванИй позволил выявить тесную отрицательную кор- ских заболеваний, последствий перенесенных реляцию между уровнем мРНК рецепторов про- воспалительных заболеваний и оперативных гестерона типа В и возрастом женщин: r=-0,9, вмешательств на матке и придатках, а так же p= 0,083 по корреляции Спирмена. Для осталь- экстрагенитальных заболеваний, с преобла ных параметров не выявлено достоверной данием сердечно-сосудистых и эндокринопа зависимости, что может быть объяснено недо- тий. Многие специалисты считают, что почти статочным объемом выборки. с последнее десятилетие в половине случаев Таким образом, увеличение возраста жен- бесплодие в браке обусловлено нарушением щин с бесплодием сопровождается снижением репродуктивной функции обоих супругов.

уровня экспрессии генов рецепторов проге- Таким образом, в возрасте старше 35–37 лет ее стерона типа В, что может отразится на функ- возможности женщины в реализации репро ционировании иммунокомпетентных клеток дуктивной функции весьма ограничены, и вносить свой вклад в нарушении репродук- поскольку возраст уже сам по себе оказывает тивной функции. влияние на фертильность, а также имеет место сочетание нескольких факторов бесплодия.

С целью определения клинических особен ностей женщин позднего репродуктивного воз K. B. Bolshakova, M. p. Kramarenko, E. N. Kareva, раста и проведения сравнительного анализа D. A. Tikhonov причин эндокринного бесплодия, нами были GENE EXpRESSION OF STEROID HORMONES обследованы 92 женщины от 25 до 44 лет, име RECEpTORS IN SAMpLES OF MONONuCLEAR ющих в анамнезе первичное или вторичное CELLS OF pERIpHERAL BLOOD AT THE бесплодие: I группа — 47 пациенток позднего WOMEN WITH ADvANCED AGE WHO репродуктивного периода от 35 до 44 лет (сред ARE INCLuDED IN IvF pROGRAM ний возраст 38,52 + 0,43 лет), II группа сравне ния — 45 пациенток среднего репродуктивного Department of obstetrics and gynecology of pediatric faculty, P. V. Sergeev department of molecular pharmacology and radiobiology периода от 25 до 34 лет (средний возраст 29, N. I. Pirogov Russian State Medical University, Moscow, Russia + 0,42 лет). Нами было проведено полное кли We have been examining 66 women with infer- нико-лабораторное обследование бесплодных tility who were included in IVF program. These супружеских пар. Проведена статистическая patients were divided into two groups. In these обработка полученных результатов с вычисле groups we had estimated number of IVF attempts нием средних величин и их ошибок.

and probability of pregnancy. Gene expression of В ходе сравнительного анализа данных, было steroid hormones receptors in samples of MNC выявлено, что причиной обращения большин of peripheral blood was studied at five women of ства женщин позднего репродуктивного воз second group. It was shown that gene expression раста явилось вторичное бесплодие, которое of progesterone receptor isoform B decrease with было диагностировано у 35 (74,5%), в то время the increase of years. как 26 (57,8%) пациентки среднего репродук тивного возраста страдали от бесплодия пер вичного. Причем в обеих клинических груп пах преобладала сочетанная форма бесплодия, Е. в. воробьева в 74,5%, 62,2% случаев соответственно. Так, клИнИко — лабораторная при сравнении межгрупповых данных в I группе характЕрИстИка жЕнщИн у мужчин наиболее часто был диагностирован с ЭнДокрИнныМИ форМаМИ бЕсплоДИя хронический простатит — у 24 (51,1%) обследу в возрастЕ старшЕ 35 лЕт емых, а по результатам спермограммы, у боль Первый Московский Государственный Медицинский Университет шинства 17 (36,2%), встречались сочетанные им. И. М. Сеченова, Кафедра акушерства и гинекологии МПФ формы патозооспермии (астенотератозооспер Москва, Россия мия), в отличие от II группы, где хронический В последние годы среди женщин, страдающих простатит зафиксирован всего у 9 (20%) муж бесплодием, наметилась тенденция к увеличе- чин с преобладанием боле легких форм нару нию доли пациенток позднего репродуктивного шений спермограммы по типу астенозооспер возраста, обращающихся с целью достижения мии — у 12 (26,7%) и тератозооспермии — у беременности и рождения ребенка. По ста- (33,3%). Изменение репродуктивного потен тистике у женщин позднего репродуктивного циала мужчин I группы в сторону ухудшения возраста увеличивается частота гинекологиче- связано, по-видимому, с более старшим (41, NEW TECHNOLOGIES FOR DIAGNOSIS AND TREATMENT OF GYNECOLOGIC DISEASES Е. а. коган, в. Ю. смольникова, т. а., Демура, + 0,56 лет) возрастом обследуемых данной з. Г. ароян, Е. а. калинина группы. Анализируя репродуктивный анамнез ЭкспрЕссИя клауДИнов женщин, наибольшее количество беремен 3 И 5 в ЭнДоМЕтрИИ в «окно ностей в анамнезе отмечалось у пациенток I группы, так у 74,5% больных зафиксировано ИМплантацИИ» прИ трубно от 1 до 12 беременностей, по отношению к II пЕрИтонЕальноМ факторЕ бЕсплоДИя группе, где у 42,2% пациенток была 1–3 бере- Отделение вспомогательных технологий в лечении бесплодия, менности, а в числе репродуктивных потерь отделение патоморфологии Научного Центра Акушерства, Гине кологии и Перинатологии имени акад. В. И. Кулакова Минздрав преобладали самопроизвольный выкидыши соцразвития России, Москва, Россия и неразвивающаяся беременность. Среди нару Происходящие в эндометрии структурные, шений менструальной функции, в I группе функциональные и молекулярные изменения больных превалировали мено-метрорра в ответ на эмбриональные сигналы являются гии — у 36 (76,6%), что, по-видимому, связано основой для успешной имплантации. Клаудины с наличием большого числа гинекологических 3 и 5 являются одними из основных компонен заболеваний дисгормонального характера, тов межклеточных взаимодействий, которые а именно: внутренний эндометриоз диагности контролируют изменения мембраны клеток рован у 18 (38,3%), миома матки у 15 (31,9%), эндометрия в период имплантации.

гиперпластические процессы эндометрия, Цель исследования состояла в том, чтобы в том числе полипы у 9 (19%). Во второй группе оценить особенности экспрессии клаудинов гинекологические заболевания практически в эндометрии в период “окна имплантации» при отсутствовали, но при этом имели место дис трубно-перитонеальном факторе бесплодия.

фукциональные нарушения с преобладанием Материал и методы: образцы эндометрия гиперандрогенных состояний, выявленные у 30 пациенток, включенных в программу ЭКО (84,4%) больных и нарушения менструальной и ПЭ, полученные путем пайпель-биопсии, функции по типу опсоменореи — у 20 (44,4%).

в период “окна имплантации”, были подвер При оценке соматического статуса во II группе гнуты морфологическому и иммуногистохими превалировали эндокринопатии у 22 (48,9%), ческому исследованию, полученные результаты а во II группе — заболеваний сердечно-сосуди проанализированы в зависимости от исхода стой системы у 17 (36,2%).

лечения: беременность наступила (I группа) Таким образом, в группе обследуемых жен или не наступила (II группа).

щин старшего репродуктивного возраста, при Результаты: Пациенты II группы показали чиной бесплодия являются результаты возраст несоответствующие морфологические изме ной перестройки репродуктивной системы, нения в эндометрии в период «окна имплан тогда как у пациенток среднего репродуктив тации»: секреторное преобразование проис ного возраста наиболее значимыми стали дис ходило позже, число зрелых пиноподий было функциональные нарушения репродуктивной значительно ниже (меньше чем 20%), чем в 1-й системы.

группе, где было отмечено наличие пинопо дий — больше чем на 50% площади поверх ностного эпителия (p 0.05). Анализ индекса E. v. vorobyeva плотных контактов в II группе для клаудинов CLINICAL AND LABORATORY CHARACTERISTIC 3 и 5 показал число, меньше чем 0,5. Для 1-й OF WOMEN OvER 35 YEARS WITH ENDORCINE группы показаны лучшие результаты (клаудин FORMS OF INFIRTILITY 3–4,5, клаудин 5–3,5).

The First Moscow Sechenov State Medical University, Ранее нами была показана корреляция Department of Obstetrics and Gynecology PMF в той же самой группе пациенток между соотно Moscow, Russia шением рецепторов эстрадиола и прогестерона Late reproductive age of women, concomitant (PR/ER) и результатами лечения бесплодия.

gynecological diseases, health of a husband pre- Соотношение PR/ER, равное 1,5–2,0 в период supposes the existence of several factors of infertil- ”окна имплантации” коррелирует с положи ity. The complex character of risk factors makes the тельными результатами. Мы использовали choice of therapy difficult. терапию препаратами эстрадиола (“Divigel”, Orion-Pharma, Финляндия) и прогестерона, когда PR/ER отличался от нормального соотно шения.

новыЕ тЕхнолоГИИ в ДИаГностИкЕ И лЕчЕнИИ ГИнЕколоГИчЕскИх заболЕванИй Взятые вместе полученные результаты позво- play a crucial role in implantation, but need to fur ляют предположить, что анализ межклеточных ther investigation.

взаимодействий наряду с изучением рецеп тивности эндометрия позволит пролить свет на процессы в период «окна имплантации», М. И. Мазитова, Г. М. зарипова которые, безусловно, нуждаются в дальнейшем прИМЕнЕнИЕ 4% раствора исследовании.

