авторефераты диссертаций БЕСПЛАТНАЯ БИБЛИОТЕКА РОССИИ

КОНФЕРЕНЦИИ, КНИГИ, ПОСОБИЯ, НАУЧНЫЕ ИЗДАНИЯ

<< ГЛАВНАЯ
АГРОИНЖЕНЕРИЯ
АСТРОНОМИЯ
БЕЗОПАСНОСТЬ
БИОЛОГИЯ
ЗЕМЛЯ
ИНФОРМАТИКА
ИСКУССТВОВЕДЕНИЕ
ИСТОРИЯ
КУЛЬТУРОЛОГИЯ
МАШИНОСТРОЕНИЕ
МЕДИЦИНА
МЕТАЛЛУРГИЯ
МЕХАНИКА
ПЕДАГОГИКА
ПОЛИТИКА
ПРИБОРОСТРОЕНИЕ
ПРОДОВОЛЬСТВИЕ
ПСИХОЛОГИЯ
РАДИОТЕХНИКА
СЕЛЬСКОЕ ХОЗЯЙСТВО
СОЦИОЛОГИЯ
СТРОИТЕЛЬСТВО
ТЕХНИЧЕСКИЕ НАУКИ
ТРАНСПОРТ
ФАРМАЦЕВТИКА
ФИЗИКА
ФИЗИОЛОГИЯ
ФИЛОЛОГИЯ
ФИЛОСОФИЯ
ХИМИЯ
ЭКОНОМИКА
ЭЛЕКТРОТЕХНИКА
ЭНЕРГЕТИКА
ЮРИСПРУДЕНЦИЯ
ЯЗЫКОЗНАНИЕ
РАЗНОЕ
КОНТАКТЫ


Pages:     | 1 || 3 |

«УКРАИНСКАЯ АКАДЕМИЯ АГРАРНЫХ НАУК СЕЛЕКЦИОННО-ГЕНЕТИЧЕСКИЙ ИНСТИТУТ на правах рукописи КАЛЕНДАРЬ РУСЛАН НИКОЛАЕВИЧ ...»

-- [ Страница 2 ] --

Достоверностью средних значений технологических показателей служили параметрические T (Стюдента) и F (Фишера) критерии. T-критерий определялся как отношение разности выборочных средних к своей ошибке, а F-критерий как отношение выборочных дисперсией (Ли, 1978;

Лакин, 1990;

Компьютерная биометрика, 1990).

2.6.2. Построение схем филогенетических взаимоотношений с помощью программы TREE 4. Для установления генетических дистанций по данным полиморфизма продуктов ПЦР использовался метод Нея и Ли (Nei, Li, 1979). Коэффициент генетического сходства между двумя сравниваемыми на электрофорезе образцами вычисляли по формуле :

2 N xy F=, Nx + Ny где Nxy - число общих полос у сравниваемых образцов Х и Y;

Nx - количество полос образца X;

Ny - количество полос образца Y. Коэффициент генетической дистанции D по Нею (Nei, 1972) выражается как :

D = - ln( P ).

Р можно оценить через, F используя итеративную формулу (Nei, 1987):

P = 4 F ( 3 - 2 P1 ), где Р1 имеет первоначальное равное F, последующие итерации проводятся до тех пор пока P = P1.

Любезно предоставленные нам программы “d-Value”, “UPGMA” и “NJTREE” доктором Л. Гензбиттелем (L.Gentzbittel, Universite Baiaise-Pascal Clermont-Ferrand, France) не позволяют быстро анализировать полученные многочисленные данные.

Вводимая информация состояла из результата анализа каждого образца со всеми количество общих полос, и количество полос для каждого из сравниваемых образцов.

Так для построения дерева для 120 образцов необходимо было вычислить n2 - n Sp = (арифметическая прогрессия, где n - число образцов) чисел с точность до пятого знака после запятой. Даже для меньшего числа сравниваемых образцов данная процедура становится нереальной. Поэтому разработана программа “TREE” (ее модернизированая версия 4.0) позволяющая строить схемы-дендрограммы, используя данные электрофоретического разделения белков и ДНК, а так же использовать количественные показатели, удобным для пользователя способом.

Необходимым условием анализа является наличие текстового файла с данными электрофореграмм (аналогично подготовленному в текстовом редакторе, как это показано для программы “MAP_QTL”). Присутствие полосы на данном уровне обозначается как “1” ее отсутствие - “0”, если на том же уровне у различных oбразцов имеется полоса с разной интенсивностью имеют различную частоту (сорта встречаемости данного продукта), тогда полоса с максимальной интенсивностью обозначается как “2”, а с меньшей “1” и коэффициент сравнения тогда равен 0,5.

Первые строки в файле отводятся под комментарии, выделяемые в начале строки апострофом (‘ или `). Затем, в каждой новой строке записываются названия образцов (до 20 знаков и без пробелов), разделенным апострофом от последовательности цифр данных электрофореза длиной до 256 знаков. В один и тот же файл можно дописывать данные для других праймеров, в случае ПЦР.

Вычисление производятся по известным формулам. При сравнении образцов по количественным признакам определяли коэффициент сходства который (F), подсчитывали как отношение меньшего значения у сравниваемых образцов к большему. В конечный результат входила средняя арифметическая от суммы по каждому из значений технологических показателей.

Данные нескольких файлов могут быть суммированы и использованы для построения усредненной дендрограммы. Матрицы, полученные по данным анализа различных методов (например, анализ запасных белков и ПЦР-анализ), используются для построения дендрограммы. Программа осуществляет кластерный анализ, используя модули UPGMA (парно-групповой невзвешенный метод) (Sneath, Sokal, 1973) и NJTREE (метод ближайших соседей) (Saitou, Nei, 1973). Например:

’Образцы сортов ячменя ПЦР - праймер P6 и P Одесский100 ‘00001110101010101010101 Одесский131 ‘00010101000101010010101 Одесский151 ‘10101010100111110110100 Прерия ‘11101010101111110000001 Престиж ‘01111001011100011010101 Дерибас ‘11101000000010011111110 Эдем ‘21010101000111111000001 Паллидум107 ‘10101010011110100000111 КалсбергII ‘11101111101011101010001 2.7. Количественные показатели Количественные показатели за 1994 и 1995 годы 150 линий самоопыляющейся популяции №106 определял Чапля А.Е.

Исследовали следующие количественные показатели - масса 1000 зерен (граммы), кустистости (число стеблей к числу растений), озерненности (число зерен с растений к числу стеблей), продуктивности (вес зерна к числу растений), числу зерен одного растения.

ГЛАВА 3. Оптимизация условий полимеразной цепной реакции c произвольными праймерами 3.1. Моделирование полимеразной цепной реакции Хотя использование ПЦР с произвольными праймерами насчитывает около лет (c 1990 г.), проблема воспроизводимости результатов до сих пор не потеряла актуальности. Об этом свидетельствуют многочисленные работы в области оптимизации и стандартизации процесса амплификации ДНК с помощью ПЦР (Wolff et al., 1993;

Michli et al., 1994).

На взаимодействие между отдельными нитями, дуплексами, петлями шпилек и другими типами молекул, формируемых в течении ПЦР, влияет ряд параметров.

Использование произвольных праймеров требует определенных условий реакции, от которых зависит воспроизводимость результатов. Для поддержания необходимого равновесия эти условия должны быть тщательно оптимизированы. Такие параметры, как продолжительность и температура отжига, элонгации, денатурации, число циклов, скорость нагрева и охлаждения, концентрация праймеров, матрицы, ионов, источник и качество ДНК-полимеразы, влияющие на результат амплификации, по нашему мнению, должны быть стандартизированы. На результатах сказывается и качество препаратов геномной ДНК. Кроме того, использование различных по размерам и нуклеотидному составу олигонуклеотидов требует и особых условий проведения реакции. Критическим является температура отжига, так как денатурация и элонгация, проводится всегда при фиксированной температуре (температура денатурации ДНК от 90 до 95, а элонгация от 68 до 74 градусов) и изменения не играют существенной роли в амплификации. Отжиг - эта та стадия от которой во многом зависит амплификация нужного фрагмента и его количественный выход. Воспроизводимый с максимальным выходом продукт амлификации можно получить только при оптимальных условиях проведения реакции. По этой причине была предложена модель полимеразной цепной реакции с произвольными праймерами. Результаты данной модели использовались при оптимизации условий проведения температурного режима отжига.

Для начала необходимо определить понятия, которые будут использованы в описании механизма полимеразной цепной реакции с произвольными праймерами.

Основной продукт полимеразной цепной реакции это (ампликон) двухцепочечная молекула ДНК, концы которой фланкированы последовательностью праймеров и комплементарного им участка ДНК.

Структура продукта амплификации с единичным произвольным праймером представляет фрагмент ДНК, фланкированный инвертированной последовательностью праймера.

Полупродукт полимеразной цепной реакции - это одноцепочечная молекула ДНК, содержащая на конце последовательность праймера. Молекулы полупродуктов участвуют в образовании основного продукта и других полупродуктов реакции (рис.1).

Накопление полупродуктов происходит за счет образования новых молекул полупродуктов в каждом цикле.

