авторефераты диссертаций БЕСПЛАТНАЯ БИБЛИОТЕКА РОССИИ

КОНФЕРЕНЦИИ, КНИГИ, ПОСОБИЯ, НАУЧНЫЕ ИЗДАНИЯ

<< ГЛАВНАЯ
АГРОИНЖЕНЕРИЯ
АСТРОНОМИЯ
БЕЗОПАСНОСТЬ
БИОЛОГИЯ
ЗЕМЛЯ
ИНФОРМАТИКА
ИСКУССТВОВЕДЕНИЕ
ИСТОРИЯ
КУЛЬТУРОЛОГИЯ
МАШИНОСТРОЕНИЕ
МЕДИЦИНА
МЕТАЛЛУРГИЯ
МЕХАНИКА
ПЕДАГОГИКА
ПОЛИТИКА
ПРИБОРОСТРОЕНИЕ
ПРОДОВОЛЬСТВИЕ
ПСИХОЛОГИЯ
РАДИОТЕХНИКА
СЕЛЬСКОЕ ХОЗЯЙСТВО
СОЦИОЛОГИЯ
СТРОИТЕЛЬСТВО
ТЕХНИЧЕСКИЕ НАУКИ
ТРАНСПОРТ
ФАРМАЦЕВТИКА
ФИЗИКА
ФИЗИОЛОГИЯ
ФИЛОЛОГИЯ
ФИЛОСОФИЯ
ХИМИЯ
ЭКОНОМИКА
ЭЛЕКТРОТЕХНИКА
ЭНЕРГЕТИКА
ЮРИСПРУДЕНЦИЯ
ЯЗЫКОЗНАНИЕ
РАЗНОЕ
КОНТАКТЫ


Pages:   || 2 | 3 |
-- [ Страница 1 ] --

УКРАИНСКАЯ АКАДЕМИЯ АГРАРНЫХ НАУК

СЕЛЕКЦИОННО-ГЕНЕТИЧЕСКИЙ ИНСТИТУТ

на правах рукописи

КАЛЕНДАРЬ

РУСЛАН НИКОЛАЕВИЧ

УДК 575.11.113:633.16

ИССЛЕДОВАНИЕ МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКОГО

ПОЛИМОРФИЗМА ГЕНОМА ЯЧМЕНЯ

(HORDEUM VULGARE L.) МЕТОДОМ ПОЛИМЕРАЗНОЙ

ЦЕПНОЙ РЕАКЦИИ

03.00.26 - молекулярная генетика

Диссертация на соискание

ученой степени кандидата

биологических наук

Научный руководитель доктор биологических наук, профессор, член.-корр.УААН, Ю.М. Сиволап ОДЕССА - 1996 2 ОГЛАВЛЕНИЕ ВВЕДЕНИЕ 4 ГЛАВА 1. Исследование молекулярно-генетического полиморфизма с помощью молекулярных маркеров 1.1. Белковые маркеры 1.1.1. Особенности белковых маркеров 1.1.2. Применение белковых маркеров в генетико-селекционных исследованиях 1.1.3. Ограничения в использовании белковых маркеров 1.2. ДНК-маркеры 1.2.1. Полиморфизм длин рестрикцированных фрагментов ДНК (ПДРФ) 1.2.2. Особенности ПДРФ-маркеров 1.2.3. Применение ПДРФ-маркеров 1.2.4. Полиморфизм амплифицированных фрагментов геномной ДНК ГЛАВА 2. Материалы и методы 2.1. Используемый материал 2.2. Выделение высокомолекулярной растительной ДНК 2.3. Полимеразная цепная реакция 2.4. Синтез и очистка олигонуклеотидов 2.4.1. Очистка коротких (до 40 нуклеотидов) олигонуклеотидов на ОРС 2.4.2. Очистка 10-членных олигонуклеотидов 2.4.3. Очистка олигонуклеотидов в полиакриламидном геле 2.5. Электрофорез и идентификация изоферментов 2.6. Компьютерный анализ полученных результатов 2.6.1. Определение сцепления и картирование молекулярных маркеров с помощью программы “MAP_QTL” Постороение схем филогенетических взаимоотношений с помощью 2.6.2.

программы “TREE 4.0” 2.7. Количественные показатели ГЛАВА 3. Оптимизация условий полимеразной цепной реакции с произвольными праймерами 3.1. Моделирование полимеразной цепной реакции 3.2. Оптимизация условий проведения отжига ПЦР 3.3. Оптимизация остальных условий полимеразной цепной реакции 3.4. Моделирование произвольных праймеров для исследования молекулярно- генетического полиморфизма ГЛАВА 4. Исследование меж- и внутривидового полиморфизма рода Hordeum L 4.

1. Специфичность произвольных праймеров при выявлении полиморфизма 4.2. Исследование молекулярно-генетического полиморфизма между видами рода Hordeum L 4.3. Исследование внутривидового полиморфизма вида Hordeum vulgare L. ГЛАВА 5. Картирование генома ячменя и идентификация локусов количественных признаков 5.1. Картирование продуктов ПЦР при помощи самоопыляющейся популяции F8, Одесский115/Гольф 5.2. Маркерный анализ количественных признаков....................123 ЗАКЛЮЧЕНИЕ ВЫВОДЫ ЛИТЕРАТУРА ВВЕДЕНИЕ В методологии исследования молекулярно-генетического полиморфизма растений за последнее время сделан шаг вперед, благодаря использованию ДНК маркеров и, в частности, маркеров, полученных на основе полимеразной цепной реакции (ПЦР). Быстрота получения результатов и относительная дешевизна полимеразной цепной реакции - это то, что особенно прельщает в этом методе.

Данный метод легко осваиваем и, поэтому, может быть доступен многим лабораториям занимающимися изучением организации генома.

Наибольшее развитие в исследовании молекулярно-генетического полиморфизма получил вариант полимеразной цепной реакции с единичным коротким произвольным праймером (ПП-ПЦР или RAPD - Random Amplified DNA). Первые работы по использованию ПП-ПЦР были проведены на сое и микроорганизмах где данный метод показал себя как наиболее эффективный способ дифференциации организмов и их идентификации. Сегодня уже сложно найти в молекулярной генетике область, где не использовался бы данный метод. Сложно найти и организмы, геномы которых бы не исследовали с помощью полимеразной цепной реакции. Это особенно заметно по тем мировым проектам, которые сегодня используют ДНК-маркеры для наиболее детального исследования особоценных в народном хозяйстве организмов.

Так, Северо-американский проект по картированию генома ячменя (North American Barley Genome Mapping Project) объединил более 26 лабораторий США, Канады и стран Европы, в том числе и Украины для детального картирования генома ячменя, идентификации локусов отвечающих за количественные признаки и устойчивость к болезням. До 1994 года основными маркерами в исследовании генома ячменя служили ПДРФ-маркеры, сегодня отработан метод полимеразной цепной реакции, ее вариант полиморфизм длин амплифицированных фрагментов (AFLP - Amplified Fragment Leght Polymorphism).

При использовании ПП-ПЦР в различных лабораториях иногда возникает проблема воспроизводимости результатов, иногда и в пределах одного опыта.

Интерпретация результатов требует разработки теоретических аспектов. Как рассматривать данную полосу - как уникальный участок генома или повтор?

Сложности возникают и в теоретическом плане. Авторы проводят реакцию в неоптимальных условиях для конкретных праймеров или механически повторяют те условия реакции, которые предложены первыми авторами. А это не практично при использовании праймеров различных размеров и последовательности. Целью настоящей работы явился анализ молекулярно-генетического полиморфизма генома ячменя с помощью оптимизированных условий полимеразной цепной реакции с произвольными праймерами, картирование продуктов полимеразной цепной реакции и определение сцепления локусов количественных признаков и молекулярных маркеров.

Непосредственными задачами работы были:

1. Оптимизация условий полимеразной цепной реакции с произвольными праймерами: оптимизация состава реакционного раствора для повышения выхода и воспроизводимости амплификации;

подбор температурного режима полимеразной цепной реакции.

2. Исследование межвидового полиморфизма рода Hordeum L.

3. Исследование внутривидового полиморфизма вида Hordeum vulgare.

4. Картирование генома ячменя с помощью продуктов ПП-ПЦР и идентификация локусов количественных показателей.

ГЛАВА 1. Исследование молекулярно-генетического полиморфизма с помощью молекулярных маркеров Необходимым условием любого генетического анализа является наличие у изучаемых форм полиморфных признаков. Полиморфным называется менделевский (моногенный) признак, по которому в популяции присутствует не менее двух фенотипов и, по крайней мере, два генотипа, которые встречаются с частотой не менее 5%. В популяциях часто присутствует больше двух аллелей одного локуса и, соответственно, более чем два фенотипа по данному локусу. Отмечаются также редкие генетические варианты, которые условно определяются как моногенные признаки, присутствующие в популяции с частотой менее 5%. Если данный полиморфный фактор локализован на хромосоме, тогда он становится маркером, по которому можно выявить расположение других факторов. Обычно имеют дело не с самим геном-маркером, а с его фенотипическим проявлением, представляющим собой хорошо различимый качественный признак. Такой признак можно рассматривать как фактор идентификации соответствующего ему гена, а также сцепленных с ним других генов (Конарев и др., 1983).

1.1. Белковые маркеры 1.1. 1. Особенности белковых маркеров Генетические маркеры играют исключительно важную роль в оценке наследственной конституции организма и служат одним из главных средств селекции.

В классической генетике в качестве маркеров использовались морфологические признаки, набор которых в сравнении с количеством генов и генетических систем в организме весьма ограничен. К тому же, подавляющая часть их нестабильна, зависит от условий среды обитания организма, что проявляется в виде пенетрантности (проявление фенотипа) и экспрессивности (уровень фенотипического проявления).

Полиморфизм морфологических признаков является главным критерием в систематике, при изучении мутационного процесса, исследовании филогенетических связей, он послужил основой для формулирования Н.И.Вавиловым закона гомологических рядов наследственной изменчивости.

Морфологические признаки не всегда изменяются дискретно, и на их проявление, как правило, существенное влияние оказывают условия выращивания.

Это наиболее ярко проявляется в селекции, где главное внимание уделяется количественным полигенным признакам: продуктивности, устойчивости к абиотическим стрессам, качеству урожая. Новые возможности генетического маркирования появились с привлечением молекулярных маркеров - белков и ДНК.