ИкоДЕкстрИна у пацИЕнток с трубно пЕрИтонЕальныМ бЕсплоДИЕМ Кафедра акушерства и гинекологии № E. A. Kogan, v.Yu. Smolnikova, z. G. Aroyan, Казанская государственная медицинская академия T. A. Demura, E. A. Kalinina Казань, Россия TIGHT juNCTIONS MOLECuLES CLAuDINES IN Формирование спаечного процесса в малом THE pERIOD OF “IMpLANTATION WINDOW” IN тазу является одной из актуальных проблем, WOMEN WITH TuBAL FACTOR OF INFERTILITY как с медицинской, так и с социальной точки IVF Department, Pathology Department, Research Centre for Obstetrics, зрения. Послеоперационная интраперитоне Gynecology and Perinatology named after V. I. Kulakov альная адгезия занимает ведущее место среди Ministry of Health and Social Development of Russian Federation, Moscow, Russia причин трубно-перитонеального бесплодия.

Structural, functional and molecular changes На современном этапе подходы к профилак of endometrium are the basis for the adequate тике спаек включают щадящие хирургические response to embryo signals resulting in implanta- методики, современный шовный материал, tion. Claudines are the main tight junction consti- применение вспомогательных средств, проти tutents, which control lumen membrane change in воспаечных барьеров, уменьшающих спайкоо the period of implantation. бразование.

The goal of the study was to evaluate character- Целью нашего исследования является изу istics of tight junctions molecules claudines in the чение влияния противоспаечного барьера period of “implantation window” in women with (ПСБ) 4% раствора икодекстрина на образо tubal factor of infertility. вание спаек в послеоперационном периоде Materials and Methods: The endometrial sam- у больных с трубно-перитонеальным беспло ples of 30 infertile women involved in IVF pro- дием. Нами прооперировано 25 пациенток grams, obtained via Pipelle biopsy in the period с трубно-перитонеальным бесплодием, кото of “implantation window” were morphologically рым вводился с целью профилактики образо and immunohistochemically analyzed according вания спаечного процесса противоспаечный to treatment outcome: become pregnant (I group) барьер — 4% раствор икодекстрина (Адепт).

or not (II group). Всем пациенткам проведена лапароскопия Results: Patients of II group showed inadequate с адгезиолизисом и последующим вливанием morphological transformation in endometrium: в брюшную полость ПСБ 4% раствора икодек secretory transformation occurred later and the стрина «Адепт». Возраст пациенток составил number of mature pinopodes was sighnificantly 19–38 лет. Выраженность спаечного процесса lower (less than 20%), than in 1st group — more по степени распространенности был следую than 50% of surface epithelium (p0.05). Analyzes щим: I ст. обнаружена у 7 (28%) пациенток, II of tight junctions pattern revealed score in II group ст. — у 8 (32%), III ст. — у 6 (24%), IV ст. — у for claudines 3 and 5 less than 0,5. The 1st group (16%).

had better results (claudine 3–4,5 score, claudine ПСБ «Адепт» — стерильная прозрачная жид 5–3,5 score). кость для интраоперационного применения, Earlier we identified the correlation in the same оказывает физическое воздействие на ткани, group of patient between progesterone recep- обеспечивая временное разделение поверх tor/estradiol receptor (PR/ER) ratio and out- ностей органов брюшной полости, благодаря comes of infertility treatment. The mean of PR/ флотации в жидкости. Это минимизирует ER 1,5–2,0 in ”implantation window” correlates соприкосновение тканей в критический период with positive results. We used therapy by estradiol образования фибрина и регенерации мезотелия (“Divigel”, Orion-Pharma) and progesterone when после хирургических операций и, таким обра PR/ER differs from normal ratio. зом, препятствует образованию спаек. «Адепт»

Obtained results taken together suggest tight нами вводился в конце операции с помощью junctions and receptivity of the endometrium to аспиратора-ирригатора. Послеоперационный NEW TECHNOLOGIES FOR DIAGNOSIS AND TREATMENT OF GYNECOLOGIC DISEASES период протекал без особенностей. В двух В настоящее время не существует надежных случаях наблюдался незначительный отек средств профилактики образования спаек как передней брюшной стенки и наружных поло- послеоперационного, так и воспалительного вых органов, который купировался к 3-м сут- генеза. Поэтому метод, который смог бы сни кам. Пациенткам проводилось УЗИ на 2-е, 4-е зить или предотвратить образование спаек сутки с целью контроля жидкости в брюшной после операций, был бы очень полезен для полости. Раствор сохранялся на все критиче- снижения частоты случаев неэффективности ское время спайкообразования. После выпи- хирургического лечения, в общем, повыше ски через 2 месяца пациенткам проводилась ния эффективности репродуктивной хирургии ультразвуковая соноконтрастная гистеросаль- в частности. Существенной особенностью спа пингография с применением искусственного ечной болезни является устойчивость частоты асцита в режиме 3 Д с целью выявления спаеч- заболевания на протяжении многих лет, несмо ного процесса. Спайки обнаружены у 17 (68%) тря на достижения медицины и рекомендуе пациенток, в том числе I ст. — у 9 (36%), II cт. — мые методы профилактики развития спаек.

у 6 (24%), III ст. выявлена у 2 (8%) пациенток. Перспективным считаем применение гелевой Проведение дальнейших исследований формы противоспаечного барьера. Именно позволит нам сделать выводы об эффективно- гель может задерживаться в брюшной полости сти «Адепта» в профилактике послеоперацион- на достаточно долгое время (что необходимо ного спаечного процесса. для регенерации поврежденной брюшины).

Кроме того, структура геля позволяет депони ровать в нем различные лекарственные препа раты, способные усиливать профилактический M. I. Mazitova, G. M. zaripova эффект.

IMpLEMENTATION OF 4%-SOLuTION Цель работы: оценить эффективность приме OF ICODEXTRIN IN TREATMENT OF pATIENTS нения противоспаечных препаратов, улучшить WITH TuBAL–CAvITY INFERTILITY результаты лечения пациенток с трубно-пери Department of obstetrics and gynecology № тонеальным фактором бесплодия;

профилак Kazan State Medicine Academy тика рецидива образования спаек;

создание Kazan, Russia протокола использования и оценки эффектив Development of the adhesive process is pending ности противоспаечных барьеров Линтекс problem in gynecology. In actual research in order Мезогель, INTERCOAT, ADEPT. Материалы to prevent adhesion four-percent solution of ico- и методы. Линтекс-Мезогель использован dextrin has been used as an anti-adhesive barrier. при лапароскопии у 72 пациенток преимуще Observation of patients has shown great improve- ственно при операциях на придатках и пла ment in reproductive function. стики маточных труб. Гель INTERCOAT был применен в 50 случаях — у 20 пациенток после консервативной миомэктомии и у 30 паци енток с двухсторонними и односторонними т. н. Мананникова, а. а. попов, М. р. рамазанов, гидросальпинксами, которым в процессе опе а. а. федоров, н. а. колесник, М. а. чечнева, ративного вмешательства выполнены рекон а. а. Головин структивные операции на маточных трубах.

профИлактИка образованИя спаЕк Известно, что эти оперативные вмешательства с ИспользованИЕМ протИвоспаЕчных имеют высокий риск формирования послеопе прЕпаратов рационных спаек. Также у 35 больных, пере Московский областной НИИ акушерства и гинекологии несших ранее от 2 до 4-х «открытых» операций Москва, Россия на органах малого таза и брюшной полости, В настоящее время не существует надежных после адгезиолизиса с целью профилактики средств профилактики образования спаек как повторного формирования спаек и спаек de послеоперационного, так и воспалительного novo были использован противоспаечный рас генеза. Перспективным считаем применение твор ADEPT. Эффективность противоспаечных гелевой формы противоспаечного барьера. барьеров оценена у 50 больных при повтор Именно гель может задерживаться в брюшной ной лапароскопии в сроки от 4 до 36 меся полости на достаточно долгое время (что необ- цев. Повторное формирование спаек отме ходимо для регенерации поврежденной брю- чено практически во всех случаях, но степень шины). выраженности спаечного процесса снизилась новыЕ тЕхнолоГИИ в ДИаГностИкЕ И лЕчЕнИИ ГИнЕколоГИчЕскИх заболЕванИй Г. в. нанагюлян, а. к. хачатрян с 4 до 1–2 степени. Оценивая результаты вос лапароскопИчЕскИЕ становления фертильности, следует отметить, рЕконструктИвно-пластИчЕскИЕ что из 28 пациенток с бесплодием беремен ность наступила в 13 случаях. Сроки наступле- опЕрацИИ прИ ГИДросальпИнксах ния беременности варьировали от 5 месяцев с прИМЕнЕнИЕМ ИнтраопЕрацИонной до 1,5 лет с момента проведения операции.

лапароскопИчЕской ЭхоГрафИИ У большинства женщин наступление беремен у жЕнщИн с трубно-пЕрИтонЕальныМ ности отмечено в первый год после операции.

бЕсплоДИЕМ Таким образом, использование противоспа ечных препаратов в комплексе хирургического ФГУ «НЦ АГиП им. В. И. Кулакова» Минздравсоцразвития России Москва, Россия лечения позволяет минимизировать послеопе По данным литературы, трубно-перитоне рационный спаечный процесс, что особенно альные факторы бесплодия выявлены у 35–70% важно при выполнении операций при беспло пациенток с нарушением генеративной функ дии, устранить локальные проявления спаеч ции. При первичном бесплодии частота пораже ной болезни и улучшить результаты лечения.

ния маточных труб колеблется от 29,5 до 70%, Разработка алгоритма лечения трубно-пери при вторичном — от 42% до 83%.