Цикл полимеразной цепной реакции начинается с денатурации ДНК, затем отжига праймера на ДНК-матрицу (полупродукт предшествующего цикла или геномная ДНК) и завершается синтезом полупродукта ДНК-полимеразой. Полимеразная цепная реакция с произвольными праймерами обычно происходит в присутствии одного праймера, который выполняет функцию прямого и обратного. При амплификации участка ДНК праймер образовывает дуплексы с обоими комплементарными нитями ДНК. 3'-концы праймера ориентируются внутри амплифицируемого фрагмента (ампликона).

Рис.1. Схема образования продукта полимеразной цепной реакции c произвольными праймерами Для упрощения моделирования полупродукты амплификации ПЦР были дифференцированы по двум признакам: по природе их образования и степени комплементарности концевых участков.

Образование полупродуктов зависит от типа матрицы, с которой синтезирована копия данного полупродукта (матрицей может служить как геномная ДНК, так и синтезированные ранее полупродукты).

Каждый тип полупродукта включает нити ДНК, синтезированные с комплементарных матриц.

В формулах, описывающих динамику образования каждого типа полупродуктов ПЦР, учитывается тип матриц, принимающих участие при их образовании в конкретном цикле n и оценивается вклад других полупродуктов из предшествующих циклов. Тип данного полупродукта не изменяется в течение всей реакции, формулы состоят из двух частей: одна описывает количество образованных молекул полупродукта в данном цикле, вторая - количество полупродукта, полученного из предыдущих циклов.

Из рисунка 1 видно, что в первом цикле образуются молекулы, более длинные, чем продукт, связанный с ДНК-матрицей. Назовем этот тип полупродукта - «а».

Количество молекул «а», синтезируемых в каждом цикле реакции, одинаково. Сумма молекул комплекса «a»+»Ms» - S(«a»+»Ms») (где «Ms» - матричная ДНК в одноцепочечной форме) - равна количеству матричной ДНК S(«Ms»). Длина полупродукта типа «a» больше, чем длина последовательности основного продукта, так как терминация синтеза ограничена пределами нити ДНК или ее денатурацией.

Cуммарное количество молекул «а» - S(an), образованных за n циклов, описывается следующей формулой:

S(an)=Ms + S(an-1) (1) S(an) = 2n Мd (1.1) Для остальных формул количество матричной ДНК - Md (Md в двухцепочечной форме, Ms - в одноцепоченой форме) принято равным единице, в противном случае формулы по динамике образования полупродуктов необходимо умножить на соответствующее количество матричной ДНК.

На втором цикле с молекул полупродукта типа «а» предыдущего синтеза S(an-1) образуется новый тип полупродукта - «b». Данный тип полупродукта короче, чем молекулы «а», и в следующем цикле образует продукт реакции.

Суммарное количество молекул типа «b» - S(bn) (арифметическая прогрессия), образованных за n циклов:

S(bn) = S(an-1) + S(bn-1) (2) S(bn-1) = n2 - 3n + 2 (2.1) S(bn) = Md (n2 - n) (2.2).

На 5`-конце праймера возможны некомплементарные матрице нуклеотиды, характерные только для молекул полупродуктов типа «a» и «b».

В третьем цикле с молекул «b» синтезируются молекулы «d», равные по длине молекулам «b». С третьего цикла впервые образуется продукт, который представлен двухцепочечной молекулой ДНК, содержащей цепь молекулы «b» и молекулы «d».

Суммарное количество синтезированных молекул типа «d» S(dn) за n циклов (геометрическая прогрессия):

S(dn) = S(bn-1)+ S(dn-1) (3) S(dn-1) = 2n - n2 + n - 2 (3.1) S(dn) = Md (2n+1 - n2 - n - 2) (3.2) Молекулы типа «b» и «d» одинаковы по нуклеотидному составу, но происходят от разных матриц (рис. 1, Табл. 2).

Особенности молекул этих типов состоят в следующем: во-первых, полупродукт «b» синтезируется на матрице «a» с образованием комплекса «a»+»b», по структуре не соответствующем характеристике продукта ПЦР (длина молекул типа «a» всегда больше длины продуктов амплификации);

во-вторых, матрицей полупродукта «d»

является «b», последовательности обоих полностью комплементарны, и комплекс «b»+»d» представляет собой полноценный продукт;

синтез «d» происходит на третьем цикле и косвенно связан с полупродуктом «a» через «b». Для удобства описания образования продукта ПЦР полупродукта типа «b» недостаточно, и поэтому был введен полупродукт типа который идентичен ему по нуклеотидной «d», последовательности.

Логические формулы (1-3) объясняют происхождение образования данного типа полупродукта, а формулы 1.1, 2.2, 3.2 - пригодны для количественных расчетов.

В образовании основного продукта принимают участие молекулы типа «b» и «d», синтезированные в предыдущих циклах, то есть S(bn-1) и S(dn-1). Образование продукта ПЦР можно описать как сумму:

Pd = S(bn-1)+ S(dn-1), (4) где Pd - продукт ПЦР (если количество матрицы Md = 1).

Таблица Динамика образования продукта и полупродуктов ПЦР.

Число циклов Количество полупродуктов Продукт “a” “b” ”d” Pd 1 2 4 3 6 6 2 4 8 12 10 5 10 20 32 6 12 30 84 7 14 42 198 8 16 56 438 20 40 380 2096730 * Md = 1.

Из всех синтезированных в ПЦР молекул только комплексы типа «a»+»Ms» и «a»+»b» не являются продуктом реакции, и поэтому их количество снижает значение 2n к значению 2n -2n. Количество комплекса S(«a»+Ms») равно количеству 2Мd, а S(«a»+»b») равно 2 (n-1). Сумма («a»+»Ms») и S(«a»+b) дает 2(Md + n-1), если Мd = 1, то сумма равна 2n. Образование продукта возможно описать таким образом:

Pd = Md (2n - 2n) (5).

Данная зависимость объективна для идеальных условий, когда все компоненты реакции (dNTP, Taq-полимеразы, праймера) в избытке. При недостатке какого-либо компонента эффективность образования продукта ПЦР снижается.

Предложенная математическая модель динамики образования продукта и других молекул реакции амплификации необходима для описания начальных циклов, так как в дальнейшем количество комплексов и будет «a»+»Ms» «a»+»b»

незначительным по сравнению с комплексами «b»+»d» и «d»+»d»:

S (bn ) + S ( d n ) n -1= - Pd (6).

3.2. Оптимизация условий проведения отжига ПЦР Известны эмпирические формулы измерения температуры плавления олигонуклеотидов:

(Коробко и др., 1984), Tm = 2 S(A+T) + 3 S(Ц+Г) (7) Tm = 2 S(A+T) + 4 S(Ц+Г) - 5 (Meinkoth et al., 1984) (8).

Однако, данные формулы не применимы при вычислении оптимальной температуры отжига ПЦР, так как полученные с помощью их значения, не соответствуют реальной картине амплификации (праймеры с одинаковым ГЦ-составом и одинаковым размером могут иметь разную температуру плавления, а праймеры с разной длиной могут иметь одинаковую температуру плавления). Закон распределения ГЦ-состава для праймеров с фиксированным размером имеет прерывистый характер, а температура плавления праймеров подчиняется непрерывному закону. В ПЦР с 10-членными произвольными праймерами, отжиг обычно проводят при температуре от 35 до 40 градусов (Williams et al., 1990).

В работе Wolff et al. (1993) было показано, что на выход конечного продукта ПЦР влияют следующие факторы: качество ДНК-полимеразы, последовательность праймера, температура отжига и особенности амплификатора. Оптимальная температура отжига не коррелирует с ГЦ-составом праймера.

Rychlik et al. (1990) была предложена формула для вычисления оптимальной температуры отжига, в зависимости от последовательности праймеров и продукта ПЦР:

opt primer product = 0.3Tm + 0.7Tm - 12.9, Ta (9) primer product где Tm - соответственно, температуры плавления праймера и продукта.

, Tm Температуру плавления продукта вычисляют по стандартной формуле, используемой при гибридизации по Саузерну:

[ + ] + 0.41[GC %] - product = 81.5 + 16.6 lg K Tm, (10) l где [K+ ] - концентрация ионов калия в молях;

[G+C%] - количество G и C в продукте ПЦР в процентах;

l - длина продукта в парах нуклеотидов.

Температуру плавления олигонуклеотидного праймера определяют:

dH + 16.6 lg K + - 273.15 (11) Tm primer = dS + R ln( c / 4) где dS и dH соответственно изменение энтропии и энтальпии праймера при отжиге, R газовая постоянная (1.987 кал/0Смоль), с - молярная концентрация праймера (авторы подобрали эмпирически, 250 пмоль).

Значения dS и dH определялись авторами методом l-граммного разложения последовательности праймера (l=2) (Компьютерный анализ генетических текстов, 1990). В работе Kenneth et al. (1986) представлены числовые значения dS, dH и dG для каждой из 16 пар сочетаний нуклеотидов. Изменение температуры плавления праймера происходит по непрерывному закону, что соответствует реальным данным.