Белковые признаки в меньшей мере подвержены фенотипической изменчивости, чем морфологические признаки. Белками могут быть маркированы некоторые генетические системы. Исключение составляют системы транспортных, рибосомальных и низкомолекулярных РНК, обеспечивающих синтез белка и сам процесс передачи генетической информации от ДНК белку, а также неструктурная зона, занимающая большую часть генома (Конарев и др., 1993). Белковые и ДНК маркеры имеют ряд существенных преимуществ перед морфологическими. Они позволяют при генетическом анализе избегать проблем, связанных с влиянием других локусов. Морфологические признаки представляют собой лишь одно из проявлений гена, а молекулярные, в случае кодоминирования, выявляют оба аллеля. Другие аспекты фенотипа (как следствие плейотропии) могут быть скрыты от поверхностного наблюдения. Белковые и ДНК маркеры дают возможность выявить недоступные визуальному анализу точечные мутации.

В работе Vanhintum (1994) исследовали происхождение европейских сортов ячменя с помощью полиморфных белковых систем - 19 изоферментов и гордеинов;

С окраски хромосом по Гимза;

по 3-м морфологическим показателям и гену устойчивости к DDT. Автор показал, что коэффициент сходства между сортами по эстеразе (Est1) наибольший и равен 0.41. При окраске по Гимза значение коэффициента также велико по сравнению с морфологическими признаками, где он минимален.

Белковые маркеры, как правило, наследуются кодоминантно и анализ генотипа возможен непосредственно по белковому фенотипу. Благодаря этому, а также за счет большего числа характеристик белковые маркеры дают возможность выявлять генетическую изменчивость в морфологически однородных популяциях и анализировать гибриды в популяции уже с первых поколений.

Разработка современных методов разделения и идентификации белковых молекул изоэлектрофокусирование, гельфильтрация, (электрофорез, иммуноэлектрофорез и др.) позволила получить более достоверную информацию о разнообразии макромолекул, а следовательно, и о различиях генотипов, так как по ряду причин белки удобны как маркеры, но не всякий белковый признак может быть использован как маркерный. Выбор белка-маркера и метода оценки его биологической или генетической специфичности - одна из задач биохимической генетики. К настоящему времени сложились и хорошо себя показали два главных принципа маркирования, один из которых основан на использовании антигенной специфичности белка, другой - на специфичности спектра компонентов множественных генетически полиморфных белков. Им соответствуют два типа белковых маркеров:

иммунохимические (серологические) и электрофоретические (Конарев и др., 1993).

Серологические маркеры хорошо отражают биологические свойства белка, его принадлежность виду, роду, что позволяет использовать белки-антигены как биологические, или филогенетические, маркеры. На реакции узнавания антигена антителом основаны иммунохимические методы идентификации вида растений.

Характерно, что типы антигенов и многих полиморфных белков не изменяются в онтогенезе и наследуется кодоминантно. Это позволяет использовать их в качестве генетических маркеров (Созинов, 1985).

Использование электрофоретических маркеров основывается на физико химических свойствах белка, это прежде всего, - заряд, масса и форма молекулы.

Белковыми признаками здесь служат соответственно электрофоретическая подвижность, изоэлектрическая точка, число и разновидность субъединиц белка и их позиции в электрофоретическом спектре.

В поисках генных маркеров для популяционных исследований приморского гребешка (Mizuhopecten (Patinopecten) yessoensis Jay.) из более чем 30 изученных белков были отобраны высокополиморфных: глюкозофосфатизомераза, аспартатаминотрансфераза, ацетат эстераза, 4-метилбеллиферил глутаматионредуктаза, октопиндегидрогеназа, фосфоглюкомутаза (Долганов, 1995). Их гетерогенность выявляли методом электрофореза в крахмальном геле с использованием одной буферной системы. Автор провел идентификацию аллозимных фенотипов этих белков, выявленных у гребешка разными авторами.

Для сортовой идентификации и решения проблем, связанных с изменчивостью внутри вида, необходимы генетически полиморфные белковые системы.

Полиморфизм таких систем обусловлен аллельной изменчивостью и раскрывается при помощи электрофореза. Это дает возможность по спектру компонентов полиморфного белка различать генотипы и идентифицировать сорта, биотипы и линии.

Среди группы множественных генов, кодирующих белки с разной электрофоретической подвижностью, наряду с многоаллельными и диалельными могут быть гены с большим преобладанием по частоте встречаемости в переделах популяции или вида какого-либо одного аллеля (другие аллели очень редки или вовсе не проявляются). Белки таких генов считаются мономорфными.

По этой причине электрофоретический спектр гетерогенных многокомпонентных белков часто представляет собой совокупность мономорфных и в разной степени полиморфных (аллельных) белков. Мономорфные (по подвижности) компоненты являются общими, то есть одинаковыми, для всех представителей вида. Остальные, в зависимости от степени полиморфизма, или множественности аллелей, могут быть общими для представителей подвида, популяции или генетической группы, например, биотипа. В совокупности, спектры множественных (полигенных) и генетически полиморфных (за счет многоаллельности генов) белков дают представление о множественности генов данного белка, аллельной структуре генов, структуре популяций, биотипном составе сорта и о генетических отношениях между сортами, биотипами и популяциями в пределах вида (Созинов, 1975, 1985;

Конарев, 1993).

При использовании электрофореза в генетическом анализе сортов и популяций учитывается, что гетерогенность некоторых белков может быть обусловлена посттрансляционной изменчивостью за счет модификаций типа гликозилирования, метилирования, фосфорилирования, протеолиза и др.

Большое число изоферментных систем в организме позволяет маркировать практически все хромосомы генома, а также многие локусы в пределах отдельных хромосом. Изоферментный анализ может проводиться на больших выборках, причем для изучения требуется, как правило, очень мало материала.

1.1.2. Применение белковых маркеров в генетико-селекционных исследованиях Примером использования изоферментов в качестве надежных генетических маркеров могут служить работы по картированию изоферментных локусов у ячменя (Yoshimi, Konishi, 1995). 46 изоферментов исследовались на линиях пшеницы, дополненных хромосомами ячменя. Для некоторых изоферментов была уточнена их локализация на хромосомах. Такие изоферменты как эстераза 5 (Est5) и 6 фосфоглюконат дегидрогеназа (Pgd1) идентифицированы на 1 хромосоме;

аспартат аминотрансфераза (Aat2) - на 6 хромосоме;

эстераза 9 (Est9) - на 7. Локусы Est5 и Pgd1 сцеплены как между собой (6.5% рекомбинации), так и с морфологическим признаком хлорина fc (Est5-Pgd1-fc). Вторая группа сцепления связана с длинным плечом 6 хромосомы: o-Aat2-l9 (o - оранжевая лемма;

l9 - плотный колос). Третья группа сцепления: fs-s-r-Est5 - на длинном плече 7 хромосомы. Эти изоферментные локусы могут быть сцеплены с некоторыми важными агрономическими локусами, такими как устойчивость к болезням.

Нецветаевым (Netsvetaev, 1992;

1993) изучена генетика b-амилаз, выделенных из зрелого и проросшего зерна ячменя. Анализ дополненных пшенично-ячменных линий подтвердил, что локус BmyI, контролирующий синтез b-амилаз, находится в хромосоме 4 ячменя. Многочисленный тест по данным анализа двух комбинаций скрещивания дал следующий порядок расположения BmyI относительно известных генов: f9=K0=g12=ml-o=BmyI. Им идентифицирован новый аллель - Bmy IAL, характерный для сортов Algerian, Asse, Imula, Zenit.

У пшеницы достаточно подробно исследовались изоферменты a-амилазы, так как от активности этого фермента зависит проявление одного из очень важных признаков - способности прорастания зерна на корню (Созинов, 1983;

Netsvetaev, 1992;

Илличевский и др., 1995).

Для идентификации сортов, биотипов и анализа популяций эффективны многокомпонентные и генетически полиморфные изоферментные системы. По данным ряда авторов, многокомпонентность и высокая степень полиморфизма характерны для эстеразы овса, ячменя, ржи и многих других культур. Идентификация листовых эстераз 11 и 12 у ячменя (H.vulgare) и их генетических контроль выяснены Нецветаевым (1992a;

Netsvetaev, 1992б). Им также проведен анализ сцепления эстераз 4 и 11 с морфологическим признаком Ble (голубой эндосперм) у H.spontaneum (Netsvetaev, 1992г).

Наибольшее распространение в сортовой идентификации получили запасные белки семян. В комплекс признаков, по которым оценивается сортовой материал, введен официальный контроль по запасным белкам зерна (глиадину и глютелину) всей зерновой продукции как при закупке у производителей, так и при международной торговле зерном, особенно семенным материалом. Запасные белки множественны, полиморфны и локализованы в морфогенетически однородных тканях - эндосперме и семядолях зрелого семени. Высокий процент содержания их в тканях позволяет брать для анализа часть зерна, используя другую (с зародышем) для посева.

Спирторастворимые белки зерна ячменя (гордеины) являются одной из наиболее полиморфных белковых систем, известных на данный момент у этой культуры. Такая полиморфная система, как гордеины, может служить удобным инструментом для быстрой идентификации, определения чистоты и подлинности сорта (Поморцев и др., 1994а). Кроме того, гордеинкодирующие локусы являются удобными фланговыми маркерами полиаллельного локуса Ml-a, контролирующего устойчивость растений ячменя к мучнистой росе. Это позволяет в ранних поколениях, начиная с зерен F2, применять электрофорез гордеинов для отбора гомозиготных по указанному гену устойчивости генотипов, а также создавать формы с комплексом генов резистентности к патогену. Ведутся исследования и по использованию гордеинокодирующих локусов в качестве маркеров генов других хозяйственно полезных признаков.

Имеющиеся в литературе данные свидетельствуют об адаптивном значении полиморфизма гордеинов. Так, Nevo et al. (1983) при изучении полиморфизма проламинов в четырех субпопуляциях дикого ячменя Hordeum spontaneum Koch.

обнаружили существенные корреляции между некоторыми фенотипами гордеинов и микрогеографическими условиями произрастания.

Анализ гордеинов, контролируемых локусами Hrd A (Hor 1), Hrd B (Hor 2) и Hrd F (Hor 5), у 226 сортов ярового ячменя, районированных за последние 62 года на территории бывшего СССР, показал значительный полиморфизм указанных локусов, неоднородность частот аллелей и неравномерность их распределения на территории страны (Поморцев и др., 1994б). Показано, что на территории европейской части СССР распространение и частоты аллелей локусов Hrd существенно зависят от воздействия таких климатических факторов, как среднегодовое количество осадков и средняя температура июля.

Методы белковых маркеров могут быть использованы (и используются) в сочетании с любыми методами отбора и на всех этапах селекционного процесса - от изучения исходного материала и поиска источников до сортоиспытания и семеноводства созданных сортов (Конарев и др., 1986).