тонеального бесплодия с использованием Цель исследования: разработать способ противоспаечных препаратов и проведение адекватного оперативного вмешательства повторной лечебной и/или диагностической на маточных трубах с применением интрао лапароскопии, позволяет оптимизировать перационной лапароскопической эхографии репродуктивные возможности пациентов.

(ЛЭ) при гидросальпинксах у женщин с трубно Применение противоспаечных препаратов перитонеальным бесплодием. В основную также приводит к улучшению качества жизни группу (ОГ) включены 20 женщин с гидро больных, снижению частоты рецидивов забо сальпинксом и трубно-перитонеальным бес левания у пациенток со спаечной болезнью;

плодием, которые оперировались с примене повышению клинической эффективности нием ЛЭ. Контрольную группу (КГ) составили и сокращению сроков восстановительного 11 женщин с гидросальпинксом и трубно-пери лечения;

снижению частоты неоправданных тонеальным бесплодием, оперированных без хирургических вмешательств у больных со спа применения ЛЭ.

ечной болезнью, что, в свою очередь, имеет Эхографическое исследование осущест значительный, экономический эффект.

вляли при помощи ультразвуковых при боров фирмы "Aloka" SSD-2000, «Siemens Sienna», (Германия) с использованием линей T. N. Manannikova, A. A. popov, M. R. Ramazanov, ного датчика частотой 7,5 МГц, обеспечи A. A. Fedorov, N. A. Kolesnik, вающего оптимальную глубину зондиро M. A. Chechneva, A. A. Golovin вания в 6–8 см. Лапароскопию выполняли ANTIADHESION BARIERS ApLICATION IN у 31 больной по общепринятой методике.

ADHESIONS pREvENTION Эффективность дооперационной трансва Moscow Regional Obstetrics and Gynecology Research Institute гинальной эхографии (ТВЭ) в обнаружении Moscow, Russia гидросальпинкса при первичном и вторич In present time weir is no authorized ways of ном трубно-перитонеальном бесплодии оце adhesions prevention after surgery and inflam- нена у 31 пациентки основной и контрольной mation diseases. We suggest what the most per- групп, а ЛЭ — у 20 ОГ.

spective are liquid (gel) antiadhesion barriers. Возраст обследованных женщин не разли Antiadhesional gel can stay in abdomen cavity for a чался между исследуемыми группами и коле long time (for period of peritoneum regeneration). бался от 21 до 35 лет, составляя в среднем 30, ± 0,6 года. На момент обследования все жен щины имели регулярный менструальный цикл.

Средняя продолжительность бесплодия среди обследуемых женщин колебалась от 1 до 10 лет и составила в среднем 5,7 ± 0,7 лет. Первичным бесплодием страдали 14 (45,2%) пациенток, а вторичным — 17 (54,8%). Следует отметить, что все женщины в исследуемых группах пере NEW TECHNOLOGIES FOR DIAGNOSIS AND TREATMENT OF GYNECOLOGIC DISEASES несли хронический сальпингоофорит, в основ- Ложноотрицательный результат получен у ном, хламидийной и уреоплазменной этиоло- (38,7%) женщин. Как выяснилось при лапа гии. роскопии, причиной ложноотрицательных По данным трансвагинальной эхографии результатов были небольшие размеры гидро у всех женщин в исследуемых группах обна- сальпинкса и незначительное количество ружен спаечный процесс в малом тазу 3–4 сте- жидкости в маточной трубе, которая не визу пени. Односторонний гидросальпинкс выявлен ализируется при ТВЭ. При ТВЭ-диагностике у 11 (55%) женщин ОГ и у 6 (54,5%) в КГ, а дву- гидросальпинкса чувствительность составила сторонний гидросальпинкс у 4 (20%) ОГ и у 4 76,6%, специфичность — 78,6%, прогностиче (36,4%) женщин КГ. ская ценность положительного результата — Согласно результатам лапароскопии спа- 95,2%, прогностическая ценность отрицатель ечный процесс 3–4 степени с образованием ного результата — 37,9%, а диагностическая одностороннего или двустороннего гидро- точность — 76,2%. У женщин с гидросальпинк сальпинкса обнаружен у всех пациенток. сами в исследуемых группах за период послео Односторонний гидросальпинкс обнаружен у 8 перационного наблюдения на первые сутки тол (40%) женщин ОГ и у 5 (45,5%) КГ, а двусторон- щина маточных труб составила от 1,2 до 1,8 см, ний гидросальпинкс у 12 (60%) ОГ и у 6 (54,5%) в среднем 1,45±0,05 см. На 3 и 7-е сутки наблю КГ. Всем пациенткам ОГ и КГ произведены саль- дения существенных изменений толщины пингоовариолизис, сальпингостомия, фимбри- маточных труб не выявлено. На 14 сутки после опластики. Сопутствующая бесплодию гинеко- оперативного вмешательства толщина маточ логическая патология, такая как субсерозная ных труб прогрессивно уменьшалась, составляя миома матки небольших размеров обнаружена от 0,5 до 1,0 см, в среднем 0,74±0,04 см, а через у 4 (20%) пациенток ОГ и у 2 (18,2%) КГ, пара- месяц не визуализировалась. Ультразвуковой овариальная киста небольших размеров — у 5 мониторинг послеоперационного периода (25%) ОГ, наружный генитальный эндометриоз в ОГ не выявил рецидивов гидросальпинкса, у 2 (18,2%) и серозная цистаденома небольших а у женщин КГ выявлен рецидив в 3 (27,3%) размеров у 1 (9,1%) женщины КГ. В связи с этим, случаях из 11. В течение 1,5–2 лет послеопера дополнительно выполнены: миомэктомия без ционного периода беременность наступила у вскрытия полости матки, цистэктомия, коагу- (20%) женщин в ОГ и завершилась срочными ляция очагов эндометриоза.

Односторонняя родами. У женщин ГС беременность не насту тубэктомия произведена 4 (20%) пациенткам пила ни в одном случае. Таким образом, у жен ОГ и 2 (18,2%) КГ. Учитывая высокую частоту щин, оперированных с применением ЛЭ при рецидива гидросальпинкса после сальпинго- гидросальпинксах и выраженном спаечном неостомии, по данным литературы, в нашем процессе, метод позволил достичь беремен исследовании мы не производили данный вид ности в 20% случаях и избежать рецидива оперативного вмешательства. ЛЭ маточных заболевания, а при отсутствии беременности труб выполнена пациенткам ОГ, а в КГ не про- нет необходимости в дополнительной опера водилась. Длина гидросальпинксов колебалаья тивной подготовке для применения вспомога от 5 до 10 см, в среднем составила 8±0,5 см, тельных репродуктивных технологий. ЛЭ при а поперечный размер колебался от 1 до 3 см, гидросальпинксах дает возможность иссле в среднем составил 2±0,5 см. В 11 случаях довать маточные трубы на всем протяжении гидросальпинкс был небольших размеров до маточного угла, определить локализацию с незначительным содержимым в маточной фимбриального отдела, точно определить фим трубе. При гидросальпинксах после разделения бриальный отдел маточной трубы и выполнить спаек и мобилизации маточной трубы, с уче- адекватное хирургическое вмешательство — том ее извитости, отечности, целью ЛЭ было сальпингостомию.

отслеживание хода маточной трубы по нахо- Результаты выполненных исследований дящемуся в ней гипоэхогенному или анэхоген- показали, что при гидросальпинксах в сочета ному содержимому до фимбриального отдела, нии с выраженными спайками и с вовлечением с визуализацией фимбрий, определение места в спаечный конгломерат смежных органов для проведения сальпингостомии без повреж- ЛЭ позволяет более четко определить объем дения стенок маточной трубы. Анализ сравни- хирургического вмешательства, обеспечить тельных данных ТВЭ и ЛС в выявлении гидро- его безопасность, а также сохранить придатки сальпинкса показал, что ложноположительный у молодых женщин с нереализованной репро результат был получен у 3 (2,3%) женщин. дуктивной функцией.

новыЕ тЕхнолоГИИ в ДИаГностИкЕ И лЕчЕнИИ ГИнЕколоГИчЕскИх заболЕванИй G. v. Nanagyulyan, A. K. Khachatryan и физически здоровыми сверстницами анало LApAROSCOpIC RECONSTRuCTIvE pLASTIC гичного возраста. Всем пациенткам, было про OpERATIONS FOR HYDROSALpINX WITH THE ведено полное клинико-лабораторное обсле дование с оценкой гормонального профиля uSE OF INTRAOpERATIvE LApAROSCOpIC и проведением УЗИ в динамике менструаль uLTRASOuND IN WOMEN WITH ного цикла. Проведена статистическая обра TuBAL INFERTILITY ботка полученных результатов.

Research Center of Obstetrics, Gynecology and Perinatology Причиной обращение всех пациенток яви Moscow, Russia лось бесплодие, причем у 26 (57,8%) пациенток I Intraoperative laparoscopic sonography dem- группы было выявлено первичное бесплодие, onstrates high resolution and helps to determine в то время как 35 (74,5%) пациентки II группы surgery approach in patiens with hydrosalpinx and страдали от бесплодия вторичного. При про complex cystic mass with solid component. It`s ведении анализа данных УЗИ органов малого secure and it allows to preserve adnexes in women таза на 5–7 день цикла не было обнаружено of reproductive age. достоверных различий от группы контроля.

Данные уровня эстрадиола на 21–23 день мен струального цикла значительно превосходили во II группе больных (608,2+44,06 пмоль/л), р. а. саидова, Е. в. воробьева что достоверно отличалось от I группы Cтруктура ЭнДокрИнных форМ (439,8+33,34 пмоль/л), р0,01 и группы бЕсплоДИя у жЕнщИн срЕДнЕГо контроля (471,1+33,05 пмоль/л), р0,05.