Термодинамические параметры dH0 dS0 dG Interaction AA/TT 9.1 24.0 1. AT/TA 8.6 23.9 1. TA/AT 6.0 16.9 0. CA/GT 5.8 12.9 1. GT/CA 6.5 17.3 1. CT/GA 7.8 20.8 1. GA/CT 5.6 13.5 1. CG/GC 11.9 27.8 3. GC/CG 11.1 26.7 3. GG/CC 11.0 26.6 3. вычисления с помощью формулы Tmprimer Однако, не представляется возможным, в связи с тем, что в формуле имеется ошибка или опечатка в статье. Так правая часть формулы равна -275.15 при концентрации 50 мМ KCl в реакционной смеси. Тогда левая часть должна превышать данную величину не менее чем на 40 (то есть быть равной 315), но числитель dH не может иметь столь больших значений.

Поэтому, данная формула не может использоваться в вычислениях значения температуры плавления олигонуклеотида. Но, значения температур плавления праймеров в данной статье рассчитаны верно как и при вычислениях с помощью компьютерной программы «OLIGO», разработанную этими же авторами.

Для вычисления температуры плавления олигонуклеотидного праймера Tmprimer мы предложили свою эмпирическую формулу, использующую термодинамический показатель dG (свободная энергия Гиббса), изменение которого происходит по непрерывному закону (Cиволап и Календарь 1994), что более корректно при определении истинной температуры плавления олигонуклеотида:

dG Tm primer = - k (12) l 3.3/ где k=2.9136826, l - длина праймера (в нуклеотидах), если концентрация ионов калия в растворе равна 50 мМ.

В общем же случае формула выглядит следующим образом:

dG + 16.6 lg[K + ].

Tm primer = -3.9 (12.1) 3.3/ l Для вычисления значения свободной энергии Гиббса использовали l-граммный метод разложения последовательности праймера (l=2). Для каждой из 16 пар сочетаний нуклеотидов соответствовало определенное значение dGi. следовательно, конкретной последовательности праймера соответствовало свое определенное значение dG, полученное суммированием всех dGi.

Значения температур плавления олигонуклеотидов, приведенные в статье Rychlik et al., (1990), и их величины, вычисленные по формуле “12”, идентичны (Табл.3). Таким образом, предложенные нами формулы «12» и “12.1” пригодны для расчета температуры плавления олигонуклеотидов.

Были вычислены для каждого праймера значение Tmprimer, используя формулу “12” и конечное значение температуры отжига по формуле “9”. При вычислении температуры плавления продукта амлификации Tmproduct исходили из того, что размеры амплифицированных продуктов не ниже 200 и не выше 2000 пар оснований, а ГЦ состав в среднем вероятнее всего составит у данных продуктов 50%. В результате получили значения Тaopt в диапазоне 1,4 градуса. Отжиг, соответственно проводили при минимальной температуре, приведенной для каждого праймера в таблице 2. Как видно из таблицы 2, что для 10-членных праймеров минимальное значение Тaopt не ниже 47.70С и максимально - 50.90С, что значительно отличается от тех значений температур отжига, используемых в RAPD другими авторами (обычно это 370С или 400С).

Таблица Температуру плавления олигонуклеотидов ( С), полученных с помощью формул “11” и “12” Последовательность 5`-3` * Ta (“11”) Ta (“12”) GTCGAACCGGAAACCACCCCT 60.7 60. GTGGATATGGTTGTACAGAGCCC 54.3 54. AACGGGGAGGACGATGGC 56.8 56. CAGCGCCACATACATCAT 46.9 47. TCAGCTCCCAAATCTCGATTGC 58.0 57. GGTTATCGAAATCAGCCACAGCGCC 65.2 66. CCGGCGCAGAAGCGGCATCAGCAAA 73.9 75. TCACCAGCCAGCCGCAGCACGTTCC 72.8 71. AGGATGGCGAACAACAAGAAACTGG 61.3 61. GGCGAAAGCAGAAGCAGATGAGAGA 61.9 61. * - последовательность олигонуклетидов взята из работы Rychlik et al., (1990) Для стандартной амплификации точно вычисленная оптимальная температура отжига определяет чувствительность амплификации и ее специфичность. Ошибка в три градуса при вычислении оптимальной температуры отжига существенно сказывается на результате амплификации, и выражается в уменьшении выхода основного и появление неспецифического продуктов (Rychlik et al., 1990). Оптимальная температура отжига в AP-PCR различается для коротких продуктов ПЦР и для продуктов с максимальной длиной при прочих равных условиях. Максимальная разница может составить 6 градусов. Отжиг можно проводить только в диапазоне температуры, оптимальном для конкретного праймера. Для праймеров равной длины существует общий диапазон температуры отжига, в пределах которого происходит их отжиг с матрицей.

В течение первых двух циклов ПЦР с произвольными праймерами происходит образование разнообразных полупродуктов, участь которых определяется уже в третьем цикле. Синтез молекул полупродукта типа «a» на матричной ДНК и при образовании «b» на матрице «a» происходит при неполной комплементарности с матрицей. Поэтому, для проведения амплификации необходимо, чтобы в течение первых двух циклов условия отжига были оптимальны для образования дуплексов праймера с геномной ДНК, имеющей на 5`-конце праймера до 1-3 мисметчей (в зависимости от размера праймера). После второго цикла амплификации температуру отжига необходимо увеличить до оптимальной, чтобы в реакцию были вовлечены только молекулы типа «d» и «b» предшествующих циклов. Это приведет к воспроизводимости реакции и к уменьшению фоновой амплификации (синтез молекулы типа «a» и синтез «b» на матрице «a»). Большая часть молекул типа «a» не принимает участия в амплификации основных продуктов реакции, так как не все варианты амплифицируемых молекул «а» являются матрицами для синтеза молекул типа «b», в связи с отсутствием комплементарных участков для праймера.

Таким образом, условия проведения отжига следующие: первые три цикла AP PCR (олигонуклеотиды более 15 нуклеотидов) следует проводить при температуре ниже оптимальной на 10 градусов, для RAPD (праймеры до 15 нуклеотидов) - на 5- градусов ниже оптимальной.

Результаты тестирования всех олигонуклеотидов (табл.1) при выше указанных условиях реакции показали количественную и качественную стабильность амплифицированных продуктов. Количество амплифицированных продуктов зависело только от последовательности праймера, поэтому, казалось бы, при жестких условиях отжига должны образовываться только наиболее стабильные продукты, обусловленные наименьшим количеством мистметчей праймера с последовательностью мишени (а скорее их отсутствием), однако, образовывалось до 30 продуктов, что свидетельствует об амплификации всех стабильных комплексов при температуре отжига не ниже 370С для 10-членников. Амплификация при температуре отжига 370С (RAPD) и 450С образует одинаковые продукты, но при 450С эти продукты более стабильны при воспроизведении, что связано с оптимальными условиями их образования и накопления, и, кроме того, не накапливается неспецифический продукт и снижается фоновая амплификация. Кроме того, суммарное время затраченное на амплификация с температурой отжига 450С меньше, чем при температуре отжига в 370С.

3.3. Оптимизация остальных условий полимеразной цепной реакции а) Условием успешной амплификации с произвольными праймерами является высокая концентрация ионов магния (при стандартной амплификации концентрация ионов магния составляет 1.5 мМ, для RAPD - 2-4 мМ). Высокая концентрация ионов магния способствует инициации синтеза продукта ПЦР с не полностью комплементарного комплекса праймера и мишени при температуре отжига ниже оптимальной.

Мы оптимизировали концентрация ионов магния в реакционной смеси и, показали, что при 3 мМ наблюдается наибольшее количество продукта без примеси неспецифического продукта (Сиволап и др., 1994).

б) Для синтеза продукта амплификации необходима высокая концентрация праймера. Для АР-РСR она составляет 0.2 - 0.3 мкМ, для DAF - до 3 мкМ (Caetano Annoles, 1993). Низкая концентрация праймера приводит к невоспроизводимости результатов.

в) На воспроизводимость результатов влияет качество используемых препаратов ДНК. Наличие плохо очищенной или гидролизованной ДНК-матрицы приводит к нестабильности воспроизводства продуктов реакции или непредсказуемым результатам.

Нами была усовершенствована методика выделения высокомолекулярной ДНК из растений в эппендорфе без жидкого азота. Данная процедура основана на использовании детергента цетилтриэтиламмоний бромида (СТАВ) растворяющим нуклеиновые кислоты при высокой ионой силе (выше 0.7 М) (Генная инженерия растений, 1991). Размалывание растительного материала происходит в эппендорфе с лизирующем раствором при комнатной температуре. Выдерживается лизат при 650С для полного растворения cоли СТАВ с ДНК/РНК и преципитации белков и полисахаридов. Однократная обработка хлороформом денатурирует белки и удаляет все нерастворимые в СТАВ примеси. Осажденная из водной фазы ДНК растворяется в растворе ТЕ с РНКазой (примесь РНКазы в растворе ДНК не мешает амплификации).

Выделенная таким методом ДНК имеет размер не менее 50 тыс. пар оснований, хорошо амплифицируется и хранится. Аналогичная процедура c использованием СТАВ и без жидкого азота описана и другими авторами (Paran et al., 1993).