1.1.3. Ограничения в использовании белковых маркеров При использовании изоферментных систем в генетическом анализе растений учитывается ряд обстоятельств. Это, прежде всего, органная, тканевая и субклеточная специфичность зимограмм многих ферментов, что, естественно, в большей мере отражает функциональную разнокачественность их морфогенетических систем. В цикле развития клеток и, особенно, при переходе эмбриональных клеток в фазу дифференцировки и специализации отмечаются смены типов зимограмм.

Соответственно возможны изменения в спектре изозимов по фазам развития организма. Наконец, зимограммы ряда ферментов, особенно функционально лабильных (пероксидазы, алкогольдегидрогеназы и др.), в той или иной мере изменяются под влиянием таких факторов, как температура, фотопериод, инфекция и условия питания растений (Cозинов, 1983;

Netsvetaev, Krestinkov, 1992).

Сложность при изоферментном анализе состоит в идентификации субъединиц изоферментов и особенно аллоферментов, представленных множественными аллелями отдельных генов либо блоков генов.

Для таких экспрессируемых продуктов генов, как запасные белки и ферменты, характерен высокий уровень полиморфизма, однако их число ограничено и, соответственно, ограничено число исследуемых локусов. Кроме того различные участки генома эволюционируют с различной скоростью, и, следовательно, исследование одного или нескольких участков генома дает информацию о небольшой части генома.

Генетическая изменчивость, наблюдаемая на уровне ДНК, существенно выше.

Поскольку значительная часть генома, вероятно, не принимает прямого участия в регуляции или кодировании продуктов генов, мутации в этих не регуляторных и не кодирующих участках ДНК могут не иметь фенотипического выражения и являются селективно нейтральными. Кроме того, очень важное преимущество ДНК-ового уровня над белковым - это возможность исследовать изменчивость не тестируемых неполиморфных белковыми локусами. Использование ДНК-маркеров является наиболее перспективным инструментом в исследовании молекулярно-генетического полиморфизма.

1.2. ДНК-маркеры 1.2.1. Полиморфизм длин рестрицированных фрагментов ДНК (ПДРФ) Наиболее распространенный тип исследования полиморфизма ДНК рестрикционный полиморфизм. Если в сайте узнавания для какой-либо рестриктазы происходит точечная мутация, фермент не распознает свой сайт и не разрезает ДНК.

Имея специфические ДНК-зонды и рестриктазы, можно анализировать геномную ДНК.

Рестриктированные фрагменты ДНК (рестрикты) различаются по длине при их разделении на геле после электрофореза. Фрагменты ДНК, разделенные по размеру с помощью агарозного гельэлектрофореза, сначала денатурируют, а затем переносят на нитроцеллюлозный (капроновый) фильтр и иммобилизируют. При переносе на фильтр относительное положение фрагментов ДНК в геле сохраняется. ДНК, связанную с фильтром, гибридизуют с ДНК или РНК, меченую P, и на радиоавтографе находят положение полос, комплементарных радиоактивному зонду.

Обычными метками нуклеиновых кислот являются радиоизотопы, в первую 32 32 очередь Sи I, которые вводятся в ДНК или РНК с помощью разнообразных P, ферментативных методов. Достигаемая чувствительность составляет 10-17 - 10-18 моль ДНК в образце (Бадашкеева, 1989). Некоторые ферменты, например пероксидазу и щелочную фосфатазу, можно связывать химически с синтетическими олигонуклеотидными пробами;

таким образом, появляется возможность для высокочувствительного метода обнаружения с помощью каталитического действия фермента на соответствующий субстрат. Действие фермента можно обнаружить по осадку хромофора или по появлению окрашенных, флуоресцирующих или люминесцирующих молекул в растворе. Чувствительность нерадиактивного мечения сходна с чувствительностью радиоизотопного метода (Ландегрен и др., 1990). Наряду с биотином используется также дигоксигенин (Lion, 1990;

Schmitz, 1991), флуорофоры (флюоресцеин, родамин), они стабильны, обнаружить их можно при непосредственном наблюдении (Kuller, 1989;

Oser, 1990). Однако, более чувствителен нерадиоактивный метод - флуоресценция хелатов ионов редкоземельных металлов (таких, как европий Eu(III) (Praf, 1991) или тербий Tb(III) (Oser, 1990), а так же батофенантролин рутения Ru(II) (Bannwarth, 1989) (его чувствительность сравнима с методом радиоизотопов) (Pollard-Knight, 1990).

1.2.2. Особенности ПДРФ-маркеров ПДРФ-маркеры обладают теми же достоинствами, что и белковые: они наследуются в соответствии с законами Менделя (Фогель и др.,Т2, c.288, 1990;

Yanagisawa et al, 1994) по кодоминантному типу, независимы от условий выращивания растений и не опосредствованы плейотропией гена.

К указанным выше преимуществам этих маркеров следует отнести:

a) возможность использовать ДНК любой ткани для генетического анализа или сортовой идентификации на всех этапах развития растения (при этом, для анализа по Саузерну достаточно 5-10 мкг ДНК, для получения которой требуется навеска листьев менее 1г.);

б) экспериментатор может использовать большое число комбинаций рестриктаз и фактически безгранично повышать разрешающую способность метода;

в) использование зондов, получаемых на основе средних и высоких повторов значительно увеличивает количество информации в генетическом анализе, так как один зонд в данном случае будет гибридизоваться со многими локусами (а не преимущественно с одним, как в случае его уникальности), причем фрагменты ДНК, к которой принадлежат локусы, могут гораздо чаще демонстрировать полиморфизм длин рестрикционных фрагментов.

Показано, что пробы 5S ДНК и сателлитная последовательность из ячменя HVT01 в 5 раз и 6.7 раз, соответственно, увеличивают информацию на фрагмент (Sorrells, 1995). Весьма важное преимущество ПДРФ-технологии - возможность маркирования всех областей генома, включая нетранскрибируемые участки ДНК, совокупность которых составляет до 97% генома.

Точечные мутации, заменяющие один нуклеотид на другой в некодирующем районе ДНК, встречаются чаще, чем в кодирующей ДНК. Показано, что уровень нуклеотидной изменчивости некодирующей ДНК приблизительно на порядок выше, чем наблюдаемый у структурных генов, кодирующих белки. Это означает, что различия между двумя случайно выбранными гомогенными участками ДНК, обусловлены мутационным процессом, составляют 1/500-1/250 нуклеотидов, в то время как за счет гетерозиготности оно составляет 0.001-0.004 нуклеотида. Особенно подходят для выявления вариантов ДНК ферменты, распознающие палиндромы в четыре нуклеотида, например Msp I и TaqI.

ПДРФ обусловлен, в основном, наличием или отсутствием сайта рестрикции в альтернативных вариантах ДНК, что выражается в различной длине альтернативных ДНК-фрагментов и, соответственно, в расположении полос на электрофорезе. Частота полиморфного варианта в популяции может изменяться от нескольких процентов до максимальной - 50%.

Возможны и другие причины полиморфизма ДНК, выражающиеся в различном числе тандемных повторов, имеющих общую центральную часть 10-15 пар оснований (“мини-сателлиты”). Участок хромосомы различных генетических источников может иметь различное количество таких повторов. Возникновение полиморфизма этого типа облегчается благодаря идентичности последовательностей нуклеотидов в повторах, что приводит к делециям и дупликациям, возникающим в результате неравного кроссинговера. Длина рестриктированных фрагментов зависит от числа повторов.

Поскольку данный тип полиморфизма ДНК выражается в разном числе повторов, гетерозиготность по нему обычна, а гомозиготность встречается редко. Это свойство существенно для исследований с использованием ПДРФ-маркеров, поскольку почти во всех случаях варианты информативны.

На основе мини-сателлита интронной последовательности гена миоглобина Джеффриз создал зонды, узнающие гипервариабельную ДНК (Анализ генома, 1990).

В различных хромосомах человека обнаружено много гипервариабельных участков. Уровень гетерогенности в небольшой популяции, исследованной в это время, был весьма высоким и достигал 100 %. Все гетерогенные полосы наследуются согласно законам Менделя. С помощью этого метода каждый индивид из родословной легко отличается от любого другого. Дальнейшее совершенствование этой методики дало возможность различать по “отпечаткам пальцев” (fingerprint) индивидуумы, даже установить степень родства.

Заметим, что различие по длине рестрикционных фрагментов между родителями и потомками может возникать не только в результате точковых мутаций в сайте узнавания, но и в результате ошибки репликации или кроссинговера. Ожидается, что эти события происходят чаще, чем точковые мутации. Cреди 27 индивидов, у которых проанализировано 240 полос, выявлена такая полоса, которой не было ни у одного из родителей, отсюда скорость мутирования составляет 1/240, что по крайней мере на 4 порядка выше, чем скорость мутирования для точковых мутаций.

1.2.3. Применение ПДРФ-маркеров Следует прежде всего подчеркнуть, что ПДРФ-маркеры - это эффективные генетические маркеры. Примером использования ПДРФ-маркеров при картировании генов и локусов количественных признаков могут служить работы Северо Американского проекта по картированию генома ячменя (NABGMP, 1993;

Haeys, 1994;

Thomas, 1995), а так же Graner et al. (1992). Цель проекта состоит в получении максимальной информации о геноме ячменя при условии, что в H.vulgare, исследования будут вовлечены многочисленные коллективы из разных стран, в основном США, Канады, Англии и Германии, а также и Украины (Одесса, Сиволап Ю.М.). Дигаплоидные линии исследуемых комбинаций получены биотехнологическим способом (Сhen, Hayes, 1989). Список исследуемых комбинаций и направление в исследовании этих линий приведен в журнале “Barley Genetics Newsletter” (Haeys, 1995). Например, комбинация Steptoe x Morex предназначена для выявления локусов важных агрономических, пивоваренных и пищевых показателей;

это также относится и к комбинации Harrington x TR306. Для идентификации генов устойчивости к болезням:

листовой ржавчине и вирусу желтой карликовости ячменя, предназначена комбинация LbIran/Gloria//Commanche x Bowman (BC). Для поиска маркеров, сцепленных с генами зимостойкости, фотопериодизма и яровизации, предназначены две комбинации:

Doctoo x Morex и Dictoo x Plaisant. Полученные результаты будут использоваться в широкомасштабных селекционных работах. Поэтому молекулярные маркеры должны отвечать всем необходимым требованиям и быть удобными при использовании в селекционных проектах. Так, маркеры, в зависимости от качества при гибридизации зонда с геномной ДНК, различают как “отличные” - сильный гибридизационный сигнал, удобен для исследований;

“хорошие” - хороший гибридизационный сигнал, легко прослеживается;

удовлетворительный сигнал, можно “посредственные” использовать, но не рекомендуется и, наконец, “плохие” - плохо прослеживается, использовать не рекомендуется. На 150 дигаплоидных линиях от скрещивания сортов по пивоваренности) получено маркеров, Steptoe x Morex (контрастные включающих в большей степени ПДРФ-маркеры, в меньшей степени изоферменты, морфологические маркеры и ПЦР-маркеры. Треть всех маркеров были идентифицированы как “посредственные” и “плохие”. На комбинации Harrington x TR306 получено 213 маркеров.