И позДнЕГо рЕпроДуктИвноГо возраста Уровень прогестерона в лютеиновую фазу Первый Московский Государственный Медицинский Университет цикла в обеих группах (27,85+3,632 нмоль/л, им. И. М. Сеченова, Кафедра акушерства и гинекологии МПФ 25,02+3,013 нмоль/л) был ниже показателя Москва, Россия контрольной (52,31+2,101 нмоль/л) и отли Эндокринное бесплодие является одним чался с высокой степенью достоверности из наиболее частых и сложных форм женского (р0,001). На основании данных УЗИ и гормо бесплодия, имеющее многообразные клиниче- нального исследования периферической крови ские, морфологические и биохимические про- у пациенток I группы выявлен нормоэстро явления, в основе которых лежат нарушения генный тип нарушения с тенденцией к гипо процесса овуляции и менструального цикла. эстрогенному: у 20 (44,4%) пациенток была Кроме этого, известно, что структура нару- определена гипопрогестероновая НЛФ, у шений репродуктивной функции и конечный (24,4%) — нормоэстрогенная ановуляция, и у результат лечения, напрямую зависит от воз- (17,8%) женщин — гипоэстрогенная ановуля раста женщины. Выделение формы и типа нару- ция. Во II группе женщин превалируют состоя шения репродуктивной функции, безусловно, ния относительной и абсолютной гиперэстроге важно для проведения адекватной, патогене- нии, при этом у 29 (61,7%) пациенток выявлена тически обоснованной терапии. Именно такой гипопрогестероновая НЛФ, у 10 (21,3%) — подход в лечении данного контингента боль- гиперэстрогенная ановуляция.. Среди нару ных позволяет добиться хороших результатов. шений процесса овуляции у большинства С целью определения структуры форм эндо- обследуемых I клинической группы был выяв кринного бесплодия в зависимости от репро- лен синдром хронической ановуляции — у дуктивного возраста и совершенствования (26,7%), отсроченная овуляция диагностиро принципов патогенетически обоснованного вана у 9 (20%), синдром неовулировавшего лечения, нами были обследованы 92 женщины фолликула — у 6 (13,3%), преждевременный от 25 до 44 лет, имеющих в анамнезе первич- выбор доминантного фолликула — у 5 (11,1%).

ное или вторичное бесплодие: I группа — Во II группе пациенток превалировали наруше 45 пациенток среднего репродуктивного пери- ния по типу преждевременного выбора доми ода от 25 до 34 лет (средний возраст 29,76 + нантного — у 23 (48,9%), синдром хронической 0,42 лет), II группа — 47 пациенток позднего ановуляции, отсроченная овуляция и синдром репродуктивного периода от 35 до 44 лет (сред- неовулировавшего фолликула зафиксированы ний возраст 38,52 + 0,43 лет). Группу контроля у 3 (6,4%), у 2 (4,3%) и у 1 (2%) пациентки, составили 30 относительно здоровых женщин соответственно.

репродуктивного возраста от 20 до 40 лет (сред- Таким образом, оценка формы (НЛФ и ано ний возраст 29,34 + 1,25 лет) репродуктивно вуляция) и типа нарушения репродуктивной NEW TECHNOLOGIES FOR DIAGNOSIS AND TREATMENT OF GYNECOLOGIC DISEASES системы (гиперэстрогенный, нормоэстроген- бесплодия и у обследованных с сохраненными ный, гипоэстрогенный) в зависимости от воз- воспалительно-измененными маточными тру раста у женщин, страдающих бесплодием, бами.

позволяет осуществить анализ превалиру- Согласно современным представлениям ющего звена повреждения репродуктивной (N. Gleicher, A. Weghofer, 2011), нами был изу системы, дать прогноз для восстановления мен- чен тотальный овариальный резерв (фоллику струальной и генеративной функции, а также ляный запас и фолликулогенез) 64 пациенток провести выбор патогенетически обоснован- с трубным и трубно-перитонеальным факто ной коррекции нарушений, приводящей к вос- рами бесплодия. В 1 группу вошли 30 пациен становлению менструальной функции и насту- ток, которым была произведена двусторонняя плению желанной беременности. тубэктомия в анамнезе. Во 2 группу включены 34 больные с воспалительно-измененными маточными трубами. Контрольную группу составили 30 практически здоровых жен R. A. Saidova, E. v. vorobyeva щин с мужским фактором бесплодия. Возраст THE STRuCTuRE OF ENDOCRINE FORMS всех наблюдаемых больных варьировал OF INFIRTILITY IN WOMEN OF MIDDLE AND от 23 до 40 лет. С целью изучения овариального LATE REpRODuCTIvE AGE резерва использовали 2D и 3D сканирование The First Moscow Sechenov State Medical University, на аппарате «VOLUSON — 730 Expert» (GE Kretz, Department of Obstetrics and Gynecology PMF Zipf, Австрия) с трансвагинальным датчиком Moscow, Russia (3,3 и 10,0 MHz) по стандартной методике.

Determination of endocrine status during Определяли объем яичника (V, см), количе examination of infertile couple occupies a lead- ство антральных фолликулов (АФ), интенсив ing position. The reproductive system with ages is ность и плотность интраовариальной перфу undergoing significant changes due to age as a зии (FI, VI) на 5 день менструального цикла.

reorganization of the organism, influence of vari- При исследовании фолликулогенеза в I и II фазу ous exogenous (environmental, pharmaceutical менструального цикла оценивали формирова and others) and endogenous factors (extragenital ние доминантного фолликула и желтого тела.

diseases). Определение уровня Антимюллерова гормона (АМГ) проводилось методом иммунофермент ного анализа. Всем пациенткам программа ЭКО проводилась по стандартной схеме.

а. а. соломатина, Д. а. сафронова, При изучении овариального резерва паци а. в. коновалова, о. в. братчикова, с. п. балицкий енток 1 группы установлено, что объем яич оварИальный рЕзЕрв у пацИЕнток ника (V=5,6+0,5 см), количество антраль с разлИчныМИ вИДаМИ трубно ных фолликулов (АФ=6,2+1,1) и показатели пЕрИтонЕальноГо бЕсплоДИя интраовариального кровотока (FI=26,7+2,2, ГОУ ВПО "Российский государственный медицинский универси VI=1,6+0,5) были в 1,3–1,4 раза ниже в срав тет Росздрава";

Кафедра акушерства и гинекологии педиатриче нении с наблюдаемыми во 2-й и контроль ского факультета, Москва, Россия ной группе (V=8,1+0,9 см;


В структуре бесплодного брака 50–60% FI=32,1+2,7;

VI=2,5+0,6). Уровень АМГ в 1-й составляет женское бесплодие, ведущей при- группе варьировал от 1 до 2,5, составляя, в сред чиной которого является поражение маточных нем, 2,1+0,4 нг/мл, во 2-й группе концентра труб — 30–74% всех форм нарушения репро- ция АМГ соответствовала контрольной группе дуктивной функции (Калинина Е. А. 2005;

(3,6+0,3 нг/мл). Исследование фолликулоге Ускова М. А., 2009). Однако вопрос о целесоо- неза в 1 группе выявило нарушение формирова бразности предварительного удаления воспа- ния доминантного фолликула, проявляющееся лительно-измененных маточных труб для улуч- запоздалой овуляцией на 18–20 день менстру шения результативности лечения методом ЭКО ального цикла и недостаточной перфузией жел в настоящее время остается дискутабельным того тела (FI=22,7+2,2, VI=1,3+0,5) у каждой (Standell A., 2002.;

La Combe J., 2003., Bontis третьей наблюдаемой. Во 2 группе нарушения JN., 2006). фолликулогенеза имели место только у 3 (8,8%) Целью нашего исследования явилось изучить пациенток. При анализе результативности ЭКО морфо-функциональное состояние яичников и течение беременности в первом триместре, у пациенток с абсолютным трубным фактором нами выявлено, что частота наступления бере новыЕ тЕхнолоГИИ в ДИаГностИкЕ И лЕчЕнИИ ГИнЕколоГИчЕскИх заболЕванИй в. Ю. смольникова, Д. Ю. трофимов, менности на перенос эмбриона в 1 группе — о. Е. краснощока, о. в., бурменская, Е. а. калинина (20,6%), что ниже в 1,6 раза показателей вто МолЕкулярно-ГЕнЕтИчЕскИй профИль рой группы — 10 (33,3%). В то же время количе образцов фоллИкулярной жИДкостИ, ство эмбриональных потерь в 1-й группе было минимальным 1 (3,3%) по сравнению со 2-й получЕнных прИ провЕДЕнИИ группой — 6 (20,0%).

проГраММ врт прИ сЕлЕктИвноМ Таким образом, у пациенток с удаленными пЕрЕносЕ оДноГо ЭМбрИона маточными трубами (1 группа) показатели ова Отделение вспомогательных технологий в лечении бесплодия, риального резерва были ниже, чем у пациенток Отделение молекулярно-генетических методов 2 групы, что сопровождалось нарушением фол- ФГУ «Научный центр акушерства, гинекологии и перинатоло гии имени акад. В. И. Кулакова» Минздравсоцразвития России, ликулогенеза и меньшей частотой наступления Москва, Россия беременности. Однако, благоприятный исход Необходимость выявления предикторов первого триместра беременности у наблюдае компетентности гамет и эмбрионов дикту мых 1 группы лучше, что, по нашему мнению, ется базовой клинической стратегией лече обусловлено отсутствием хронического вос ния бесплодия — максимум эффективности палительного процесса, который может обла с минимальным риском, что крайне актуально дать вредным инфекционным или иммуноло для программ селективного переноса одного гическим эффектами на эмбрион. Результаты эмбриона (eSET).