г) Изменение состава реакционного раствора с (50 mM KCl, 20 мМ трис-НСl, рН 8.4 (250 С)) для Taq-полимеразы на (16.6 mM (NH4)2SO4 и 56 мМ трис-НСl, рН 8.8 (250С) для Tth-полимеразы не приводит у существенным различиям (рис.2). Наблюдается усиленная амплификация некоторых продуктов ПЦР или ослабление других, что связано в большей степенью с активностью полимеразы инициировать синтез данных продуктов в этих условиях реакции.

Усиление амплификации происходит в случае добавления в реакционную смесь не ионных детергентов - Tween-20, TritonX-100 или NP-40 (Hung et al., 1990;

Bachmann et al., 1990), а также глицерина (Lu et al., 1993) и форамида (Gobinda et al., 1990). Нами было показано, что наибольшее усиление (10-100 раз) амплификации наблюдается при добавлении в реакционную смесь полиэтиленгликоля (Mr=6000-7500) до конечной концентрации 6%. При повышении или уменьшении концентрации полиэтиленглюголя (PEG 6000) происходит снижение эффективности синтеза продукта (рис.3).

Объяснить факт усиления амплификации можно следующим образом:

полиэтиленгликоль уменьшает молекулярный объем реакции и по этой причине все компоненты реакции (матрица, праймер и ДНК-полимераза) находятся в “сжатом” пространстве, что сказывается в уменьшении диффузии. В результате происходит более эффективная ассоциация праймера и матрицы и не инициализирующий синтез ДНК-полимеразы. Увеличение же концентрации полиэтиленгликоля до 10% и выше уже пространственно препятствует контакту праймера с ДНК-матрицей.

Эффект усиления ферментативной реакции с помощью полиэтиленгликоля наблюдается и при других реакциях, например, рестрикции.

Эффективную концентрацию PEG 6000 в реакционном растворе определяли с помощью электрофореза продуктов амплификации с различной начальной концентрацией PEG 6000, а затем измеряли концентрацию ДНК с помощью флюориметра (Табл.4).

Использование полиэтиленгликоля предпочтительно в ситуациях связанных с высокой чувствительностью (например, в медицине - диагностика патогенов или медицинской экспертизе, при экологическом мониторинге и др.), или если в исследуемом образце присутствуют ингибиторы амплификации (например, гемоглобин, полифенолы и др.).

Таблица 4.

Оптимизация концентрации PEG 6000 в реакционной смеси ПЦР Концентрация PEG 6000 Количество ДНК № (%) (мкг/мл) 1. 0 2. 2 3. 4 4. 6 5. 10 При RAPD применение полиэтиленгликоля желательно, так как амплификация завершится на 32, а не 37 цикле. Кроме того, для амплификации потребуется меньше полимеразы и ее активность и процессивность будут более стабильны, что очень существенно на заключительном цикле реакции. И как результат, более “плотные”, а не “размытые” продукты амплификации.

Таким образом, оптимизированный реакционный раствор для полимеразной цепной реакции с произвольными праймерами должен быть следующего состава: mM KCl, 20 мМ трис-НСl, рН 8.4 (250С), 3 мМ MgCl2, 0.01 % Tween-20, 5% глицерина и 6% PEG 6000. Концентрация ДНК 1нг на 1 мкл реакционной смеси, а количество Taq полимеразы 1 ед. на 20 мкл реакционной смеси.

рис. 2. Электрофорез разделения продуктов амплификации ДНК ячменя с праймером Р6 в различных реакционных растворах. 1-6: 50 mM KCl, 20 мМ трис-НСl, рН 8.4 ( С);

7-12 : 16.6 mM (NH4 )2SO4 и 56 мМ трис-НСl, рН 8.8 (25 0С).

рис. 3. Электрофорез разделения продуктов амплификации ДНК ячменя с праймером Р56 в различных концентрациях полиэтиленгликоля. 1,2 - 0%;

3 - 1%;

4 - 2%;

5 - 4% ;

6 - 6%;

7,8 - 10%.

3.4. Моделирование произвольных праймеров для исследования молекулярно генетического полиморфизма В результате узнавания ДНК-полимеразой комплекса, образованного при отжиге праймера с сайтом-мишенью, реакция носит специфический характер. Это выражается в предпочтительной амплификации определенных участков ДНК-матрицы, что создает воспроизводимую картину полиморфизма.

Присутствие длинных концевых областей с неполной комплементарностью праймера и матрицы препятствует аффинному взаимодействию фермента с таким комплексом и затрудняет полимеризацию.

Наличие ошибки при связывании праймера с мишенью влияет на воспроизводимость продуктов амплификации и эффективность работы полимеразы, которая узнает и удлиняет «ошибочный» комплекс.

Первые восемь нуклеотидов с 3`-конца праймера имеют район с высокой степенью комплементарности к матрице. Единичная замена в этом районе значительно сказывается на результатах амплификации. Поэтому для успешной амплификации на 3`-конце праймера необходимо не менее шести нуклеотидов, полностью комплементарных матрице. Увеличение праймера на 2 или 3 нуклеотида не приводит к изменению нуклеотидного состава амплифицированного продукта (Caetano-Annoles, 1993).

Было замечено, что в зависимости от нуклеотидной последовательности праймеров определяется степень выявляемого меж- и внутривидового полиморфизма.

Одни праймеры выявляют межвидовой полиморфизм, но неприменимы на внутривидовом уровне;

другие же выявляют внутри- и межвидовой полиморфизм.

Поэтому, праймеры можно условно разделить на видоспецифичные, внутривидоспецифичные и, возможно, специфичные для более высоких таксонов.

Специфичность праймера определяется продуктами амплификации.

Нами предложен способ классификации произвольных праймеров на основе различия их внутри- и межвидовой специфичности и отсюда - их целенаправленного отбора. Способ выявления основывается на свойствах пар соседних нуклеотидов, это так называемый метод l-граммного разложения (l=2) последовательности праймера (Компьютерный анализ генетических текстов, 1990). Суть подхода состоит в следующем: нуклеотидная последовательность праймера с 3`-конца разбивается на пары нуклеотидов, смещенные на один нуклеотид к 5`-концу. Например, праймер 3` ATTGCCAGTT образует пары: 1 пара - AT;

2 пара - ТТ;

3 пара - TG;

4 пара - GC;

5 пара - CC;

6 пара - CA;

7 пара - AG;

8 пара - GT;

9 пара - TT (Календарь и Сиволап, 1995).

Всего вариантов пар для четырех нуклеотидов 16 (24). Если провести анализ всех праймеров, выявляющих внутривидовую специфичность (так как они представляют наибольший интерес для исследований), и частоту встречаемости определенных пар нуклеотидов в данном положении праймера, то полученные данные можно использовать для синтеза произвольных праймеров с экстраполированной последовательностью. Такие праймеры с большой вероятностью могут использоваться при исследования внутривидового полиморфизма.

Поиск экстраполированных последовательностей внутривидо-специфичных праймеров можно осуществить, анализируя последовательность геномной ДНК из банков данных. Для этой цели разработана компьютерная программа, которая производит поиск произвольных праймеров в данной последовательности и анализирует их нуклеотидный состав. Поиск произвольных праймеров происходит с учетом заданного числа ошибок комплементарности (для 8 - нуклеотидного праймера максимальное число мисметчей равно 2, для 10 нуклеотидов, соответственно, - до 4 и так далее) при необходимом условии полной комплементарности 6 нуклеотидов на 3' конце праймера.

Смоделирована гипотетическая последовательность геномной ДНК с максимальным разнообразием ее нуклеотидной последовательности. Последнее необходимо для увеличения разнообразия последовательности и уменьшения повторов. При моделировании этой последовательности придерживались принципа максимального разнообразия нуклеотидного состава. Нуклеотидная последовательность «синтезировалась» генератором случайных чисел, где каждому варианту из трех нуклеотидных сочетаний соответствовало множество чисел, генерирующихся компьютером. Образование нуклеотидной цепи происходило путем добавления сочетаний, «вызываемых» генератором случайных чисел (RND(1215), размерность в 1216 чисел). Например, «вызов» триплета «AAA» происходил только в случае, если генерировались числа - 1, 65, 129, 193, 321, то есть по формуле 1 + 64*RND(1215);

для триплета «AAT» - 2, 66, 130, 194, 258, 322, то есть 2 + 64*RND(1215). Длина «синтезируемой» нуклеотидной последовательности составляла 7500 нуклеотидов. Этой длины было достаточно, чтобы программа отобрала произвольных праймеров длинной 8 нуклеотидов, без «ошибок» комплементарности праймера с генерированной последовательностью. ГЦ-состав «синтезируемых»

нуклеотидных последовательностей составлял от 45 до 60 %.