Song et al. (1995) сконструировали детальную ПДРФ карту сцеплений у Brassica rapa (syn. campestris) для определения возможных сцеплений молекулярных маркеров с локусами количественных признаков. Было получено 220 ПДРФ локусов с характеристикой каждой линии по 28 количественным признакам (QTLs). Авторы показали, что эффект уменьшения плотности расположения маркеров на геном с на 126 не снижает точность локализации QTLs. Однако уменьшение с 126 до маркеров приводит к потере информации более, чем на 15%. Аналогичные работы по выявлению сцепления локусов молекулярных маркеров с локусами количественных признаков проведены многими авторами. Более четырехсот ПДРФ-проб, 50 из которых оказались полиморфными, использовали при картировании генома ячменя, в частности, локусов количественных признаков и генов устойчивости к болезням (Backes et al., 1995). Frova et al. (1994) определили локусы устойчивости к высокой температуре у пыльцы кукурузы, используя 188 картированных ПДРФ-маркера.

Genzbittel et al. (1995), основываясь на 180 зондах и комбинациях рестриктаз, определили 237 локусов у Helianthus annus L. Общий размер участка генома, покрываемый 34 группами сцепления, равен 1150 cM, 16 из которых локализованы на хромосомах. Подробная генетическая карта не идентична физической карте.

Доказательством тому может выступать работа Song et al. (1995). Авторы оценили адекватность физической карты риса (Oryza sativa L.), полученной с помощью гибридизации in situ и генетической картой, основанной на ПДРФ-маркерах. 44 ПДРФ маркера образовывали группы сцепления, ассоциированные с концами 7, 8, 11 и хромосом. Средняя ошибка в расхождении с данными гибридизации in situ составила 5.91%. Расстояние между двумя маркерами на генетической карте была большим, чем на физической. Это показывает различия между генетической и физической картами.

Причины таких различий могут быть связаны как с центромерным, теломерным эффектом, так и различной частотой кроссинговера вдоль хромосомы. Аналогичные работы проведены Cartilho et al. (1995) с Aegilops umbellulata, которые использовали in situ-гибризацию последовательностей генов рибосомальной ДНК - 18S-5.8S-25S.

Данные о локализации ПДРФ-маркеров могут использоваться для картирования генов изоферментов, генов, кодирующих морфологические или физиологические признаки, в том числе устойчивость к патогенам и вредителям (Huestis et al., 1994).

Williams et al (1994) идентифицировали ПДРФ-маркеры, сцепленные с геном устойчивости к нематоде злаков (Heterodera avenae Woll.) у пшеницы. Для работы использовалась пара близкоизогенных линий, различающихся по наличию и отсутствию гена устойчивости к нематоде - Cre. 58 гибридизационных зондов применяли для скрининга и идентификации полиморфизма у близко-изогенных линий и нуле-тетрасомиков и дителосомиков и на популяции F2, полученных от скрещивания контрастных по устойчивости форм. Анализ сцепления показал, что ПДРФ-маркеры фланкируют ген устойчивости: зонд Xcdp588 сцеплен на 7.4 cM. Bonhomme et al. (1995) идентифицировали ПДРФ-анализом главный ген устойчивости к листовой ржавчине (Lr) у Aegilops ventricosa. Rayapati et al. (1994) на 88 линиях овса (Avena strigosa и Avena weistii) сконструировали 10 групп сцепления для идентификации генов устойчивости к стеблевой ржавчине, используя ПДРФ-анализ.

Galiba et al. (1995) идентифицировали три ПДРФ-маркера - Xpsr426, Xcdo504 и Xwg644, плотно сцепленных с генами Vrn1 и Fr1, контролирующих, соответственно, яровизацию и морозостойкость в длином плече 5A хромосомы Triticum spelta 5A.

Показано, что гомологичные последовательности имеются у ярового ячменя в локусе Sh2 хромосомы 7 (5H) и в локусе Sp1 на хромосоме 5R ржи.

Карту сцепления из 74 маркеров построил Pan et al. (1994) на 100 дигаплоидных линиях от скрещивания озимого и ярового ячменя для идентификации локусов, контролирующих зимостойкость. В результате анализа моногенного расщепления по исследуемым локусам и связи маркеров с устойчивостью к низким температурам было установлено следующее: наблюдалась сопряженность между ПДРФ-маркерами и количественным локусом по устойчивости к низким температурам на хромосоме 7.

ПДРФ-анализ нашел применение в установлении генов-восстановителей фертильности. Так гены Rf (restorer fertility) - Rf1, Rf4, Rf3, были идентифицированы на 5D хромосоме пшеницы (Ma et al., 1995). ПДРФ-локус Xksug48 сцеплен с геном Rf4 на хромосоме 6BS, Rf3 сцеплен с ПДРФ-локусoм Xcdo442 на IBS. Полиморфизм митохондриального гена ржи с генотипом (Secale cereale L.) “нормальным” сравнивался с генотипом цитоплазматической стерильности ПДРФ-анализом и “нозерн”-анализом (Dohmen et al., 1994). В ПДРФ-анализе использовали несколько гетерогенных митохондриальных генов в качестве проб для сравнения данных генотипов. Был найден один зонд, идентифицирующий корреляцию с фенотипом цитоплазматической мужской стерильности.

Важное значение имеет применение полиморфных ПДРФ-маркеров при исследовании происхождения и эволюционных изменений геномов близких видов (Gentzbittel et al., 1992).

Svitashev et al., (1994) исследовали шесть клонированных последовательностей ДНК из генома H.vulgare, представляющих собой повторы, для исследования филогенетических взаимоотношений 31 вида рода Hordeum. По результатам ПДРФ анализа, in situ-гибридизации данные виды ячменей образуют четыре главных кластера, содержащих геном I, X, Y и H. Авторы подтвердили уникальную позицию располагающегося отдельно от всех остальных видов ячменей.

H.bulbosum, Наблюдали различие среди H.vulgare и H.bulbosum, содержащих геном I.

Bark et al. (1995) использовали случайные последовательности в ПДРФ-анализе для оценки генетического сходства среди 70 открытых популяций лука (Allium cepa), различающихся реакцией на длительность дня. Среднее число полиморфных фрагментов на гибридизационный зонд составило 1,9. Коэффициент сходства в популяциях, отвечающих на длинный день (LD), и популяциях с ответом на коротким день (SD), а также между этими популяциями равен, соответственно, 0.79, 0.67 и 0.68.

Кластерный анализ проводился парно-групповым невзвешенным методом (UPGMA Unweighted-Pair-Group Method). Совершенно неожиданным оказалось заключение о наличии достоверной гомологии между хромосомами пшеницы, ячменя и ржи, принадлежащих к разным родам - Triticum, Hordeum и Secale. При помощи ПДРФ анализа сравнивались геномы злаков - Hordeum vulgare и Triticum tauschii (Devos et al.

(1993). Результаты показали, что более 95% малокопийных последовательностей обоих геномов сходны, но 42% умеренных повторов показали различие. Шестьдесят три локуса, ранее картированные у ячменя, были картированы с помощью ПДРФ маркеров у Triticum tauschii (Namuth et al., 1994). При сравнении полученных групп сцепления у обоих видов оказалось, что наблюдается некоторый порядок в расположении маркеров. Однако шесть из семи групп сцеплений у Triticum tauschii ориентированы в обратном, чем у ячменя, направлении. Авторы делают вывод о том, что геномы этих видов обменивались друг с другом сегментами, которые дуплицировались или удалялись из геномов.

Была установлена связь между некоторыми ПДРФ-маркерами и локусами аллелей глиадинов Gli-1 и Gli-2 у 70 сортов пшеницы (T.aestivum L.). Зондами для ПДРФ-анализа служили последовательности генов g-глиадина (K23) и a-глиадина (pTU1). Все особи с аллелями Gli-B1 и Gli-D1, имеющие различие в g-глиадине, показали полиморфизм и при ПДРФ-анализе зондом К23. Данный зонд также определял полиморфизм по Gli-B1b и Gli-B1e-подобным аллелям и Gli-A1a среди других Gli-A1 аллелей. Таким образом, данные гибридизационные пробы локализуют последовательность ржи из хромосомы 1R в геноме пшеницы. Molnar et al. (1995) также сравнивали полиморфизм запасных белков ячменя, гордеинов, с полиморфизмом, выявляемым ПДРФ-анализом, гибридизационными пробами в котором выступают последовательности ДНК генов гордеинов. Авторы показали, что полиморфизм выявляемый, как с помощью гордеинов, так и ПДРФ-анализа, сходен.

При исследовании молекулярно-генетического полиморфизма на уровне селекционных линий можно использовать короткие олигонуклеотиды, последовательность которых представлена повтором, например, (GACA)4, (GATA)4, (GTG)5 или (CA)8 (Schmidt et al., 1993). Авторы исследовали полиморфизм среди представителей вида Beta vulgaris и среди селекционных дигаплоидных линий у B.vulgaris cv altissima. Оказалось, что олигонуклеотид (GATA)4 как гибридизационная проба является наиболее информативным при гибридизации с геномной ДНК, рестрицированной по Hinf I, Hae III, Rsa I и позволяет дифференцировать дигаплоидные линии одного сорта.

Недостаток ПДРФ-анализа - его дороговизна, связанная с использованием радиоактивной или нерадиоактивной метки и рестриктаз, методические и технические сложности в результате чего - ПДРФ-анализ с трудом поддается автоматизации. Кроме того, наблюдаемые полосы гибридизации иногда не отчетливо различаются, что усложняет использование данного маркера для широкомасштабных работ. Поэтому многие исследователи ПДРФ-маркеры “переводят” в ПЦР-маркеры. Так, на основе последовательностей тандемных повторов, используемых в качестве зондов при ПДРФ-анализе у пшеницы, были разработаны праймеры для ПЦР (Devos et al., 1995).

Полиморфизм, выявляемый ПЦР-анализом, был использован для идентификации геномов и может быть полезен для селекции. Аналогичная работа проведена Han et al.

(1995). На базе нуклеотидной последовательности мРНК гена a-амилазы 2 была подобрана пара праймеров для ПЦР. Полиморфизм между сортами Steptoe и Morex выявлялся после рестрицирования амплифицированных продуктов BstX I. Фрагмент из генотипа Morex был на 80 п.о. короче, чем фрагмент Steptoe. Таким образом, выявляемый ПЦР-маркерами полиморфизм оказался кодоминантного типа.