проведенного исследования, с определенной В репродуктивной медицине человека важ долей вероятности, все-таки позволяют сделать ным является создание условий для повышения вывод об обоснованности двустороннего удале имплантационного потенциала эмбриона. При ния скомпроментированных маточных труб.

проведении программ ВРТ актуальным оста ется получение наиболее качественных ооци тов с целью получения эмбрионов, имеющих а. а. Solomatina, D. A. Safronova, A. v. Konovalova, максимальный шанс для успешной имплан O. v. Bratchikova, S. p. Balitskii тации и развития. Качество эмбриона опреде OvARIAN RESERvE OF pATIENTS WITH ляется многими факторами: генетическими, TuBAL INFERTILITY условиями культивирования, а также состо Russian State Medical University янием рецепторного аппарата эндометрия Department of Obstetrics and Gynecology of Pediatric Faculty, Moscow, Russia в период имплантации.

Перспективным для программ ВРТ с учетом We have analyzed 64 patients with tubal-peri- является разработка и внедрение персонифи toneal factors of infertility (34) and after bilateral цированных методов неинвазивной диагно tubectomy (30). We used 3-D ultrasound in mea- стики качества гамет и эмбрионов с целью suring ovarian volume, antral follicle and stro- повышения эффективности лечения бесплодия mal blood flow. AMH was also investigation. IVF методом ЭКО и ПЭ при eSET.

was performed in all 2 groups. We concluded that В процессе оогенеза внутри фолликула про patients with no fallopian tubes (1 group) had исходит взаимодействие ооцита и окружаю the lowest rate of pregnancy, but minimal embryo щего комплекса кумулюсных клеток путем losses. While the patients with inflammatory- интерцеллюларного влияния через ряд регу changed fallopian tubes (2 group) had higher range ляторных молекул, к которым можно отнести of embryo losses. The study proved the necessity of некоторые цитокины, факторы роста, антиа bilateral tubectomy prior to IVF. поптотические факторы. На успешное развитие ооцита, а в последующем и эмбриона, влияет качественный и количественный состав фол ликулярной жидкости. Полноценность ооцита зависит от микроокружения, изменение в био активности гранулезных клеток может отра жать качество ооцита и дальнейшее развитие эмбриона Многими авторами производится поиск предикторов, которые позволили бы предсказывать наиболее точно успешность проведения программ ВРТ, однако до сих пор остается актуальным вопрос о принципиаль NEW TECHNOLOGIES FOR DIAGNOSIS AND TREATMENT OF GYNECOLOGIC DISEASES ном наличии или отсутствии таковых в фолли- от рецептивности эндометрия определять успех кулярной жидкости. имплантации. Поиск прогностически значи Цель. Определение взаимосвязи уровня экс- мых показателей в фолликулярной жидкости, прессии мРНК некоторых факторов роста и их их комбинация с морфометрическими дан рецепторов, цитокинов, факторов апоптоза ными, позволят выбрать для селективного в фолликулярной жидкости с результатами переноса наиболее перспективные для успеш лечения бесплодия методами ВРТ. ной имплантации эмбрионов.

Материал и методы. В исследование вклю- Таким образом, изучение роли мРНК ооцит чено 31 пациентка программ ВРТ, которым кумулюсного комплекса путем определения производился eSET. Критерии включения экспрессии некоторых цитокинов, факторов в исследование: трубно-перитонеальный фак- роста, антиапоптотических факторов позволит тор бесплодия, возраст пациентки не более более детально оценить молекулярно-генетиче 35 лет, число предшествующих циклов ЭКО ский профиль фолликулярной жидкости и про и ПЭ не более 2, нормальный овариальный гнозировать исход программ ВРТ при селектив резерв. Критерии исключения: эндометриоз ном переносе одного эмбриона.

любой локализации, миома матки больших размеров, патология спермы супруга высокой степени. Стимуляция суперовуляции проводи- v.Yu.Smolnikova, D.Yu. Trofimov, O. E. Krasnoschoka, лась по стандартному «длинному» протоколу. O. v. Bourmenskaya, E. A. Kalinina Образцам фолликулярной жидкости, собран- MOLECuLAR pROFILING OF ным во время трансвагинальной пункции яич FOLLLICuLAR FLuID SELECTIvE ников индивидуально от каждого фолликула FACTORS AND RELATIONSHIp в отдельные пробирки, присваивался номер, WITH EMBRYO IMpLANTATION IN соответствующий номеру эмбриона, произво WOMENuNDERGOING ICSI-ESET дилась криоконсервация при температуре –70 С. Оплодотворение методом ИКСИ, индивиду- IVF Department, Laboratory of Molecular Genetics Research Centre for Obstetrics, Gynecology and Perinatology named альное культивирование эмбрионов, перенос after V. I. Kulakov;

Ministry of Health and Social Development of одного эмбриона в полость матки на 5 сутки. Russian Federation, Moscow, Russia Для оценки профиля изучаемых факторов Objective. Concentration of certain sub в образце фолликулярной жидкости, соответ stances in follicular fluid may be related to fertil ствующем номеру перенесенного эмбриона, ization outcome. The study aim was to identify использовался метод полимеразной цепной follicular fluid markers which could help to pre реакции в реальном времени оценивается экс dict embryo implantation potential. Material and прессия мРНК.

methods. Concentration of selected growth fac Результаты. В 7 случаях из 31 при селектив tors, cytokines, apoptotic factors in follicular fluid ном переносе одного эмбриона наступила samples obtained during assisted reproduction беременность. Частота наступления беремен treatment ICSI were related with treatment out ности в расчете на перенос эмбриона составила comes. Results. Mean concentration of IGFBP2, 22,5%. При оценке молекулярно-генетического HBEGF, BCL-2, LIF — were significantly higher in профиля ооцит-кумулюсного комплекса в зави treatment attempts leading to a clinical pregnancy симости от исхода лечения нами была выявлена as compared with those in which no pregnancy тенденция к более высокой экспрессии мРНК was established. IGF-1, IGF-2, LIFR, HAS-2 con при наступлении беременности для связыва centrations are similar in unsuccessful attempts.

щих инсулиноподобные факторы роста проте Conclusion. Fertilization outcomes were related to инов 2 типа (IGFBP2), гепаринсвязывающего molecular profiling of follicular fluid markers.

эпидермального фактора роста (HBEGF), инги битора апоптоза-2 (BCL-2), лейкем-ингибиру ющего фактора (LIF) и некоторых других. Для соматомединов (IGF –1, IGF-2), рецептора LIF, гиалурансинтазы-2 (HAS-2) показано обратное соотношение.

Полученные данные позволяют предполо жить о дифференцировании молекулярно-гене тического профиля фолликулярной жидкости и до периода имплантации вне зависимости новыЕ тЕхнолоГИИ в ДИаГностИкЕ И лЕчЕнИИ ГИнЕколоГИчЕскИх заболЕванИй т. а. федорова, а. с. очан, Э. М. бакуридзе, покоя на 18% и снижение количества активи л. б. киндарова, а. с. айрапетян рованных клеток на 17%. Во 2 группе женщин влИянИЕ плазМафЕрЕза на состоянИЕ контрольное исследование системы гемостаза сИстЕМы ГЕМостаза у пацИЕнток проводилось после проведения соответству ющей медикаментозной коррекции у 22% с трубно-пЕрИтонЕальныМ больных в связи с выявлением общей гиперко бЕсплоДИЕМ в поДГотовкЕ к проГраММЕ агуляции, гиперфункции тромбоцитов, акти ЭкстракорпоральноГо оплоДотворЕнИя вации ВСК и активности ВА. Уровень содержа ФГУ «НЦ АГ и П им. В. И. Кулакова» Минздравсоцразвития РФ, ния ТАТ снижался лишь на 19%, PF4 на 24%.

Москва, Россия Положительные паракоагуляционные тесты Цель исследования: Оценка влияния плазма- после проведения гепаринотерапии сохраня фереза (ПА) на показатели системы гемостаза лись у 40% женщин. ВА выявлялся у 36% боль у пациенток с трубно-перитонеальным беспло- ных. В связи с недостаточным эффектом от про дием в подготовке к программе экстракорпо- водимой антикоагулянтной и гормональной рального оплодотворения (ЭКО). терапии у половины больных данной группы Группу исследования составили 112 больных, потребовалось продолжение курса медика отобранных по следующим критериям: трубно- ментозного лечения. Оценка клинической перитонеальная форма бесплодия;

отсутствие эффективности проведения ЭКО показала, что других причин бесплодия;

наличие в анамнезе в группе женщин с использованием ПА в ком от 1 до 3 неэффективных попыток ЭКО;

отсут- плексной подготовке к программе частота ствие тяжелой экстрагенитальной патологии;

наступления беременности на 10% выше, чем возраст до 40 летВ 1 группе женщин (62 боль- в сравнительной группе. Частота репродуктив ных) в комплекс подготовки к ЭКО был вклю- ных потерь в этой группе была ниже в 1,5 раза.

чен курс ПА, состоящий из 3 процедур, проводи- В группе женщин, получавших медикаментоз мых с интервалом 1–3 дня. Во 2 группе женщин ную терапию перед проведением программы, (50 женщин) подготовка к ЭКО проводилась частота возникновения синдрома гиперстиму по традиционной схеме, включающей медика- ляции яичников (СГЯ) составила 28%. У жен ментозную коррекцию гемостазиологических щин основной группы (с использованием ПА) и аутоиммунных нарушений по общепринятым СГЯ развивался в 3,5 раза реже. Следует отме методикам. Женщины обследованы с исполь- тить тот факт, что в этой группе пациенток зованием клинических и лабораторных мето- наблюдалась только легкая и средняя степени дов исследования, включая прижизненную тяжести СГЯ, тогда как в сравнительной группе компьютерную фазометрию тромбоцитов. у 4% женщин развивался СГЯ тяжелой степени.