Генераторы случайных чисел имеют один существенный недостаток - блок генерируемых чисел повторяется каждый раз, что приводит к кластеризации «синтезируемой» нуклеотидной последовательности анализ (Компьютерный генетических текстов, 1990;

Ferrenberg et al., 1990). Решая эту проблему, мы пришли к следующему результату: каждому триплету присваивалось большое число чисел, определяемого формулой;

«синтез» последовательности происходит очень быстро, за 1 с «образовывалось» более 5000 нуклеотидов, что предотвращало генерации чисел для повторного цикла, а также длина последовательности не должна превышать нуклеотидов.

Моделирование новых произвольных праймеров возможно после анализа «генерированных» компьютером произвольных праймеров. Такая работа проведена по результатам исследования специфичности произвольных праймеров и смоделированы некоторые праймеры (P22, P23, P26, P27, P40, P41, P42-P57). Данные праймеры выявляют внутривидоспецифичный полиморфизм.

В таблице показаны праймеры используемые в работе. Праймеры, выявляющие на высоком уровне вероятности внутривидовой полиморфизм отмечены жирным шрифтом. Среди 68 произвольных праймеров, используемых в работе праймера разработаны с помощью компьютерной программы «PCR». Это праймеры:

P22, P23, P26, P27, P40-57, P69. Из них внутривидоспецифическими оказались - 19.

Сравнение праймеров длиной в 8 нуклеотидов, полученных из разных по ГЦ составу «синтезированных» последовательностей (различие в 5%), показало, что величина сходства наиболее часто встречаемых пар сочетаний нуклеотидов (первые пар из 16), приближается к половине, но для различных последовательностей с равным ГЦ-составом эта величина приближается к 60%. Данные приведены в таблицах 6 и 7 (толстым шрифтом показаны сходные пары). Таким образом, для произвольных праймеров, происходящих из контрастных по ГЦ-составу исследуемых последовательностей, характерны разные сочетания соседних нуклеотидов.

Наблюдается увеличение частоты встречаемости пар нуклеотидов, содержащих Ц или Г для последовательностей с ГЦ-составом выше и А или Т для 50 % последовательностей с ГЦ-составом ниже 50%. У произвольных праймеров из последовательностей с близким ГЦ-составом (не более 5% разницы) частота определенных пар соседних нуклеотидов приблизительно сходна (табл.5).

Таблица 5.

Зависимость частоты сочетаний соседних пар нуклеотидов от их положения в 8-нуклеотидном праймере (GC-состав исследуемой модельной ДНК равна 49.9%).

Частота встречаемости пары нуклеотидов в праймере (max-min)* с 5`-конца праймер No 1 2 3 4 5 6 7 8 9 3`-5` 1 ag gg aa tt ga at ta gt tc AGGTTGAA 2 aa gg ac ta tc ct tt tg ga GGATGTGT 3 ac ct gt gg at aa ta ca tt GGACTGAT 4 tt at tg ca ct ag ta ga tc AACTGTAG 5 tg ag tt gt ac gc ta ga at TTCTGTAG 6 ta ga gt gc at ag tg cc ca GACTTGAG 7 ta cg aa at tg ag gt ac gg GACAGTGT * Число «ошибок» спаривания равно 0.

Таблица 6.

Зависимость частоты сочетаний (соседних) пар нуклеотидов от их положения в 8-нуклеотидном праймере. GC-состав исследуемой модельной ДНК равна 50.89 %.

Частота встречаемости пары нуклеотидов в праймере (max-min)* с 5`-конца праймер No 1 2 3 4 5 6 7 8 9 3`-5` 1 gt ag aa tt ct cg ac ca gc GTACCCTC 2 ta gc ag ac tt cg ca gt tc GTTCCGAC 3 ca ac ta gc aa ag gt cc gg GTACGGAC 4 ac aa cc cg gg ag tt ct gc GTCAGGTC 5 cc ta cg gg ac aa gt tc ga CAGTTCCA 6 ac cc ct ga gc aa tt cg tg AGCACCTC 7 cc ac aa ca cg ga ct gc tc AGTACCCA * Число «ошибок» спаривания равно 0.

Для подбора праймеров необходимо учитывать ГЦ-состав геномной ДНК исследуемого организма. Вероятность амплификации участков ДНК с контрастным содержанием ГЦ-пар, представляется низкой. Богатые А-Т последовательности не принимают участия в амплификации, так как комплекс праймера с такими участками не стабилен и поэтому менее вероятно, что они послужат затравкой для ДНК полимеразы. В среднем же можно ориентироваться на 50 % ГЦ-состав геномной ДНК.

Таблица 7.

Зависимость частоты сочетаний (соседних) пар нуклеотидов от их положения в 9-нуклеотидном праймере. GC-состав исследуемой модельной ДНК равна 49.9 %.

Частота встречаемости пары нуклеотидов праймере (max-min)* с 5`-конца праймер No 1 2 3 4 5 6 7 8 9 3`-5` 1 aa tt ga ta gt tc gg ag at AACCTGTAT 2 aa gg ta ac tt tc ct tg at AACCAGTAG 3 ac at gg ta gt ag cc tt tc TTCCTGTAT 4 at tt ct ca tg gc ta cc ga GAAGCGTAC 5 tg tt ta cg ag gt gc cc ac GACCTGTAG 6 ta gt ga cc at cg ag ac tg GAACTGTAG 7 aa ta cg ag at gg tc tg cc GACAGCCCC 8 cc gt ta gg at ag ga ac cg GTTTGTAGG * Число «ошибок» спаривания равно 1.

Праймеры длиной в 8 нуклеотидов подобны праймерам из 9 и более нуклеотидов если они не содержат мистметчей. Этим праймерам характерны общие пары нуклеотидов, количество праймеров в 8 нуклеотидов больше, чем праймеров в нуклеотидов. Ситуация изменяется, если в 9-нуклеотидном праймере допускается хотя бы один мистметч на последних трех нуклеотидах 5`-конца. Тогда 9-нуклеотидных праймеров больше, и в них входит множество 8 нуклеотидных праймеров (табл.5-6).

Например, последовательность длиной 5823 нуклеотида с ГЦ-составом 49.9 % содержит 285 произвольных праймеров длиной в 8 нуклеотидов, для этой же последовательности число праймеров длиной в 9 нуклеотидов составит 600. При одной и той же температуре отжига (максимально жесткой для 8-нуклеотидного и близкой к строгой для праймеров) в первых трех циклах, 9-нуклеотидного предпочтительно при исследовании полиморфизма применение праймеров длиннее нуклеотидов.

рис. 5. Формула 8-членного праймера для последовательности ДНК с 49.9% CG составом. Показаны пять наиболее часто встречающихся пар нуклеотидов в данных положениях праймера.

При проведении отжига в максимально мягких условиях предпочтительнее короткие праймеры (8-10 нуклеотидов), так как комплекс праймера с мишенью более стабилен. У длинных праймеров (например, 15 и более нуклеотидов), в условиях, допускающих комплементарность только 6 нуклеотидов на 3`-конце праймера, значение dG увеличивается, что приводит к нестабильности данного комплекса и маловероятнее всего, что он будет образовываться.

В таблицах 5-7 приведены произвольные праймеры полученные путем моделирования наиболее встречаемых пар нуклеотидов в соответствующих положениях праймера. Эти и другие праймеры, полученные на базе сочетаний пар нуклеотидов, приведенных в таблицах, вероятнее всего, могут выявлять внутривидовой полиморфизм.

Максимальное число последовательностей длиной в 6 нуклеотидов равно 4096.

Однако, половина последовательностей непригодна как «ядро» произвольного праймера, так как ГЦ-состав ниже 50% (количество оснований Г и Ц меньше или равно двум), или выше 70 % (количество оснований Г и Ц больше или равно 5). При удовлетворяющем ГЦ-составе возможны структуры праймеров, где 3`-концы не содержат оснований Г или Ц или их число в первых 6 нуклеотидах меньше, например, 3`-AATCCC, 3`-TTTCGG. Остальные 2000 последовательностей пригодны как «ядро»

последовательностей праймеров. Таким образом, 10-членные и 15-членные праймеры с идентичной «ядерной» нуклеотидной последовательностью на 3`-конце образуют одинаковые ампликоны. Однако, по некоторым ампликонам могут наблюдаться различия (Caetano-Anolles, 1993). Возможен случай, когда количество мистметчей в дуплексе для 10-членного праймеров более 1 (на 5`-конце праймера), устойчивость такого дуплекса мала для инициации синтеза ДНК-полимеразой. Для 15-членного праймера данный сайт может служить матрицей, так как его устойчивость стабилизируется остальными 5 нуклеотидами с 5`-конца праймера. В результате, образуется дополнительный продукт амплификации, отсутствующий при амплификации с праймером с идентичной нуклеотидной 10-членным последовательностью (первые 10 нуклеотидов). Однако, возможна ситуация, когда 15 членный праймер не инициирует синтез ампликона. Это возможно только для ситуации, когда количество мистметчей в дуплексе с матрицей велико для инициации элонгации. 10-членный праймер в данном сайте устойчив и приводит к синтезу ампликона, отсутствующего при амплификации с 15-членным праймером. Однако такие ситуации крайне редки и скорее всего, что 10- и 15 членный праймеры образуют идентичные продукты амплификации. Доказательством может служить, то обстоятельство, что имеющиеся в работе два произвольных праймера Р22 и Р имели идентичные первые 15 нуклеотидов на 3`-конце (Табл.1), и образовывали идентичные продукты амплификации. Это свидетельствует о том, что для выявления полиморфизма достаточно применять праймеры не более 10-15 нуклеотидов.