Полиморфизм b-глюканазы (ген Brz) был выявлен аналогичным способом - продукт амплификации ДНК Morex был на 3 нуклеотида длиннее, чем продукт амплификации ДНК Steptoe.

1.2.4. Полиморфизм амплифицированных фрагментов геномной ДНК Поиск удобных ДНК-овых маркеров для изучения молекулярно-генетического полиморфизма привел к использованию полимеразной цепной реакции (ПЦР).

Полимеразная цепная реакция является специфическим высокочувствительным методом, который находит применение для решения широкого спектра проблем биологии (Mullis et al., 1986;

PCR technology, 1989;

PCR protocol, 1990;

Дебабов, 1990;

Вартапетян, 1991).

Полимеразная цепная реакция - это метод амплификации ДНК in vitro, с помощью которого в течение нескольких часов можно избирательно размножить интересующий участок ДНК в миллиарды раз. Для амплификации избранного фрагмента геномной ДНК используют два олигонуклеотида, фланкирующих интересующий нас участок ДНК. Последовательность праймеров подбирается таким образом, чтобы их были ориентированы навстречу друг другу, 3`-концы взаимодействуя с комплементарными нитями данной последовательности. ДНК полимераза осуществляет достройку взаимнокомплементарных цепей ДНК, используя затравку - 3`-концы олигонуклеотидных праймеров. Цикл ПЦР состоит из трех температурных режимов: денатурация ДНК при 940C;

ассоциация олигонуклеотидных праймеров с ДНК-мишенью (отжиг) при 37-68 0C;

cинтез ДНК термостабильной ДНК полимеразой (например, Taq-полимераза, из Thermus aquaticus или Tth-полимераза из Thermus termofilus) при 720C. В каждом цикле реакции происходит удвоение синтезируемых в предыдущем цикле молекул ДНК-матрицы.

Первоначально ПЦР была разработана для амплификации и анализа конкретных генетических локусов и базировалась на предварительном знании нуклеотидной последовательности локусов (Анализ генома, 1990;

Barghest-Nicoletti et al., 1990;

Barnett et al., 1990;

Costa et al., 1994;

Charalampos et al., 1990;

Decorte et al., 1990;

Ford et al., 1994). Разработка разных вариантов амплификации геномной ДНК расширила возможности применения ПЦР, особенно в выявлении полиморфизма. Так, варианты использования полимеразной цепной реакции при выявлении полиморфизма могут быть сгруппированы согласно особенностям самого процесса: а) амплификация со специфическими праймерами, б) амплификация мини- и микросателлитных локусов (SSRP, Simple Sequence Repeat Polymorphism), в) амплификация с перемежающимися повторами (Alu-PCR), г) ампликация с произвольными праймерами (RAPD, Random Amplified Polymorphic DNA) и д) полиморфизм длин амплифицированных продуктов (AFLP, Amplification Fragment Length Polymorphisms).

а) Амплификация со специфическими праймерами требует в качестве необходимого условия знание нуклеотидной последовательности амплифицируемого участка для подбора соответствующих праймеров к фланкирующим последовательностям. Размер праймеров для направленной амплификации обычно составляет 18-22 нуклеотида;

ГЦ-состав праймера должен быть выше 50 %;

3’-конец праймера должен содержать следующие пары нуклеотидов: ЦЦ, ГГ, ЦГ и ГЦ.

Праймеры, с учетом всех этих условий, могут образовывать и неспецифический продукт ПЦР. В таких случаях необходимо повторить подбор праймеров, сдвинув участки поиска влево или вправо от мишени. Полиморфизм при направленной амплификации может быть связан с вставкой или делецией в центральной части продукта, либо точечной мутацией в сайте, комплементарном одному из праймеров. В первом случае продукты амплификации различаются размерами (кодоминирование), во втором - это наличие или отсутствие продукта ампификации (образование продукта не будет наблюдаться у особей с точечной мутацией в первых шести комплементарных 3`-концу праймера последовательности). Однако мутации данных типов маловероятны (редки), то есть выявление полиморфизма с помощью направленной амплификации - затруднительно. Большая же часть точечных мутаций в амплифицированных последовательностях не заметна, так как не сказывается на размере продукта. Рестрикция мутированного продукта позволяет выявить точечные мутации, инактивирующие или восстанавливающие сайты рестрикции. В таком случае рестрикты продуктов ПЦР различаются по длине, это означает, что ПЦР-продукты наследуются по кодоминантному типу.

Faccioli et al. (1995), используя нуклеотидную последовательность кДНК гена DB4 (B-гордеин), подобрали фланкирующие праймеры к данному участку. Продукты амплификации ДНК различных сортов ячменя были рестрицированы по Rsa I для выявления STS-маркеров (sequence-tagged-sites). Авторы показали возможность выявления полиморфизма STS-маркерами в качестве дополнительного инструмента для “фингерпринта” сортов ячменя.

б) Амплификация участка геномной ДНК, содержащего высокоповторяющиеся последоватности (гипервариабельные районы генома), демонстрирует высокую степень полиморфизма. Гипервариабельные районы генома (HVR), которые часто называют также тандемными повторами с изменяющимся числом копий (VNTR), находят все большее применение в качестве генетических маркеров при изучении генома эукариот. Высокий уровень полиморфизма этих минисателлитных последовательностей часто бывает полезен при решении задач, связанных с картированием генов и идентификацией локусов, ответственных за злокачественное перерождение клеток и развитие многих наследственных заболеваний. Все более широкое применение находят полиморфные минисателлитные последовательности и при определении отцовства-материнства, идентификации личности и ряда других задач, относящихся к судебно-медицинской экспертизе (Чистяков и др., 1993).

Число копий в тандемных повторах может изменяться от одного до нескольких десятков. Обычно в популяции обнаруживается определенный набор аллелей, отличающихся друг от друга по числу повторяющихся единиц и, следовательно, по длине. Было показано, что полиморфизм VNTR может быть эффективно использован при идентификации личности, поскольку набор повторяющихся последовательностей определенной длины является уникальным для каждого индивидуума.

До недавнего времени типирование гипервариабельных районов было основано на использовании гибридизации по методу Саузерна или при ПДРФ-анализе. Однако, данный экспериментальный подход обладал недостаточной разрешающей способностью в тех случаях, когда VNTR входили в состав относительно крупных фрагментов ДНК, так как аллели мало отличались друг от друга по длине. В таких случаях было практически невозможно различить аллели VNTR, отличавшиеся друг от друга на 11-70 п.н. (в этот интервал укладываются размеры повторяющихся единиц среди известных VNTR). Кроме того, для ПДРФ-анализа требуется наличие значительных количеств высокомолекулярной ДНК, которые практически невозможно получить из небольшого кусочка ткани. Важное значение имеет также качество используемой ДНК и ее состояние (ДНК не должна быть деградированной или загрязненной посторонними примесями).

Использование соответствующих фланкирующих олигонуклеотидных праймеров в ПЦР позволяет амплифицировать любой фрагмент геномной ДНК. Амплификация ДНК находит все более широкое применение при анализе полиморфизма VNTR.

Возможно получить принципиально важные результаты, в том числе по идентификации индивидов, даже если исследователь располагает геномной ДНК, выделенной из единственной клетки. С помощью ПЦР на 160 образцах ДНК неродственных индивидуумов северо-западного региона России проведено исследование аллельного полиморфизма тримерного AGC-повтора экзона 1 гена адренорецептора - AR (Xq11-12), а также тетрамерных повторов ATCT интрона 40 гена фактора Виллибрандта - vWF (12p12);

AGAT-гена гипосантинфоcфорибозилтрансферазы и ДНК HPRT (Xq26) AGAT-анонимной последовательностей короткого плеча X-хромосомы - STRX1 (Ассев и др., 1995).

Авторы обсудили перспективу использования изученных маркерных полиморфных систем для молекулярной диагностики соответствующих болезней (спинобульбарной атрофии мышц - AR, болезни Леш-Нихана-HPRT, болезни Виллибрандта - vWF), а также в популяционной генетике человека, идентификации личности и молекулярных подходов к оценке мутагенной активности.

Определение полиморфизма микросателлитного участка генома получила название - SSRP (Morgente et al., 1994;

Rougwen et al., 1995;

Plaschke et al., 1995) Полиморфизм проявляется в различной длине продуктов амплификации, обусловленной различным количеством ди- или тринуклеотидных повторов в амплифицируемом участке. В половине работ, посвященных SSRP-маркерам, при амплификации используется радиоактивная метка. Разделение по размерам продуктов амплификации производится в агарозном геле высокой концентрации или в полиакриламидном геле. Так, Plaschke et al. (1995) определили нуклеотидную последовательность у 23 минисателлитов Triticum aestivum L., локализовали их на хромосомах и подобрали олигонуклеотидные праймеры для ПЦР. Наследование продуктов амплификации было кодоминантного типа. Общее число аллелей составило 142, от 3 до 16 на локус (в среднем 6.2 аллеля). Среднее число динуклеотидных повторов составляло от 13 до 41. Авторы продемонстрировали, что для исследования генетического разнообразия и сортовой идентификации в элитном материале гексаплоидной пшеницы может быть использовано небольшое число минисателлитов.


Аналогичные работы проделаны Morgante et al. (1994), Rougwen et al. (1995) на сое и на ячмене (Maroof et al., 1994).

в) Амплификация с перемежающимися повторами (Interspersed Repetitive Sequences IRS), Alu-PCR или REP-PCR основана на том, что в геномах высших организмов присутствуют в большом количестве Alu-последовательности, перемежающиеся с уникальными. Используя праймер к консервативной части Аlu повторов, можно амплифицировать участки ДНК, расположенные между ними (Breukel 1990;

Barghesi-Nicoletti 1990;

Nelson, 1989;

Decorte, 1990).

г) Полимеразная цепная реакция с произвольными праймерами, RAPD (Random Amplified Polimorphic DNA), произвольно-праймированная ПЦР (AP-PCR Arbitrarily Primed PCR) и фингерпринт амплифицированной ДНК (DAF - DNA Amplification fingerprinting) (Williams et al., 1990;

Welsh et al., 1990;

Welsh et al., 1991;

Caetato-Anolles et al., 1991a;

1991b;

Caetato-Anolles et al., 1992;

Caetato-Anolles, 1993).