В результате исследования показано, что у жен- Таким образом применение ПА у больных с бес щин с трубно-перитонеальным бесплодием плодием способствует повышению эффектив в 70% случаев имеется суперкомпенсированная ности программы ЭКО, снижению репродук форма хронического ДВС-синдрома, проявляю- тивных потерь и частоты осложнений данной щаяся тромбинемией, повышением субстратов программы.

и кофакторов свертывания и относительной тромбоцитопатией потребления в результате хронической активации и изменения морфо- T. A. Fyodorova, A. S. Ochan, E. M. Bacuridse, функциональных свойств тромбоцитов. L. B. Kindarova, A. S. Ayrapetyan В 1 группе женщин, после проведения ПА, THE THERApEuTIC pLASMApHERESIS произошла стабилизация агрегации тром AND HEMOSTASIS SYSTEM IN pATIENTS боцитов на уровне 30% и снижение частоты WITH TuBO-pERITONEAL INFERTILITY выявления РКМФ на 70%. Клинически значи BEFORE IN vITRO FERTILIzATION (IvF) мым явилось повышение активности протеина pROGRAM & EMBRYO TRANSFER С на 25%. Элиминация ВА произошла у 82% женщин. Титр фактора Виллебранда после Research Centre of obstetrics, gynecology & perinatology named after acad. V. I. Kulakov процедур ПА титр снижался на 1–2 порядка. Moscow, Russia Наблюдалось выраженное снижение уровней The objective of this paper is to assess the role содержания ТАТ на 41% и PF4 на 35%. Влияние of the therapeutic plasmapheresis in patients with процедур плазмафереза нашло отражение в зна tubo-peritoneal infertility before in vitro fertiliza чительном изменении морфофункционального tion (IVF) program & embryo transfer The meth статуса тромбоцитов: увеличилось число форм NEW TECHNOLOGIES FOR DIAGNOSIS AND TREATMENT OF GYNECOLOGIC DISEASES ods of the investigation included evaluation of clinical symptoms, parameters of hemostasis, and the endometrium in patients with tubo-perito neal infertility before and after the course of the therapeutic plasmapheresis. It was demonstrated, that therapeutic plasmapheresis improves clini cal symptoms, improves parameters of hemostasis system and the condition endometrium in these patients. After the course of therapeutic plasma pheresis just before IVF-program the frequency of pregnancy in main group was 52% (in comparative group it was 40%).

новыЕ тЕхнолоГИИ в ДИаГностИкЕ И лЕчЕнИИ ГИнЕколоГИчЕскИх заболЕванИй Глава 11. возМожностИ новых тЕхнолоГИй в урГЕнтной ГИнЕколоГИИ CHApTER 11. NEW TECHNOLOGIES IN THE TREATMENT OF uRGENT GYNECOLOGICAL pATHOLOGY л. в. адамян, И. с. чернова, а. в. козаченко с применением метотрексата (в/в болюсно) рЕпроДуктИвная функцИя жЕнщИн и лейковарина (в/м). Суммарная доза вводи послЕ лЕчЕнИя ЭктопИчЕской мого метотрексата колебалась от 200 до 300 мг в зависимости от массы тела женщины и срока бЕрЕМЕнностИ разлИчной гестации. У 12 пациенток удалось добиться локалИзацИИ снижения кровотока (по данным УЗИ с допле ФГУ НЦ АГиП им. В. И. Кулакова Минздравсоцразвития России, ровским картированием), удалить плодное Москва, Россия яйцо петлей гистерорезектоскопа и сохранить Эктопическая беременность до настоящего матку. Все случаи закончились прерыванием времени является одной из основных проблем беременности, подтвержденным падением акушерства и гинекологии. Обусловлено это уровня в-ХГЧ. Во время проведения гистеро стабильно высокой частотой эктопической резектоскопии в половине случаев отмечалась беременности в структуре неотложных состо- повышенная кровоточивость из ложа хориона, яний в акушерстве и гинекологии. Более того потребовавшее коагуляции шаровидным элек за последнее десятилетие отмечена тенденция тродом.

к неуклонному росту частоты внематочной В 2 случаях была произведена гистерэктомия беременности во всем мире. без придатков: в одном — ввиду развития про Нами проведен анализ 127 случаев хирурги- фузного кровотечения в связи с прорастанием ческого лечения женщин с внематочной бере- ворсинами хориона шейки матки и стенки менностью, находившихся в отделении опера- влагалища, в другом — из-за большого срока тивной гинекологии Центра с 2003 по декабрь шеечной беременности (до 9 недель гестации) 2008 года. При анализе особенностей локали- у больной с реализованной генеративной функ зации плодного яйца беременность в маточной цией.

трубе была у 110 пациенток (86,6%), из них При анализе репродуктивной функции трубная беременность после ЭКО у 30 пациен- у 74 женщин после лечения эктопической бере ток;

шеечная беременность — у 17 (13,4%). менности (66 с трубной и 8 с шеечной локали У изученного нами контингента больных зацией плодного яйца) получены следующие трубной беременностью во всех случаях опе- результаты: из числа пациенток, проопери рации были выполнены лапароскопическим рованных по поводу трубной беременности, доступом. В 41 случае (37,2%) была проведена у 18 с туботомией в анамнезе эктопическая тубэктомия, в 69 случаях (62,7%) проведено беременность возникла повторно;

у 33 паци органосохраняющее лечение — туботомия, уда- енток наступила беременность, закончивша ление плодного яйца, санация брюшной поло- яся родами;

у 3 женщин из 8 прооперирован сти. Удаление маточной трубы выполнялось ных по поводу шейной локализации плодного ввиду перенесенных ранее операций на трубах, яйца, наступила беременность, закончившаяся разрыва трубы, желания женщины подвер- родами.

гнуться стерилизации. В ряде случаев хирурги- Таким образом, использование современных ческое лечение трубной беременности сопро- технологий в лечении женщин с эктопической вождалось сочетанными вмешательствами беременностью, в т. ч. шеечной, позволяет на органах малого таза: миомэктомия — сохранить и восстановить репродуктивную в 16 случаях (14,5%), коагуляция и иссечение функцию в большинстве случаев.

очагов эндометриоза — в 36 (32,7%), резекция яичников — в 20 (18,1%), разделение спаек в малом тазу в 45 (40,9%).

У 14 (12,7%) больных шеечной беремен ностью, с целью сохранения детородной функции, применялась комплексная терапия NEW TECHNOLOGIES FOR DIAGNOSIS AND TREATMENT OF GYNECOLOGIC DISEASES L. v. Adamyan, I. S. Chernova, A. v. Kozachenko При мониторинге уровня бета ХГЧ у 93% WOMEN’S REpRODuCTIv FuNCTION AFTER пациенток отмечалось снижение уровня, TREATMENT OF ECTOpIC pREGNANCY вплоть до негативных концентраций, а у 7% Scientific Centre for Obstetrics, Gynecology and Perinatology, Moscow, пациенток уровень бета ХГЧ нарастал и у 5,7% Russia появились симптомы прерывающейся труб 127 patients with ectopic pregnancy were ной беременности, всем им была проведена enrolled in the study. Among them 110 had tubal лапароскопия диагностическая с переходом localization, 17 cervical pregnancy. на хирургическую, объем выполненных опе The authors evaluated the effectiveness of mod- раций — туботомия — 27,7%;

тубэктомия — ern approaches and technologies in the preserva- 15%;

выдавливание плодного яйца — 57,3%.

tion of reproductive function. Остальные пациентки после проведенного консервативного лечения были выписаны из стационара в удовлетворительном состоя нии, из них 63,7% пациенткам через 3–6 меся н. в. анисимова, о. И. нехаева, в. б. зубенко цев проведена контрольная лапароскопия, при соврЕМЕнныЕ особЕнностИ лЕчЕнИя этом в 58% патологии в малом тазу не было ЭктопИчЕской бЕрЕМЕнностИ выявлено, в 42% выявлен спаечный процесс Кафедра акушерства и гинекологии СтГМА;

Ставропольский и проведен сальпингоовариолизис.

краевой клинический перинатальный центр, Ставрополь, Россия Таким образом, при своевременной диагно Проблема ранней диагностики и оказания стике прогрессирующей трубной беременно своевременного лечения при эктопической сти у пациенток, нуждающихся в максимально беременности сохраняет свою актуальность. возможном сохранении репродуктивной функ Медикаментозное лечение трубной беременно- ции, возможно успешное консервативное лече сти является альтернативной хирургическому ние метотрексатом.

лечению у определенной группы пациенток.

Цель исследования: оптимизация оказания медицинской помощи при внематочной бере- N. v. Anisimova, O. I. Nekhaeva, v. B. zubenko менности. MODERN FEATuRES OF TREATMENT OF За 2010 г. в гинекологическом отделении ECTOpIC pREGNANCY СККПЦ обследовано 95 пациенток с прогрес- Department of Obstetrics and Gynecology of Stavropol state medical сирующей трубной беременностью. У всех academy Stavropol Regional Clinical Perinatal Center,Stavropol, Russia пациенток отсутствовали симптомы «острого Drug treatment of tubal pregnancy is an alter живота». С диагностической целью использова native to surgical treatment for certain groups of лись: эхография органов малого таза трансабдо patients.