Увеличение размера праймера более 15 нуклеотидов не вносит существенных изменений в информацию о полиморфизме. Таким образом, число произвольных праймеров и число выявляемых ампликонов, ограничено. Максимальное число выявленных ампликонов для этого числа праймеров будет более чем достаточно для любой молекулярно-генетической работы.

Глава 4. Исследование меж- и внутривидового полиморфизма рода Hordeum L.

4.1. Специфичность произвольных праймеров при выявлении полиморфизма При выявлении полифорфизма среди сортов ячменя Hordeum vulgare показали полифорфизм, только 55% праймеров (38 из 68). В таблице 1 показаны жирным шрифтом праймеры выявляющие внутривидовой полиморфизм Hordeum vulgare.

Праймеры, не выявившие внутривидовой полиморфизм, выявляли таковой между видами рода Hordeum (H.agriocrithon, H.spontaneum, H.lagunculiforme, H.vulgare, H.chilense, H.bulbosum), а также другими злаками Triticum durum, Triticum aestivum, Secale cereale, Zea mays и у сои Glycine max.

Это подтверждает предположение о специфичности произвольных праймеров в выявлении полиморфизма. Внутривидоспецифичные (сортоспецифичные) праймеры выявляют полиморфизм среди сортов одного вида, видоспецифичные праймеры выявляют полиморфизм между видами и показывают слабый полиморфизм среди сортов данного вида.

Проверка специфичности праймеров осуществлялась на 21 сортах из различных эколого-географических зон выращивания, например Одесский 100 (Украина), Cувенир (Белоруссия), Триумф (Германия), Паллидум 18 (Россия). Праймеры, не выявившие полиморфизм среди данных сортов и детектирующие межвидовой полиморфизм, считались видоспецифичными. Четкой границы между видо- и внутривидоспецифичными праймерами провести трудно, так как специфичность праймера определяется отношением консервативных ампликонов к общему количеству продуктов амплификации. Поэтому, видоспецифичный праймер ограничивает большее количество консервативных внутри вида локусов, чем внутривидоспецифичный праймер. Консервативные внутри вида последовательности, ограничиваемые видоспецифичным праймером, между видами оказываются полиморфными. Количество ампликонов зависит от последовательности праймера и структуры генома. Например, сортоспецифический праймер P56 при амплификации с ДНК ячменя образовывал 4 ампликона, два из которых оказались полиморфными (P56#840 и P56#760), тогда как праймер P79 при амплификации образовывал полиморфных из 25 ампликонов.

Специфичность праймера определяется на основании анализа ампликонов у набора генотипов:

P(P + N ) Is = lg( ), N где Is - индекс специфичности праймера (только для полиморфных праймеров), P количество полиморфных полос, N - всего полос.

Величина Is стремится к 0 при уменьшении получаемой информации от праймера.

Интересная закономерность специфичности произвольных праймеров показана среди вышеуказанных видов. Если представить следующий ряд расположения этих видов с увеличением уровня внутривидового полиморфизма: cоя ячмень пшеница кукуруза, то праймеры выявляющие сортоспецифический полиморфизм у сои или ячменя будут выявлять таковой и у пшеницы и кукурузы, праймеры не выявляющие сортоспецифический полиморфизм у пшеницы или ячменя, не выявят его и у сои. Поэтому сортоспецифичные праймеры у ячменя пригодны при исследовании сортового полиморфизма у сои, у пшеницы и кукурузы, видоспецифичные праймеры для ячменя не пригодны при исследовании сортового полиморфизма у сои и у пшеницы, но на кукурузе возможно выявить полиморфизм среди удаленных в генетическом отношении генотипов. Таким образом, праймер, выявляющий внутрисортовой полиморфизм у ячменя со значением индекса специфичности больше 5, вероятнее всего покажет таковой и у сои, и у пшеницы, и у кукурузы.

Был проведен совместный анализ с Бриком А.Ф. СГИ) по (Одесса, исследованию полиморфизма с произвольными праймерами у сортов (200) ячменя и сои (160 сортов). Оказалось, что все праймеры, выявляющие сортоспецифический полиморфизм у ячменя показывали полиморфизм у сои, а праймеры, демонстрирующие слабый полиморфизм среди сортов ячменя, - не выявляли полиморфизм среди сортов сои. Так, были исследованы сортоспецифичные праймеры у ячменя: P1, P2, P3, P6, P8, P22, Р39, Р43, P44, P52, P63, P66, Р73 и пара праймеров Р92/Р93 для направленной амплификации (рис.5). Все они выявили полиморфизм среди сортов сои.

Все сортоспецифичные праймеры ячменя выявляли внутривидовой полиморфизм у пшеницы и у кукурузы.

Объяснить специфичность произвольных праймеров можно тем, что у близких по происхождению видов амплифицированные продукты равного размера имеют и одинаковую нуклеотидную последовательность. Чем больше генетическая дистанция между исследуемыми видами, тем меньше у них общих (константных) продуктов амплификации (ампликонов). Особенно это заметно при сравнении продуктов RAPD у пшеницы и ячменя. Общие не полиморфные полосы у близких видов предполагают их связь с общими функциями и структурами в геномах этих видов. Консервативные ампликоны, выявляемые сортоспецифическим праймером, видимо, связаны с консервативными локусами генома данного вида. Аналогичная ситуация возможна с мономорфными ампликонами у близких видов, выявляемых видоспецифическим праймером. Константные ампликоны у видов одного рода характеризуют геномную структуру данного рода.

Спектры полиморфных ампликонов, характерны для генотипов, при исследовании сортоспецифическим праймером. При исследовании видоспецифичным праймером видов одного рода полиморфные ампликоны будут характеризовать данный вид.

В работах Булата и соав. (1992) и Шигинян и соав. (1995) при исследовании штаммов микроорганизмов делаются аналогичные выводы, «что синтезируемые ампликоны можно разделить на две категории: филогенетически консервативные и индивидуально-специфические.» И, как результат, Булат и соав. предложили изменить название “произвольные” праймеры на “универсальные” праймеры.

рис. 5. Электрофорез разделения продуктов амплификации ДНК сортов сои с праймером Р73.

4.2. Исследование молекулярно-генетического полиморфизма между видами рода Hordeum L.

Анализ филогенетических взаимоотношений данных видов осуществлялся как с помощью видоспецифических так и сортоспецифических праймеров (всего праймеров). Данные полученные после амплификации с каждым праймером вводились в текстовый файл и анализировали с помощью программы “TREE” (рис.6).

По всем праймерам прослеживалась одна тенденция, которая наблюдалась при суммарном «дереве»: анализируемые виды распределены в два больших кластера (рис.6-9). В одном расположены виды Hordeum (без H.chilense), в другом T.aestivum, T.durum, S.cereale и H.chilense. H.vulgare был представлен двумя сортами Донецким- и Джау Кабутак, характеризующимися довольно сильными морфологическими и генетическими различиями (Cиволап и Календарь, 1995). Джау Кабутак местный сорт высокогорных районов Таджикистана;

шестирядный, голозерный, Донецкий4 двурядный, пленчатый.

Анализ кластера содержащих виды показал, что наименьшие Hordeum генетические дистанции отмечены между H.agriocrithon и H.lagunculiforme, с которыми рядом располагается сорт Джау Кабутак (H.vulgare). H.spontaneum (двурядный ячмень) ближе к данному субкластеру, чем сорт Донецкий-4 H.vulgare. H.bulbоsum располагается крайне обособленно от этих видов.

рассматривается как одичавший культурный ячмень с H.spontaneum характерным ему ломким колосом, опушением по ребрам колосовых члеников.

Шестирядный с ломким колосом H.agriocrithon был обнаружен на территории Тибета Е.

Обергом. По выполненности и форме зерновки H.agriocrithon близок к культурному ячменю. Однако, по разнообразию форм H.agriocrithon делается вывод о вторичности происхождения данного вида (Трофимовская, 1972).

Рис.6. Дендрограмма межвидововых взаимоотношений, построенная на основании анализа генетических дистанций.

Рис.7. Образцы электрофоретического разделения продуктов амплификации ДНК различных видов c праймером Р37: 1 - H.vulgare, Донецкий 4;

2 - H.vulgare, Джау Кабутак;


3 - H.agriocrithon;

4 - H.lagunculiforme;

5 - H.bulbosum;

6 - H.spontaneum;

7 T.durum;

8 - S.cereale;

9, 10 - Glycinia max. М - маркер (T7 по HpaI).

Рис.8. Образцы электрофоретического разделения продуктов амплификации ДНК различных видов c праймером Р76: 1 - H.vulgare, Донецкий-4;

2 - H.vulgare, Джау Кабутак;

3 - H.agriocrithon;

4 - H.lagunculiforme;

5 - H.bulbosum;

6 - H.spontaneum;

7 T.durum;

8 - S.cereale;

9, 10 - Glycinia max.