Эти независимо разработанные подходы основаны на использовании одного или более произвольных олигонуклеотидных праймеров для амплификации различных участков ДНК с неизвестной локализацией в геноме. Функцию прямого и обратного праймеров в данном случае выполняет один и тот же олигонуклеотид. Вероятность события, при котором происходит “встреча” инвертируемых сайтов, являющихся мишенями для праймера, достаточна низкая. Поэтому, в результате ПЦР с произвольными праймерами образуются воспроизводимые фингерпринты, представляющие собой спектр уникальных (представленных в геноме по своей общей структуре в единичном числе) продуктов, часто полиморфных. ПЦР с произвольными праймерами пригодна для детального анализа геномов любых организмов. Многими исследователями показано, что продукты амплификации наследуются по закону Менделя (Williams, 1990;

Yanagisawa, 1994).

Различные варианты ПЦР с произвольными праймерами различаются по количеству продуктов амплификации, длине используемых праймеров, условиям амплификации и способу электрофоретического разделения продуктов. К примеру, для АР-PCR используются праймеры длиной, сравнимой с таковой при обычной ПЦР;

для анализе RAPD применяются короткие праймеры около 10 нуклеотидов;

для DAF размер праймеров составляет не менее 5 нуклеотидов (обычно 7-8). Эти и другие различия, в конечном результате, обуславливают выбор соответствующих условий проведения электрофореза для получения высокоразрешающих профилей продуктов амплификации. Разделение продуктов в RAPD и AP-PCR достигается электрофорезом в агарозном геле с окрашиванием бромистым этидием. Визуализацию продуктов DAF и информацию о ДНК-профилях получают с помощью электрофореза в полиакриламидном геле и окраски серебром для детекции пикограммного уровня ДНК (Bassam at el., 1991).

Выявляемый с помощью ПЦР с произвольными праймерами генетический полиморфизм может быть использован при исследованиях эволюционных взаимоотношений, видовой идентификации, для генетического картирования и паспортизации генотипов (Dixkens et al., 1995). С помощью RAPD-анализа ( декамерных праймеров) показана высокая вариабельность продуктов амплификации (ампликонов) среди 19 видов рода Hordeum (Gonzales et al., 1993). Аналогичная работа по изучению происхождения сортов ярового ячменя H.vulgare проведена Tinkey et al. (1993). Исследования проведены и с сортами редких видов, таких как папайя (Stiles et al., 1993), Azolla (Van Coppenolle et al., 1993), голубика (Vaccinium ashei) (Azuna et al., 1993), среди видов Stylosanthes quianensis (Kazan et al., 1992;

1993) и (Betula alleghaniensis) (Roy et al., 1992). Идентификацию с помощью RAPD-анализа сортов цветной капусты осуществлял Hu et al., (1991), а у сортов яблонь - Koller et al.

(1993).

Полученные данные о локализации RAPD могут быть с успехом использованы для создания эффективных генетических маркеров для картирования агрономически важных локусов.

Тесное сцепление найдено между локусами устойчивости к стеблевой ржавчине овса - Pg3 с RAPD-маркером (Penner et al., 1993) и Pc68 (crow rust resistence gene) (Penner., 1993). На близкоизогенных линиях бобов Phaseolus vulgaris L. был идентифицирован доминантный ген устойчивости к ржавчине (Uromyces Up appendiculatus) (Miklas et al., 1993). Найдены RAPD-маркеры, сцепленные с генами устойчивости к мучнистой росе у салата (Paran et al., 1991;

1993), с геном ym4, устойчивости к вирусу желтой карликовости ячменя (Ordon et al., 1995).

Идентификацию гена устойчивости к листовой ржавчине Agropyron elongatum провели Schacherman et al. (1995). На двух изогенных линиях “Arina” и “lr24” тестировали ПДРФ-проб и 360 RAPD праймеров. Шесть ПДРФ-проб и 11 RAPD-праймеров показали полиморфизм. Определение сцепления проводилось на 150 линиях, полученных от скрещивания близкоизогенных линий. Оказалось, что 6 ПДРФ-маркеров и 11 RAPD маркеров полностью сцеплены с геном устойчивости. Последовательности RAPD маркеров были клонированы и секвенированы. Синтезированы специфические праймеры, детектирующие только устойчивые генотипы. Для идентификации генов устойчивости (25 генов: с H1 по H25) к гессенской мухе (Mayetiola destructor Say.) использовались контрастные по устойчивости к вредителю близкоизогенные линии пшеницы T.aestivum L. После RAPD-анализа и денатурирующего гель-электрофореза было показано, что один из ДНК-маркеров ассоциирован с геном устойчивости Н9.

Lefebvre et al. (1995) на 85 молекулярных маркерах, включающих и ПДРФ маркеры, определили 14 групп сцепления общей длиной в 820 cM (от 36% до 59% генома) у перца (Capsium annum L.). Было идентифицировано два новых гена, представляющих агрономический интерес: устойчивости к и локус, TMV L контролирующий форму плодов. Картирование локусов важных агрономических признаков проведено Barua et al. (1993) на ячмене H.vulgare. В анализе использовали как RAPD, так и ПДРФ-маркеры, и были определены QTLs, отвечающих за такие признаки как высота, время колошения, рост. Plomion et al. (1995) на основе 263 RAPD маркеров определили 18 групп сцепления у сосны (Pinus pinaster Ait.), что составило % генома (1380 cM).

Существенный недостаток RAPD-маркеров - это в большинстве случаев полностью доминантный характер выявляемого полиморфизма, то есть формы различаются по наличию и отсутствию продукта амплификации. Это означает, что сложно отделить в популяции гетерозиготную особь среди доминантных гомозигот.

Случай кодоминирования, когда затрагивается не сайт узнавания последовательности праймера геномной ДНК, а внутренняя зона последовательности участка геномной, расположенной между последовательностями комплементарных праймеру, составляют исключения. Это обстоятельство, значительно усложняет исследования гетерогенных популяций с высоким уровнем гетерозигот. Поэтому для генетических исследований используют линии самоопылителей старших поколений и дигаплоидные линии, гетерозиготность у которых минимальна (Gale et a;

., 1992;

Kleinhofs et al., 1993;

Hayes, 1995;

Netsvetaev et al., 1995).

Paran I. и Michelmore R.W. (1993) предложили способ детекции полиморфизма с помощью ПЦР, используя информацию о нуклеотидной последовательности концевых участков продуктов амплификации с произвольными праймерами RAPDs. Подход получил название последовательностью участок “охарактеризованный амплификации” (SCARs, Sequence Characterized Amplified Regions). Эксперимент состоял в клонировании и секвенировании полиморфных RAPDs, сцепленных с генами устойчивости к болезням у салата. Концевые участки данных последовательностей использовали для синтеза 24-членных праймеров, 5`-концы которых содержали 10 нуклеотидные последовательности произвольных праймеров, остальные нуклеотидов принадлежали амплифицированному продукту. Показано, что при описанной процедуре может происходить смена наследования с доминантного (RAPD продукта) на кодоминантный (SCAR-продукт);

последний проявляется как наличие двух вариантов длины отвечающего одному локусу амплифицированного фрагмента, а не наличие-отсутствие самого фрагмента. По мнению авторов, в RAPD-продуктах преобладает доминантный тип наследования потому что мутационный процесс затрагивает в данном случае их концевые участки, участвующие в гибридизации с праймером. Если в этой зоне не будет достаточной комплементарности, то не произойдет амплификация.

Не понятно, почему возникает кодоминирование из доминантного типа наследования RAPD, так как кодоминантный тип наследования должен быть продемонстрирован и 10-членными начальными праймерами, а не проявляться в результате процедуры? Мутация, произошедшая в сайте праймирования, препятствует гибридизации праймера с геномной ДНК, в результате чего не происходит амплификации. В любом случае, синтезированные 24-членные праймеры, содержащие с 3`-конца 14 нуклеотидов полностью комплементарных геномной ДНК и допускающие возможность ошибок спаривания на оставшихся 10 нуклеотидах с 5`-конца, являются прекрасной затравкой для ДНК-полимеразы. Таким образом, данный метод вообще не должен выявлять полиморфизм и, тем более, не должно происходить смены доминантного на кодоминантный тип наследования. Действительно, в одном случае пара 24-членных праймеров не выявила полиморфизм, показанный 10-членным RAPD праймером. Авторы, видимо, учитывали этот момент и ужесточили условия отжига (600С), что обеспечивало амплификацию только с праймерами, полностью гибридизующимися на геномной ДНК. Данная работа интересна тем, что позволяет исследовать конкретный участок геномной ДНК без синтеза других продуктов ПЦР, не связанных с данным признаком.


При больших выборках при исследовании устойчивости к болезням доминантный упрощает процедуру анализа. В проведении SCAR-маркер электрофореза нет необходимости, достаточно убедиться, что амплифицированный продукт присутствует в пробирке, окрасив ДНК в ней. Кодоминирование в наследовании выявляется, если продукты RAPD рестрицировать мелкощепящей рестриктазой. Выявляемый в этом случае полиморфизм связан с мутацией в сайте рестрикции внутри первоначального RAPD-участка. Рестрикция геномной ДНК до амплификации не приведет к выявлению кодоминантного типа наследования, а только продемонстрирует дополнительный доминантный полиморфизм. Причем, общее количество полос на электрофореграмме уменьшится, а среди оставшихся некоторые полосы окажутся полиморфными.

д) метод полиморфизма длин амплифицированных фрагментов (AFLP) заключается в том, что используемая ДНК подвергается рестрикции, с последующим лигированием с коротким линкером, липкие концы которого комплементарны липким концам рестрицированной геномной ДНК. После этого с данным образцом ДНК проводят амплификацию с коротким праймером, комплементарным линкеру, в присутствии одного радиоактивного нуклеотида. Выявляется сразу большое число полиморфных локусов - от 10 до 30 на 50-100 продуктов амплификации, наследуемых по доминантному типу (NABGMP,1994).

Хотя доминантный тип полиморфизма, выявляемого ПЦР-маркерами, несколько ограничивает их применение в генетических исследованиях, однако, преимущество, которое имеют ПЦР-маркеры перед ПДРФ-маркерами, гораздо выше. Преимуществом ПЦР перед другими методами при выявлении полиморфизма является: высокая информативность, простота и скорость анализа, значительное уменьшение количества исходного материала для анализа, автоматизация и отсутствие необходимости в радиоактивном мечении. Показано (Ragot et al., 1993), что стоимость ПЦР-анализа значительно ниже, чем ПДРФ-анализа, при проведении исследований в малых и средних объемах, однако, при крупномасштабных исследованиях ситуация обратная.

Один фильтр с иммобилизованной на нем рестрицированной геномной ДНК можно использовать до 10 раз, что значительно снижает себестоимость ПДРФ-анализа.