минальная и трансвагинальная с применением Objective: to optimize care for ectopic preg импульсного допплера с цветным кортирова nancy. With early diagnosis of progressive tubal нием, диагностический мониторинг бета ХГЧ pregnancy of patients requiring the maximum pos в крови. По результатам УЗИ органов малого sible preservation of reproductive function, the таза в 100% была исключена маточная бере successful conservative treatment with methotrex менность и был установлен диагноз «прогрес ate is possible.

сирующая трубная беременность». Исходный уровень ХГЧ не превышал 5000 мМЕ/мл, в 72,5% пациенток показатели его были в пре делах 300–1300 мМЕ/мл. При выборе лечения в. в. востриков, Е. а. Маркова т. а. кузнецова, использовалась система оценки по баллам- т. И. Горбачева индекс Фернандеса. ГЕтЕротопИчЕская бЕрЕМЕнность послЕ После принятия решения о консервативном Эко (клИнИчЕскИй случай) лечении метотрексатом, лечение проводилось Кафедра акушерства и гинекологии № по следующей схеме — однократное введение ГОУ ВПО «Алтайский Государственный Медицинский Универ ситет»;

ООО «Сибирский институт репродукции и генетики 50 мг метотрексата в/м с последующим мони человека», Барнаул, Россия торингом бета ХГЧ и многократное введение Экстракорпоральное оплодотворение зани (кратность зависит от последующего уровня мает ведущее место в преодолении бесплодия.

бета ХГЧ;

от 2 до 5 инъекций). Побочных ток Наряду с накоплением опыта и решением про сических действий химиопрепарата не испы блем повышения эффективности данных про тывала ни одна из больных.

новыЕ тЕхнолоГИИ в ДИаГностИкЕ И лЕчЕнИИ ГИнЕколоГИчЕскИх заболЕванИй цедур, встают вопросы анализа их осложне- ных желтых тел. В области культи правой трубы ний, одним из которых является внематочная с переходом на заднюю стенку матки обнару беременность. За десятилетний период работы жена кровоточащая ткань синюшно-багрового Сибирского института репродукции и генетики цвета 7х4х4 мм, расцененная как эктопическое человека частота эктопической беременности плодное яйцо. Ложе образования ограничено после ЭКО составила 3%. сальником, подпаянным к углу и задней поверх Наибольшие трудности в диагностике внема- ности матки. Задний свод прикрыт спайками.

точной беременности возникли в четырех слу- Проведено удаление эктопического плодного чаях гетеротопических беременностей у паци- яйца и коагуляционный гемостаз ложа. Диагноз енток с удаленными маточными трубами. подтвержден гистологически. В послеопераци Ниже приведенный клинический случай онном периоде проводилась антианемическая отражает диагностические и тактические слож- и пролонгирующая беременность терапия.

ности указанных осложнений. Пациентке М., Пациентка выписана на 10 сутки с прогресси 31 года, в связи с вторичным трубным бес- рующей беременностью.

плодием (маточные трубы удалены ранее Таким образом, представленный случай по поводу внематочных беременностей) про- демонстрирует сложность диагностики гете ведена индукция овуляции меногоном. При ротопической беременности после программ трансвагинальной пункции получены 12 ооци- ЭКО у пациенток с удаленными маточными тов, оплодотворенных при ЭКО сперматозо- трубами. Вероятность подобных осложнений идами мужа. На третьи сутки культивирова- должна учитываться при ведении ранних сро ния в полость матки перенесено 3 эмбриона. ков беременности у данных женщин.

Проведена стандартная медикаментозная поддержка посттрансферного периода. Через две недели диагностирована биохимическая v. vostrikov, E. Markova, T. Kuznetsova, беременность. При последующем наблюдении T. Gorbacheva на 24 день после эмбриотрансфера в полости A CASE OF HETEROTOpIC pREGNANCY матки обнаружено одно плодное яйцо с серд AFTER IvF цебиением эмбриона. Пациентка направлена Altai State Medical University, на обследование для диспансерного наблюде- Siberian Institute of Human Reproduction and Genetics Barnaul, Russia ния. Через неделю на фоне нарастающей сла Ectopic pregnancy rate after IVF was ana бости, тошноты появились головокружение, lyzed. We present a case of heterotopic pregnancy рвота, умеренные боли внизу живота. При осмо after IVF and end embryo transfer in patient with тре: кожные покровы бледные, влажные, уме bilateral tubectomy in her history. It’s pointed out ренная тахикардия и гипотония. Температура at some features of management and high risk to 37.6 С. Живот мягкий, с признаками раздра misdiagnose heterotopic pregnancy.

жения брюшины в гипогастральной области, больше справа. При ультразвуковом сканиро вании обнаружена прогрессирующая маточ ная беременность, двустороннее увеличение а. И. Давыдов, в. с. попова яичников за счет множества тека-лютеиновых ДИаГностИчЕская цЕнность кист, незначительное количество свободной тЕстИрованИя хорИонИчЕскоГо жидкости в правом боковом фланге. В ана ГонаДотропИна И крЕатИнкИназы лизе крови лейкоцитоз — 18х10, гемоглобин в сывороткЕ кровИ у больных трубной 118 г/л. Больная направлена в хирургическое бЕрЕМЕнностьЮ отделение ургентного стационара с подозре нием на острый аппендицит. При поступлении Кафедра акушерства, гинекологии и перинатологии Первого Московского государственного медицинского университета для исключения внутрибрюшного кровоте- имени И. М. Сеченова, Москва, Россия.

чения проведена трансвагинальная пункция Внематочная (трубная) беременность брюшной полости. Получен серозный пунктат.

по-прежнему остается одной из причин мате С подозрением на острый аппендицит больная ринской смертности во всем мире. С широким взята на лапароскопию. В ходе обследования распространением высокоинформативных обнаружено: в брюшной полости до 1500 мл методов диагностики частота «тяжелых» кли крови со сгустками. При ревизии малого таза — нических форм трубной беременности зна обе маточные трубы отсутствуют. Яичники уве чительно уменьшилась. Тем не менее, поиск личены за счет множества кистозно изменен NEW TECHNOLOGIES FOR DIAGNOSIS AND TREATMENT OF GYNECOLOGIC DISEASES новых неинвазивных маркеров эктопиче- трофобласта. Вместе с тем, этот фермент явля ской нидации трофобласта не прекращается ется достаточно надежным маркером трубного до настоящего времени. аборта. Важно уточнить, что нами не выявлена По данным литературы, помимо «традици- достоверная разность различий в секреции КК онного» определения уровня хорионического в зависимости от срока гестации прервавшейся гонадотропина в сыворотке крови (_-ХГЧ) трубной беременности.

практическую ценность представляет изучение При сравнении ценности _-ХГЧ и КК в диа секреции креатинкиназы (КК). гностике эктопической беременности необ Нами выполнен про- и ретроспективных ходимо отметить, что увеличение титра _-ХГЧ анализ 48 историй болезней пациенток с нару- имеет прогностическое значение при динами шенной трубной беременностью по типу труб- ческом исследовании (хорошо известный тест ного аборта. Возраст обследованных больных удвоения). В то время как, сравнительно высо варьировал от 18 до 36 лет, составив в среднем кие значения КК (свыше 80 МЕ/л) уже при 22,4+1,6 лет. Во всех наблюдениях клиниче- однократном тестировании указывают на труб ская картина трубной беременности характе- ный аборт.

ризовалась «стертой» симптоматикой. В целом Выводы: определение КК в сыворотке крови длительность клинических проявлений забо- следует считать важным дополнительным био левания варьировала от нескольких дней логическим маркером трубной беременностиь;

до 2 месяцев, составив в среднем 16,9+0,9 суток. при прогрессировании беременности тестиро Тестирование биологических маркеров бере- вание КК не позволяет уточнить локализацию менности (_-ХГЧ, КК) осуществляли с помощью трофобласта, однако при трубном аборте срав наборов иммуноферментного анализа. нительно высокие значения фермента (свыше Учитывая широкое распространение в прак- 80 МЕ/л) являются надежным признаком тике тестирования _-ХГЧ при подозрении нарушения целостности беременной маточной на внематочную беременности, а также боль- трубы;

в отличие от тестирования _-ХГЧ, доста шое количество публикаций по данной про- точно однократного определения КК.

блеме, мы не ставили задачу дать клиническую оценку этому гормону как биологическому маркеру эктопической нидации трофобла- A. I. Davydov, v. S. popova ста. Вместе с тем, интерпретацию результатов DIAGNOSTIC vALuE OF TESTING CHORIONIC исследования КК оценивали в комплексе с изу GONADOTROpIN AND CREATINE KINASE IN чением _-ХГЧ.

BLOOD SERuM OF pATIENTS WITH ECTOpIC Известно, что КК успешно используется pREGNANCY в качестве маркера инфаркта миокарда, позво Department of obstetrics, gynecology & perinatology of I. M. Sechenov ляя оценить объем поражения сердечной First Moscow State Medical University, Moscow, Russia мышцы. Однако в последние годы этот маркер Level creatine kinase (CK) in a blood plasma применяется для диагностики трубной бере of patients with tubal abortion varies within менности. В наших исследованиях изучено 86–240 ME/L. Minimum value СK almost in содержание КК в сыворотке крови как больных 2 times exceed a zone, boundary for ectopic preg с нарушенной, так и прогрессирующей трубной nancy. However at advance of pregnancy testing CK беременностью.

does not allow to specify trophoblast localization.