Рис.9. Образцы электрофоретического разделения продуктов амплификации ДНК различных видов c праймером Р6: 1 - H.chilense;

2 - H.agriocrithon;

3 H.spontaneum;

4 - H.lagunculiforme;

5 - H.bulbosum;

6 - H.vulgare, Донецкий 4;

7 S.cereale;

8 - T.durum;

9 - T.aestivum. М - маркер.

Рис.10. Образцы электрофоретического разделения продуктов амплификации ДНК различных видов c праймером Р8: 1 - H.chilense;

2 - H.agriocrithon;

3 H.spontaneum;

4 - H.lagunculiforme;

5 - H.bulbosum;

6 - H.vulgare, Донецкий 4;

7 S.cereale;

8 - T.durum;

9 - T.aestivum. М - маркер.

также является шестирядным с ломким колосом, но H.lagunculiforme содержащий плодоножки на боковых колосках. И аналогично с H.agriocrithon H.lagunculiforme не является самостоятельным видом и представляет собой крайнее звено в системе вида H.spontaneum (Трофимовская, 1972).

Согласно анализу спектров ампликонов Джау Кабутак содержит больше общих полос с H.agriocrithon и H.lagunculiforme, чем к Донецким 4. Поэтому на дендрограмме Джау Кабутак ближе к данным видам, чем к сорту Донецкий 4 из того же вида.

Согласно филогенетической схеме Невского, приведенной Бахтеевым H.vulgare и H.spontaneum находятся в VI, H.bulbosum в V, а H.chilense - в III секциях.

Геномы H.vulgare и H.bulbosum относят к одной группе - I (Svitashev et al., 1994).

Авторами показано крайнее положение этих двух видов. H.bulbosum является многолетним растением (Бахтеев, 1953). При скрещивании H.vulgare и H.bulbosum получаются фертильные гибридные формы, сохраняющая, однако, лишь геном культурного ячменя (Трофимовская, 1972). Данный эффект используется при получении гаплоидов.

Данные виды относятся к трибе Hordeae Benth. рода Hordeum L. В семейство Gramineae Juss. кроме видов Hordeum так же относятся: Secale L., Triticum L. и другие, всего 21 род (Бахтеев, 1953). Поэтому в анализ были включены данные виды.

Вид H.chilense как и H.bulbosum является многолетним растением, практически не скрещивается с другими представителями рода Hordeum, что, в известной мере, сказывается на обособленности этого вида на дендрограмме. Генетические дистанции между H.chilense и другими видами Hordeum сравнимы с таковыми с рожью S.cereale (Трофимовская, 1972). Описаны спонтанные гибриды между H.chilense и S.cereale, а также H.chilense и пшеницей (Трофимовская, 1972). Поэтому не удивительно, что данный вид расположен в кластере среди пшениц и S.cereale.

В таблице 8 показана суммарная информация по каждому из исследуемых праймеров по выявлению полиморфизма среди представителей только вида Hordeum.

Количество исследуемых локусов только у представителей Hordeum составил 146, из которых полиморфными оказались 126 (86% полиморфных полос), а индекс специфичности данных праймеров составил 1,72. Это обстоятельство говорит о том, что данные праймеры выявили высокий полиморфизм среди видов, а значит и вероятнее всего данный анализ наиболее достоверен. Величина Is больше 1, свидетельствует о том, что данные праймеры (Р6, Р8, P43 и P76) наиболее эффективно детектируют полиморфизм, то есть внесли существенный вклад в дифференциацию данных видов.

Таблица Исследование межвидового полиморфизма среди представителей рода Hordeum L., с помощью ПЦР с произвольными праймерами количество продуктов амплификации Индекс специфичности праймера праймер всего полос полиморфных (Is) Р6 30 25 1, Р8 34 30 1, Р37 17 17 2, Р43 27 23 1, Р67 13 10 1, Р76 25 21 1, всего 146 126 1, Результаты филогенетического анализа позволяют подтвердить мнение что, H.spontaneum, H.agriocrithon и H.lagunculiforme вероятно являются одичавшими формами H.vulgare, отделившимися не так давно (об этом говорит тот факт, что сорт Джау Кабутак имеет больше общего с ними, чем с современными сортами), а также, что H.bulbosum значительно отличающийся фенотипически от культурных ячменей, отличается и генетически, а H.chilense ближе к S.cereale и пшенице, чем к другим ячменям.

4.3. Исследование внутривидового полиморфиза вида H.vulgare L.

В исследовании внутривидового полиморфизма вида H.vulgare использовали сорт, происходивший из различных эколого-географических зон. Так местный сорт Таджикистана - Джау Кабутак исследовался как при изучении эволюционных взаимоотношений между видами семейства Hordeum L., так и для анализа внутривидовых взаимоотношений. Паллидум - местный сорт Крыма, Винер выведен на Фаленской Государственной селекционной станции из местных сортов и районирован более чем в 60 областях бывшего СССР (нечерноземная полоса Европейской части, север центрального черноземелья, Дальнего Востока);

Нутанс 106 (получен из Одесского 18 и местного сорта Черкасской области), Черноморец (Южный/Нутанс 215) выведены во Всесоюзном Селекционно-генетическом институте и районирован в Одесской области. Корал выведен в Чехословакии, Athos в Кении;

Riso 1508, Bomi выведены в Германии, причем, первый является мутантом последнего;

сорт Riso является мутантом Calsberg II, выведенных так же в Германии, Betzes выведен в Канаде. Кроме того в анализ были взяты сорта - Одесский 31, Одесский 70, Одесский 100, Донецкий 9, Донецкий 8, Исток, Циклон, Корал.

Исследование внутривидовой изменчивости вида H.vulgare проводилось на вышеуказанных сортах с помощью ПЦР, используя сортоспецифические произвольные праймеры (Р1, P2, Р3, P4, P6 и P8 ). У 21 анализируемого сорта рассмотрено локусов. Количество полос на образец составило от 25 до 30, из них полиморфных - %. Существенный вклад в выявляемый уровень внутривидового полиморфизма внёс сорт Джау Кабутак, показавший большое количество полиморфных полос (табл.9).

Индекс специфичности праймеров составил 1,05, что ниже для значения Is, полученное на видов Hordeum.

Таблица Характеристика произвольных праймеров исследуемых на 21 сорте ячменя количество продуктов амплификации Индекс специфичности праймера праймер всего полос полиморфных Is Р1 25 4 0, Р2 30 10 0, Р3 27 14 1, Р4 37 20 1, Р6 25 10 0, Р8 24 11 0, всего 168 89 1, Так праймер Р8, выявивший высокий полиморфизм у видов (Is=1,76), среди сортов показал данную величину равной - 0,92. Это относится и к праймеру Р6 (значение Is снизилось с 1,627 до 0,80).

Диапазон генетических дистанций, рассчитанных по данным RAPD, между сортами ниже, чем межвидовой (рис.11). Незначительно различаются генотипы исходных сортов и полученных из них мутантов. Это показано для Riso 1508 и Bomi, а также Riso 56 и Calsberg II. Дендрограмма иллюстрирует значительное удаление Джау Кабутак, который значительно отличается от сортов европейской селекции и по морфологическим признакам (например, голозерность, шестирядность).

рис.11. Дендрограмма распределения сортов Hordeum vulgare, построенная на основании анализа генетических дистанций.

Остальные 20 сортов группируются в один большой кластер, в котором только Athos, выведенный в Кении, несколько удален. Сорта Донецкий 8 и Донецкий 9, имеющие общего предка - сорт Донецкого 4, находятся на дендрограмме достаточно далеко друг от друга. Одесский 70 ближе к германским сортам Riso 1508 и Bomi, имеющих общего предка - сорта Юниор. Это может говорить о том, что данные сорта хотя и выведены в различных регионах имеют общее происхождение.

На рисунках 12-14 показаны образцы электрофоретического разделения продуктов амплификации некоторых сортов ячменя с праймерами Р3, Р4 и Р6.

Для анализа внутрисортовой гетерогенности былы использованы 53 линии сорта Productiv. При анализе были использованы праймеры Р3 и Р6. Праймер Р6 не выявил полиморфизма среди линий сорта, а Р3 выявил три полиморфных продукта размером в 800, 625 и 600 нуклеотидов (Is=0,3) (рис.14). Определение сцепление локусов продуктов амплификции проводили с помощью программы “MAP_QTL”, используя формулы для вычисления процента рекомбинации в популяции. При анализе выяснилось, что между локусами, кодирующие эти продукты нет связи. Поэтому сорт является гетерогенным по многим локусам и эта гетерогенность поддерживается селекцией.

Таким образом, уровень полиморфизма у видов Hordeum самый высокий, средний у сортов вида H.vulgare и минимальный у популяции сорта вида H.vulgare.

Праймеры, выявляющие сортоспецифичный полиморфизм, выявляют таковой и у видов. Сортоспецифичные праймеры ячменя (Is больше или равно 0,5) выявляют сортоспецифичный полиморфизм у сортов близкородственных видов (пшеница, рожь) или даже у сои.