Наиболее распространенные варианты ПЦР, используемых в исследовании полиморфизма, - это RAPD, SSRP и AFLP. Однако, RAPD является нерадиоактивным, быстрым и эффективным методом при исследовании молекулярно-генетического полиморфизма. Хотя многими авторами показана невоспроизводимость RAPD продуктов как в одной лаборатории, так и между лабораториями. Это обстоятельство охлаждает пыл при широком использовании RAPD. На основании этого целью данной работы было оптимизация ПЦР с произвольными праймерами для достижения воспроизводимых результатов и показать, что могут быть RAPD-маркеры использованы в исследовании полиморфизма и картирования генома ячменя (Hordeum vulgare L.) и локусов количественных признаков.

ГЛАВА 2. Материал и методы 2.1. Использованный материал В качестве материала для исследования были использованы некоторые виды рода Hordeum L.: H. agriocrithon A`berg., H. spontaneum C.Koch., H. lagunculiforme Bacht., H. vulgare L., H. chilense Roem. et Shult., H. bulbosum L., а также Triticum durum L. (линия 350-72), Triticum aestivum L. (Одесская полукарликовая), Secale cereale L.

(Харьковская 60).

Для исследования межвидового полиморфизма рода и Hordeum L.

специфичности произвольных праймеров в выявлении полиморфизма использовали линии кукурузы (Zea mays L.) - Од322 и 074/87, а также их гибрид 074/87xОд322;

сорта сои (Glycine max (L.) Merr.).

Внутривидовую изменчивость изучали на 21 сорте ярового ячменя: Джау Кабутак, Одесский 31, Одесский 70, Одесский 100, Донецкий 8, Донецкий 9, Исток, Циклон, Черноморец, Винер, Riso 56, Riso 1508, Нутанс 106, Корал, Паллидум 32, Паллидум 331/13, Betzes, Bomi, Bonus, Athos, Calsberg II.

Для картирования локусов количественных признаков анализировали 150 линий самоопыляющейся популяции №106 (F7 F8, Одесский 115/Golf), популяцию сорта и Productiv, линии пшеницы Chinese spring дополненные хромосомами (кроме пятой) ячменя сорта Betzes, полученных из отделов: генетических основ селекции, селекции ячменя и отдела генетики СГИ УААН г.Одесса.

2.2. Выделение высокомолекулярной растительной ДНК Несколько (не более 5) этиолированных проростков (размером около 1 см каждый) для сортов ячменя или один проросток для популяции №106, растирали пестиком в эппендорфе с 0.5 мл лизирующего раствора (20 mM Na3EDTA, 100 mМ трис-НСl, рН 8.0 (250С), 1.4 М NaCl, 2 % CTAB) и выдерживали в течение 1 часа при 600С. Добавляли равный объем смеси хлороформа и изопентанола (24:1) и тщательно перемешивали. ДНК осаждали равным объемом изопропанола после 5 минутного центрифугирования в настольной центрифуге Eppendorf 5415 при максимальных оборотах. Осадок ДНК растворяли в 500 мкл раствора ТЕ (10 мМ трис-НСl, рН 8.0 и мМ Na3EDTA) в присутствии 1 мкг/мл РНКазы А.

Концентрацию ДНК определяли с помощью флюориметра ТКО 100 (Hoefer Scientific Instruments, San Francisco) в растворе 1xTNE (10 mM трис-НСl, рН 7.4 (250С), 100 mM NaCl, 1 mM Na3EDTA ) и 100 мкг/мл интеркалирующего красителя Hoechst 33258 (Riber et al., 1990). Для определения концентрации ДНК достаточно 4 мкл маточного раствора. Чувствительность прибора составляет 1 нг ДНК.

Маточный раствор ДНК разбавляли в отдельных пробирках до концентрации мкг/мл и хранили в холодильнике при 40С. Маточный раствор хранился при -700С.

2.3. Полимеразная цепная реакция В работе использовали Taq-полимеразу, выделенную в отделе генной инженерии по методике Engelke et al., (1990) и Pluthero (1993). Полимеразная цепная реакция с произвольными праймерами проводилась в реакционном растворе в присутствии 3 мМ ионов магния, а при направленной амплификации - 1.5 mM.

Температура отжига при направленной амлификации была на протяжении всей реакции равной 550С, тогда как для ПЦР с произвольными праймерами отжиг на первых четырех циклах реакции был ниже оптимальной на 5-10 градусов. Реакционная смесь для полимеразной цепной реакции объемом 20 мкл содержала: 50 мМ КСl, мМ трис-НСl, рН 8.4 (250С), 3 (1.5) мМ MgCl2, 0.01 % Tween-20, 0.15 мМ каждого dNTP, 0.3 мкМ праймера, 5 % глицерина, 20 нг ДНК и 1 ед. Taq-полимеразы. В пробирки наслаивали мкл минерального масла. Амплификацию с произвольными праймерами проводили следующим образом: первая денатурация - 2 минуты при 940С;

первые четыре цикла - 940 C, 1 мин., 1.5 минуты при 40-430С и 2 мин. при 720С;

в последующих циклах отжиг осуществлялся при 47-550С в зависимости от праймера.

Проводилось 35 циклов реакции. Последняя элонгация длилась 10 минут.

Реакцию останавливали, добавляя 60 мкл раствора ТЕ (10 mM трис-HCl, 1 mM ЭДТА Nа3, рН 8.0). Для одного электрофореза использовали шестую часть реакционной смеси. Продукты амплификации фракционировали электрофорезом в 2 % агарозном геле в 1xTBE (50 mM трис-H3BO3 и 1 mM ЭДТА-Nа3, рН 8.0) в течении 5-7 часов при напряжении 50 вольт и визуализировали бромистым этидием.

2.4. Синтез и очистка олигонуклеотидов Шестьдесят восемь праймеров, длиной от 10 до 24 нуклеотидов, были синтезированы на автоматическом ДНК - синтезаторе “Applied Biosystems 380 В” цианофосфорамидитным методом Растворы фосфорамидитов в (Табл.1).

ацетонитриле доводили до концентрации 50 мг на 1 мл. Использовали колонки для твердофазного синтеза олигонуклеотидов емкостью 0.2 мкМ (Applied Biosystems), с выходом до 15 O.Е. (33 мкг олигонуклеотида на 1 О.Е.). Короткие олигонуклеотиды (10 15 нуклеотидов) не требовали очистку, поэтому синтез заканчивался снятием всех защитных (тритильных) групп (trityl-off). Синтез более длинных олигонуклеотидов требовал очистку на колонках OPC (Oligonucleotide Purification Cartridges), поэтому синтез заканчивали без снятия тритила (trityl-on). Очистку trityl-off олигонуклеотидов проводили также с помощью электрофореза в денатуирующем полиакриламидном геле с 7М мочевиной и экстракцией водой из геля.

Очистку ацетонитрила осуществляли путем длительного обезвоживания в CaH (Sigma) при нагревании и перегонкой с хлоркальциевой трубкой. Необходимые реактивы для синтеза были получены из института Биоорганической химии имени Шемякина и Овчиникова РАН (Россия):

· Окислитель - 0.1М J2 в тетрагидрофуране (ТГФ) (J2 -1.14 г., ТГФ - 60 мл, пиридин - 20 мл, вода - 2 мл);

· САР А - 10% уксусный ангидрид, 10% 2,6-литидин, 80% ТГФ · САР В - 6 мл 1-метилимидазол, 94 мл ТГФ;

· Трифрорацетат - 0.1М трифторацетат или дихлорацетат (3-3.4 мл) в дихлорметане (450 мл);

· 0.1 М тетразол - 35 г. тетразола растворить в 1 литре сухого ацетонитрила.

Таблица 1.

Последовательность произвольных праймеров используемых в полимеразной цепной реакции для анализа генетического полиморфизма ячменя КОД ПОСЛЕДОВАТЕЛЬНОСТЬ ПРАЙМЕРОВ Tm* (5` - 3`) AATTCGAGGATCCGGGTACCATGG P1 59. GACAGACAGACAGACA P2 50. GATTTAGGTGACACTATAG P3 51. GAGCAAGTTCAGCCTGG P6 53. TAATACGACTCACTATAGGG P7 52. CAGGAAACAGCTATGAC P8 52. ACCACAGGCAGAGTAAGAGG P9 54. CCACCCTGCTTACAGCAATG P10 55. TTATGAAAACGACGGCCAGT P22 55. TTCTCCTGAATCGGA P23 52. TGCTCTGCCC P24 50. GTGGTGGTGG P25 49. TACCTTCCCC P26 49. TACCTTCCCG P27 49. CAAACGTCGG 46. P GCAGAGGAAGAG P30 49. CCAAGGAAGCGG P31 52. TCGTCGATCGCG P32 52. CAGCTGGGGA P34 50. GAGACCTCAC P35 47. CCGAATTCGC P36 50. CTGACCAGCC P37 49. CCAGTTCGCC P39 50. ACTCACTCGA P40 47. ATAGGCGAGT P41 47. ATGTGGTGGT P42 48. AGTCAGCTGC P43 48. GGACCCCGCC P44 52. AAGGAGTGTG P45 47. GGTTGGGGAG P46 49. GGAGAGGGGG P47 50. GCGGTGCTCG P48 50. GACAGCCTAC P49 47. CCTGGAGTTG P50 48. AGGACTGGAC P52 48. CGATTTGTCC P56 48. TCAGGACGCTAC P57 49. GAGGGGTTCGAGGCC P58 54. CAAACCCAACGA P59 50. GGACTGGGTCCG P61 51. TGCAGGACACCCGCCGCCAA P62 59.

CTGCCGCACTTGATACGTTGTC P63 56. TGACCGGCAGCAAAATG P64 54. TCTTGGCGGTGGGAGCCTAGG P65 58. GTAAAACGACGGCCAGT P66 54. ATCCCTCTGGCATCGGCGTAA P67 57. GAGGAAGGTCTTCATGGTGGC P68 56. AGCCTGATGCC P69 50. GGTAAGAAATTGCACTTCC P73 53. TAGCCTATTGGGCCACCC P74 55. CTGGAATATTCCCG P75 52. CCCACAAAGAAAGCAATGG P76 55. TTATCATGGGGGCAACGC P77 55. TGATCCCTCTGGCACTGG P78 54. GCTCTACAAGGCCAATGG P79 54. TGGGAAGTCCTCGTGTTGCA P80 55. TTTAGTGCTGGTATGATCGC P81 54. GAGCCGTGCTGCCGGAGC P82 57. GCCGTGAAGCCTGATGCC P83 56. CACGCCCTCGCCAACGCTCTCCA P84 60. GGGGAGATATCGACCAAAGT P85 55. ATCCAGTTCTTGTGCACCTG P86 54. GGTACGAACATGGAGGTACT P87 54. GACCTCCACGAGTTGC P88 52. GCTGCGCGCTTCAGCT P89 55. CTGGGGTTGGTTCTGG P90 53. GGCAGCAACATGGCATTC P91 55. CCACCAAGCGTGGAGTC P92 54. GGGTGGCGTGGGGTG P93 55. * - температура плавления праймера 2.4.1. Очистка коротких (до 40 нуклеотидов) олигонуклеотидов на ОРС Необходимые растворы:

· ацетонитрил для HPLC, 5 мл · 2.0 триэтиламин ацетат, 5 мл · вода MilliQ · 1.5 М NH4OH, 15 мл · 2% трифторацетат · 20% v/v ацетонитрил в воде, 1 мл · ТЕ (10 мМ трис-НСl, рН 8.0 и 1 мМ Na3EDTA), 1 мл 1. После завершения trityl-on синтеза, олигонуклеотиды инкубировали в 30% NH4OH при 55 0C в течении ночи (для снятия тритильных групп).