Анализ результатов исследования устано вил, что уровень КК в сыворотке крови боль ных с трубным абортом находился в пределах 86–240 МЕ/л. Соответственно, минимальные значения этого показателя почти в 2 раза пре вышали зону, пограничную для эктопической нидации трофобласта. В то же время, при про грессировании трубной беременности содер жание КК у 6 из 10 пациенток варьировал от 44 до 57 МЕ/л. Приблизительно такие же вариации обнаружены у 12 женщин с физио логической беременностью. Следовательно, при прогрессировании беременности тестиро вание КК не позволяет уточнить локализацию новыЕ тЕхнолоГИИ в ДИаГностИкЕ И лЕчЕнИИ ГИнЕколоГИчЕскИх заболЕванИй с. И. киселев, М. Е. Матвиенко, М. н. Дудоладова, Больная 27 лет, направлена в ГКБ М. М. цикаришвили, М. в. питько № 15 из женской консультации с диагнозом:

ЭктопИчЕская бЕрЕМЕнность в рубцЕ Беременность 6 недель, не развивающаяся.

на МаткЕ послЕ опЕрацИИ кЕсарЕва Подозрение на внематочную беременность.

Жалоб при поступлении не было. Тест на бере сЕчЕнИя (клИнИчЕскоЕ наблЮДЕнИЕ) менность положительный, уровень -ХГЧ, нака Кафедра репродуктивной медицины и хирургии ФПДО МГМСУ, Городская клиническая больница № 15 им. О. М. Филатова, нуне госпитализации — 175 мМЕ/мл. Ранее Москва, Россия у больной была 1 беременность, которая закон Беременность в рубце на матке после опера- чилась родами путем операции кесарева сече ции кесарева сечения впервые была описана ния. Осложнений после операции не было. При в 1978 г., и до недавнего времени являлась осмотре отмечено некоторое увеличение матки и связанное с задней ее стенкой образование самым редким типом эктопической беремен ности. В период до 1998 г. сообщалось лишь до 6 см. При чрезвлагалищном ультразвуко о 6 клинических наблюдениях. В третьем тыся- вом исследовании констатировано отсутствие челетии в медицинской литературе ежегодно плодного яйца в полости матки и обнаружено появляется увеличивающееся число публика- неоднородное по эхогенности образование в области перешейка матки: 565 см. Уровень ций, касающихся имплантации плодного яйца -ХГЧ на 2 и 4 сутки госпитализации — в рубец на матке. Если к 2005 г. было описано 214 и 154 мМЕ/мл, соответственно. Учитывая около 40 клинических наблюдений, то к 2008 г.

наличие признаков неразвиваюшейся внема их число уже превысило сотню, а в настоящее точной беременности, была произведена лапа время ежемесячно выходит несколько статей, роскопия. При которой обнаружено образова посвященные этому патологическому состоя ние в перешейке матки под пузырно-маточной нию. Судя по их территориальной принадлеж складкой брюшины, расцененное как эктопи ности, в Юго-Восточной Азии и Китае наблюда ческая беременность. После удаления беремен ется эпидемия беременностей в рубце на матке ности с помощью вакуум-аспирации, возникло после кесарева сечения. В одной из китайских обильное наружное кровотечение, которое работ сообщается о 39 случаях гистероскопи потребовало вскрытия пузырно-маточной ческого лечения этого типа эктопической бере складки брюшины, ревизии и зашивания раны менности за период в 2,5 года в одном един на матке. Диагноз беременности был под ственном гинекологическом отделении.

твержден патоморфологическим исследова Опасностями имплантации плодного яйца нием. Уровень -ХГЧ на 6 сутки после операции в рубец считают возможность разрыва матки составил 12 мМЕ/мл.

в поздних сроках беременности и развитие Представленное клиническое наблюдение истинного приращения плаценты. Частота этих указывает на то, что проблема эктопической опасных, а иногда и катастрофических ослож беременности в рубце на матке после кесарева нений беременности в развитых странах неве сечения существует, но требует дальнейшего лика и составляет, соответственно, 0,07–0,1% изучения и, прежде всего, получения сведений и 0,04% от общего числа беременностей.

о течении беременности у пациенток, которым Существующая тактика ведения — удаление, никакие лечебные мероприятия в связи с уль или уничтожение плодного яйца на ранних ста тразвуковым диагнозом этого заболевания диях развития, вне зависимости от того, желан на ранних стадиях развития не проводились.

ная беременность или нет. Методы лечения многообразны. К настоящему времени исполь зовались: лечение системным и местным вве дением метотрексата, местным введением S. I. Kiselev, М. Е. Matvienko, М. N. Dudoladova, хлорида калия и гипертонического раствора М. М. Tsikarishvili, М. v. pitko глюкозы, вакуум-аспирация и выскабливание ECTOpIC pREGNANCY IN THE CESAREAN под гистероскопическим и лапароскопическим SECTION SCAR (CASE REpORT) контролем или без такового, резектоскопиче- Dept. Of Reproductive Medicine and Surgery MMSU, Filatov O. M. City ское удаление, лапароскопическое и лапарото- Clinical Hospital № 15, Moscow, Russia мическое иссечение с последующим зашива There is tremendous growth of publications нием раны миометрия.

number on cesarean scar pregnancy in recent med Ни один из авторов данного сообщения ical literature. A 27-year-old woman was admitted никогда не сталкивался с подобным типом to our hospital with a suspected ectopic pregnancy.

эктопической беременности.

NEW TECHNOLOGIES FOR DIAGNOSIS AND TREATMENT OF GYNECOLOGIC DISEASES Ultrasound revealed a well-encapsulated, bulging ной) беременностью все пациентки в возрасте mass within the anterior uterine isthmus in the от 18 до 42 лет были разделены на группы:

site of an old cesarean delivery scar. Serial -hCG в I группу вошла 21 женщина, у которых был levels matched pattern of non viable pregnancy. использован доксициклин (100 мг 2 раза в день Laparoscopy was performed to confirm the diagno- 7 дней) в послеоперационном периоде без sis, and revealed cesarean scar pregnancy. The ges- использования геля во время оперативного tational products were than removed by vacuum вмешательства, II группу составили 20 паци aspiration. Began severe bleeding required lapa- енток также без использования геля с назна roscopic intervention and suturing of the defect in чением цефалоспоринов интраоперационно the uterus. с продолжением их в послеоперационном периоде в течение 5 дней (цефотаксим по 1 г 2 раза в день), III группы больных — 13 паци енток с использованием геля Intercoat в соче в. Ю. лесовая, с. о. Дубровина, в. а. линде тании с доксициклином в той же дозировке, IV роль протИвоспаЕчных барьЕров группа — 10 больных, у которых был использо И антИбИотИков в прЕДотвращЕнИИ ван гель с цефалоспоринами. Объем оператив спаЕчноГо процЕсса у жЕнщИн ного вмешательства (тубэктомия или удаление с внЕМаточной бЕрЕМЕнностьЮ плодного яйца из просвета трубы с охранением ФГУ «Ростовский научно-исследовательский институт акушер маточной трубы) зависел от того как развива ства и педиатрии» Минздравсоцразвития РФ лась беременность — по типу трубного аборта, Ростов-на-Дону, Россия Любой воспалительный процесс или хирур- прогрессирующей беременности, наличия гическая манипуляция индуцирует неиз- разрыва маточной трубы. Спаечный процесс бежное повреждение брюшины, приводя- оценивался с использованием классифика щее к формированию спаек (Molinas C. R., ции American Fertility Society (AFS) 1988 года Binda M. M., Koninckx P. R., 2006). У женщин, и у всех пациенток был I–II степени, что дикто наблюдаемых в течение 49 месяцев после опе- вало необходимость разъединения спаек. Гель рации на маточных трубах, частота наступле- вводился согласно инструкции после контроля ния беременности обратно пропорционально гемостаза и санации брюшной полости физио коррелировала со степенью спаечного про- логическим раствором.

цесса согласно классификации Американского Необходимость оценки статуса спаечного Общества Репродуктивной Медицины (Marana процесса сводится к клиническому исследо R., Rizzi M., Muzii L. et al., 1995). Высокая ванию, когда “second look” является частью эффективность геля Intercoat была доказана стандартной медицинской помощи для паци при операциях по поводу внематочной бере- ентов (Diamond M. P., Wexner S. D., diZereg G. S.

менности лапароскопическим доступом, что et al., 2010). Однако сама по себе повторная доказано повторной лапароскопией (Белянова лапароскопия является хирургическим вмеша Э. А., Соколова Ю. А., Лукач А. А., Полянин Д. В. тельством (Gutt C., Oniu T., Schemmer P. et al., с соавт., 2011). Cистемные антибиотики широ- 2004), кроме того, сами пациентки часто отка кого спектра, в частности цефалоспорины, зываются от проведения повторной операции, широко используются в хирургической прак- что в совокупности затрудняет оценку резуль тике для предотвращения воспалительного тативности противоспаечных барьеров. В этой процесса как одного из факторов развития cвязи, second-look лапароскопия проведена спаечной болезни. Но на сегодняшний день у 14 пациенток в первой группе, у 20 — во вто нет достаточного количества опубликованных рой, у 7 в третьей группе и у 6 в четвертой.

исследований, подтверждающих правильность Спаечный процесс III–IV cтепени был диагно этой практики (Nappi C., Sardo A., Greco E. et al., стирован во II группе женщин, II–III степени в I 2007). группе, I–II в IV группе и I степени в III группе.

С целью уменьшения вероятности развития Таким образом, наилучшие результаты полу спаечного процесса у пациенток в трубной чены у пациенток при использовании доксици беременностью после оперативного вмеша- клина с гелем Intercoat.

тельства проведено исследование эффектив ности геля Intercoat в сочетании с различными антибиотиками.

Pages:     | 1 |   ...   | 7 | 8 || 10 | 11 |   ...   | 13 |

Похожие работы:

© 2013 www.libed.ru - «Бесплатная библиотека научно-практических конференций»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.