2. Промывали колонку ОРС (Oligonucleotide Purification Cartridges) 5 мл ацетонитрила и затем 5 мл 2.0 М триэтиламин ацетатом.

3. Разбавленные на треть водой MilliQ, олигонуклеотиды (4 мл) наносили на колонку по 1-2 капли в секунду (все процедуры с нанесением на колонку проводятся с данной скоростью). Собранный элюат наносили повторно на колонку.

4. Промывали колонку по 5 мл три раза 1.5 М NH4OH, а затем по 5 мл два раза водой MilliQ.

5. Пропускали через колонку 1 мл 2% трифторацетата и выжидали 5 минут.

Процедуру повторяли с оставшимися 4 мл 2% трифторацета.

6. Промывали колонку по 5 мл два раза водой MilliQ.

7. Элюировали очищенные олигонуклеотиды 1 мл 20% v/v ацетонитрилом.

Олигонуклеотиды концентрировали в SpeedVac и растворяли в 1 мл раствора ТЕ.

Концентрацию олигонуклеотида измеряли с помощью спектрофотометра при длине волны в 260 нм.

2.4.2. Очистка 10-членных олигонуклеотидов Необходимые растворы:

· 2% LiClO4 в ацетоне, 1 мл · перегнанный сухой ацетон, 1 мл · вода MilliQ · ТЕ (10 мМ трис-НСl, рН 8.0 и 1 мМ Na3EDTA), 1 мл 1. После завершения trityl-off синтеза, олигонуклеотиды инкубировали в 30 % NH4OH при 550C в течении ночи (для снятия тритильных групп). Аммиак упаривали в SpeedVac.

2. Осадок олигонуклеотидов растворяли в 100 мкл воды.

3. Наслаивали по стенке пробирки 1 мл 2% LiClO4 в ацетоне, тщательно перемешивали и осаждали в настольной центрифуге при 14000 об/мин в течение минут.

4. Осадок промывали 1 мл ацетона и высушивали.

5. Осадок олигонуклеотидов растворяли в 1 мл раствора ТЕ. Концентрация олигонуклеотида измеряли с помощью спектрофотометра при длине волны в 260 нм.

2.4.3. Очистка олигонуклеотидов в полиакриламидном геле Необходимые растворы:

· 20хSTOK (350 мл H2O, 480 г. мочевины, 190 г. акриламида, 10 г. бисакриламида) (выдерживали при 550С в течение часа) · 20xТВЕ (1 М трис-ОН, 1 М Н3В3О, 20 мМ ЭДТА-Na3) · 10 % полиакриламидный гель (35 мл 20xSTOK, 35 мл 7М мочевины, 3.6 мл 20xТВЕ, 0.72 мл 10% персульфата аммония, 15 мкл ТЕМЕD) · вода MilliQ · 20 % ацетонитрила · колонки AmprepC18 (по 100 мг носителя) (Amersham) · ТЕ (10 мМ трис-НСl, рН 8.0 и 1 мМ Na3EDTA), 1 мл 1. Электрофорез проводили при напряжении тока 100 вольт в течение 1 часа.

2. Использовали люминофор для детекции локализации олигонуклеотида, под УФ-лучами. Вырезали гель с праймером и помещали гель в наконечник объемом на мл. Для предотвращения выпадения геля из наконечника - его нижную часть заполняли стеклянной ватой и закрывали парафилмом. Наконечник заполняли стерильной водой и выдерживали в течении ночи. Процедуру повторяли, а воду с экстрагированным олигонуклеотидом собирали в эппендорфах.

3. Очистку олигонуклеотида от мочевины и примесей геля проводили на колонке AmprepC18. Наносили весь собранный элюат на колонку, затем колонку промывали мл стерильной воды, элюировали олигонуклеотид 2 мл 20% ацетонитрила.

4. Концентрировали олигогуклеотид в Speed Vac и растворяли в в 1 мл раствора ТЕ. Концентрацию олигонуклеотида измеряли с помощью спектрофотометра при длине волны в 260 нм.

2.5. Электрофорез и идентификация изоферментов Полиморфизм a- и b-амилаз, а также эстераз I и V в линиях самоопыляющейся популяции №106 исследовался Нецветаевым В.П. и Чаплей А.Е. (отдел генетических основ селекции СГИ, Одесса) (Нецветаев, 1993), которые любезно предоставили нам результаты для совместного анализа.

2.6. Компьютерный анализ полученных результатов 2.6.1. Определение сцепления и картирование молекулярных маркеров с помощью программы MAP_QTL При генетическом картировании простых по наследованию и локусов количественных признаков (QTL, Quantitative Trait Loci) используются в основном две модели и, соответственно, две компьютерные программы (две модели): MAPMAKER QTL (метод максимального правдоподобия) (Lander et al., 1987) и QTL-STAT (нелинейный метод наименьших квадратов). При сравнении результатов сцепления QTLs с молекулярными маркерами, проведенных с помощью этих программ, сходными оказалось 75% (Grattapaglia et al., 1995). Многоточечный анализ по общей генетической дисперсии, на примерах некоторых QTLs (вес проростка - 89.0%;

вес отростков после усечения - 67.1%;

вес корней после усечения - 62.7%) показал, что значительная часть различий в эффекте этих у QTLs Eucalyptus grandis контролируется небольшим числом родственных главных QTL. Приобретение данных программ не представилось возможным. По этой причине, используя известные формулы и модели разработана компьютерная программа “MAP_QTL”, производящая расчеты даже на базе 286 процессора.

Программа “MAP_QTL” разработана для определения сцепления локуса молекулярного маркера c локусом количественного признака и последующего картирования. Анализируемый файл с данными подготавливался в текстовом редакторе, например “Q”, позволяющем создавать строки длиной до 256 знаков, так как именно такой максимальной длиной строки могут быть представлены данные. В начале файла создаются идентификаторы качественных и количественных показателей, разделяющихся апострофом (‘ или `) и длиной до 20 знаков.

Качественные показатели имеют цифровые идентификаторы, следуемые сразу же после апострофа, например, ‘1 - P6#900 или ‘2 - BmyI. Количественные показатели имеют буквенные идентификаторы, следуемые сразу за апострофом, например, ‘A масса 1000 зерен или ‘B - натура. За идентификаторами следуют строки с собственно данными: первая строка - определитель колонок количественных и качественных показателей, а затем следуют две строки родительских генотипов идентифицируемых в начале строки как “P1” и “P2” и только затем следуют строки, с обозначением генотипов каждой линии. Информация качественного показателя может быть кодирована в трех вариантах - “1” - наличие полиморфной полосы у образца, “0” отсутствие или аллель с другим молекулярным весом (доминирование) (кодоминирование), “*”- гетерозигота. Количественные показатели записываются в столбик под данным идентификатором для каждой линии в виде значений, полученных при измерении, до 5 знаков на колонку. Отсутствие информации для данного образца пустая ячейка.

Количество анализируемых линий не должно превышать 150, что можно считать достаточным для генетического анализа. Например:

’1 - P6#900 ‘2 - P9#950 ‘3 - P66#2300’4 - BmyI ‘5 - AmyI ‘6 - Est ‘A - масса 1000 зерен ‘ B - пленчатость % ‘C - белок % номера линий A B C 1 2 3 4 5 P1 Дн-4 44.3 10.8 10.1 1 1 0 1 1 Р2 Джау Кабутак 40.1 8.2 12.5 0 0 1 0 0 44.6 7.7 11.2 1 1 1 1 0 39.6 11.3 9.9 1 1 0 1 0 37.7 9.8 12.2 1 0 1 0 0 41.3 9.9 9.7 1 0 0 0 0 45.3 11.1 12.3 0 1 1 0 0 37.9 10.7 10.0 0 0 0 0 1 Частоту рекомбинации для F2-F5 оценивали предложенным Фишером методом максимума правдоподобия, который использует всю возможную информацию выборки о частоте рекомбинации. Формулы для вычисления частоты рекомбинации и ошибки частот рекомбинаций представленные в работе Allard (1956), а также у Серебровского (1970).

Вычисление частоты рекомбинации для самоопыляющейся популяции или гибридов старших поколений (F6-10) осуществляли по формулам Созинов и др., (1978):

a+b p=, 2( c + d ) где p - частота рекомбинации;

a и b - количество рекомбинантных, c и d - материнских генотипов.

Ошибку частоты рекомбинации определяли:

p Sp = (1 + 2 p ), 2n где Sp - ошибка частоты рекомбинации;

n - размер выборки (a+b+c+d). Критерием X l2, который определяли по упрощенной формуле:

достоверности служил 4 ( c + d )( a + b ) X l2 = n -.

n X l Недостоверными считались результаты, при которых значения были ниже 8.

X l Соответственно максимальная величина будет равна размеру выборки при 0 % рекомбинации.

Перевод данных о процентах рекомбинации (p) в сантиморганиды осуществляли с помощью формулы:

cM = - ln(1 - 2 p ), где cM - сантиморганиды, р - частота рекомбинации.

Ошибку при вычислении сантиморганид определяли по формуле:

Sp S=.

1- 2p Процесс определения групп сцепления начинается с того, что определяется сцепление между конкретными локусами с учетом достоверности. Затем определяется принадлежность каждого маркера к определенной группе сцепления, а также определяется количество точек в группе. При наличие маркеров сцепленных на 0% рекомбинации, их название заменяется на общее.

Наиболее сложная наблюдается ситуация при сцеплении двух маркеров тесное сцепление маркеров, располагающихся на одинаковом расстоянии. Решение данной проблемы состоит в использовании данных по сцеплению с дальними точками.

В дальнейшем процесс связан с отсеиванием дополнительной информации, связанной со сцеплением каждого маркера с дальними точками. Используя только ближайшие расстояния между точками выстраивается карта сцепления. Полученные результаты записываются в файл.



Pages:   || 2 | 3 |
 





 
© 2013 www.libed.ru - «Бесплатная библиотека научно-практических конференций»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.