рис.12. Образцы электрофоретического разделения продуктов амплификации ДНК сортов ячменя с праймером Р3. 1 - Джау Кабутак, 2 - Одесский-31, 3 - Одесский-70, 4 Одесский-100, 5 - Донецкий-9, 6 - Донецкий-8, 7 - Исток, 8 - Циклон, 9 - Черноморец, - Винер, 11 - Riso-56, 12 - Riso-1508.

рис.13. Образцы электрофоретического разделения продуктов амплификации ДНК сортов ячменя с праймером Р4. 1 - Джау Кабутак, 2 - Одесский-31, 3 - Одесский-70, - Одесский-100, 5 - Донецкий-9, 6 - Донецкий-8, 7 - Исток, 8 - Циклон, 9 - Черноморец, 10 - Винер, 11 - Riso-56, 12 - Riso-1508.

рис.14. Образцы электрофоретического разделения продуктов амплификации ДНК сортов ячменя с праймером Р6. 1 - Джау Кабутак, 2 - Одесский-31, 3 - Одесский-70, - Одесский-100, 5 - Донецкий-9, 6 - Донецкий-8, 7 - Исток, 8 - Циклон, 9 - Черноморец, 10 - Винер, 11 - Riso-56, 12 - Riso-1508.


рис.15. Образцы электрофoретического разделения продуктов амплификации ДНК линий сортов ячменя Productive с праймером Р3.

Глава 5. Картирование генома ячменя и идентификация локусов количественных признаков 5.1. Картирование продуктов ПЦР при помощи самоопыляющейся популяции F8, Одесский 115/Гольф Для картирования могут быть использованы только уникальные структуры генома. Высокие повторы оказываются таковыми в случае уникальности их расположения в геноме и метода их выявления. Так полосы гибридизации при ПДРФ анализе являются уникальными структурами даже если гибридизационная проба является высоким повтором. Уникальность полос гибридизации в данном случае придают сайты рестрикции. Структура продукта амплификации с единичным произвольным праймером представляет фрагмент ДНК, фланкированный инвертированной последовательностью праймера. Центральная часть данной структуры чаще всего состоит из повторов (Williams et al., 1990), однако уникальность данной структуры создаёт именно последовательность ее концов, то есть инвертируемые сайты праймирования, выявляемые полимеразной цепной реакцией.

Кроме того наличие полиморфизма по данному продукту ПЦР говорит так же об его уникальности.

Наиболее распространенным типом полиморфизма среди RAPD-маркеров является наличие или отсутствие полосы (продукта) на электрофореграмме. Вполне вероятно, что в данном случае продукт представлен уникальной структурой.

Отсутствие продукта ПЦР связано, скорее всего, с точечной мутацией в зоне праймирования. Если эта структура представлена повторами, то мутации в одном или нескольких копиях не вызовут исчезновение полосы, а скажется на ее интенсивности.

Вероятность одновременных мутаций во всех копиях данной структуры в зоне праймирования ничтожно мала.

Вставка или делеция, во внутренней части продукта амплификации, приведет к изменению размера продукта.

При исследовании популяции №106 (F7-8, Одесский 115/Гольф), только в одном случае наблюдался кодоминантный тип наследования продукта ПЦР - P57#1000, который имел молекулярную массу 1000 и 980 нуклеотидов. В остальных же случаях при изучении генетического полиморфизма на популяции №106 отмечено исключительно наличие или отсутствие продукта ПЦР.

Варьирование интенсивности электрофоретически различных по молекулярной массе полос связано не с наличием разного количества копий в геноме, а с условиями отжига, оптимальными для интенсивно амплифицированных продуктов и, соответственно, не являющихся таковыми для слабо амплифицированных.

Гетерозиготные особи популяции №106 по количеству продукта амплификации не отличались от доминантных гомозигот. Это связано с тем, что амплификация обычно проводится до насыщения, то есть увеличение продукта амплификации в последующих, после «выхода» реакции на «плато», циклах происходит уже по линейному, а не по экспоненциальному закону. Амплификация продуктов ПЦР идет со скоростью, близкой к 2n-2n, где n - число циклов. Число копий матриц для амплификации у гетерозигот вдвое меньше, чем у гомозигот и, соответственно, выход на «плато» происходит на один цикл позже. Недостающее количество продукта у гетерозигот может легко доамплифицироваться, в то время как у гомозигот уже произошло торможение синтеза конечным продуктом.

Данное обстоятельство снижает информативность RAPD-анализа в F2 по сравнению с другими методами, так как используемые доминантные RAPD-маркеры не позволяют отличить гетерозиготы от доминантных гомозигот. Доля гетерозигот в популяции уменьшается наполовину для каждого следующего поколения: H = 21-n, где Н - доля гетерозигот в популяции, n - число поколений. Тогда для F2, Н = 0.5.

Ранее было показано (Созинов и др, 1978), что для картирования можно использовать самоопыляющуюся популяцию старших поколений в стадии рекомбинационного насыщения. Такая ситуация складывается к 7-8 поколению (от 1.56 до 0.78% гетерозиготность на локус). Можно отметить, что идеальная популяция самоопылителя в стадии рекомбинационного насыщения, особенно при малых p (частота рекомбинации), дает значительную информацию о величине p. Так, при p 40% анализируемая популяция дает больше информации, чем фаза отталкивания F при полном доминировании;

при p 20% - больше, чем фаза притяжения F2 при полном доминировании, а при p 15% - больше, чем анализирующее скрещивание.

Поэтому, учитывая эти особенности, была использована практически гомозиготная популяция F10 или гибриды старших поколений.

При анализе сцепления продуктов амплификации ДНК и ферментов было установлено, что ген b-амилазы ячменя, локализованный в длинном плече хромосомы 4 (4 М) (NABGMP, 1994), тесно сцеплен с локусом продукта Р6#900 (название праймера#размер продукта в нуклеотидах) (рис.16,17). Был определен другой маркер гена b-амилазы - P9#680, расположенный на расстоянии в 1% рекомбинации (рис.18) Обнаружено, что с геном Est 5, контролирующим синтез эстеразы 5, сцеплен локус хромосомы, маркируемый продуктами амплификации P92/93#594 и P9#1150, которые выявлены с помощью пары праймеров P92 и P93 и произвольным праймером Р9. Данные генетические факторы Est5, P92/93#594 и P9#1150 расположены в коротком плече хромосомы 1.

рис.16. Электрофорез продуктов амплификации ДНК с праймером Р полученных на линиях F8 Одесский 115/Гольф и родителях (P1, P2). 1 - P1, 2 - L76, 3 - L75, 4 - L74, 5 - L73, 6 - L72, 7 - L71, 8 - P2, 9 - Т7 по Hpa I. Стрелкой показан продукт P6#900.

рис.17. Зимограммы b-амилаз (ПААГ;

рН 8.3) зрелого зерна ячменя F8 Одесский 115/Гольф: 1 - P1, 2 - L76, 3 - L75, 4 - L74, 5 - L73, 6 - L72, 7-L71, 8 - P (Фотография любезно предоставлена В.П.Нецветаевым).

рис.18. Электрофорез продуктов амплификации ДНК линий популяции №106 с праймером P9. Стрелками показаны продукты ПЦР - P9#1150 и P9#680.

рис.19. Шесть групп сцепления, полученные на данных самоопыляющейся популяции F8 Одесский 115/Гольф.

рис.20. Электрофорез продуктов амплификации ДНК линий популяции №106 с праймером P56. М - Т7 рестрицирован по Hpa I. Стрелкой показан продукт P56#1050.

рис.21. Электрофорез продуктов амплификации ДНК линий популяции №106 с праймером P2. Стрелками показаны продукты ПЦР - P2#1300 и P2#604. М - Т рестрицирован по Hpa I.

рис.22. Электрофорез продуктов амплификации ДНК линий популяции №106 с праймером P66. Стрелкой показан продукт ПЦР - P66#2320.

рис.23. Электрофорез продуктов амплификации ДНК линий популяции №106 с праймером P69. Стрелкой показан продукт ПЦР - P69#840. М - Т7 рестрицирован по Hpa I.

Третья группа сцепления состоит из пяти локусов: P69#1050, P39#2300, P44#560, P52#912 и P52#1190.

Четвертая группа сцепления: P63#700, P66#2320, P10#1300 и P52#700. Пятая:

P56#840, P69#840, P82/83#450 и P39#1188 (рис.19,20).

Шестая группа сцепления состоит из двух RAPD локусов: P2#804 и P2#1300, амплифицированных с помощью праймера Р2 (Табл.10, рис.21).

Оценка сцепления показала, что локусы Est I и Amy I наследовались независимо от всех приведенных ПЦР продуктов.

Из 68 произвольных праймеров 12 показали полиморфизм между линиями популяции №106 (рис.22,23). Из 10 пар направленных праймеров полиморфными оказались две. Всего на популяции №106 было идентифицировано 25 полиморфных маркеров (4 изофермента и 21 ПЦР маркеров), из них 21 образовали 6 групп сцепления, покрывающих 237 сМ, то есть шестую часть генома ячменя (размер генома ячменя составляет около 1300 cM (Kleinhofs, et al., 1992). Большинство маркеров расположено рядом. Не найдено сцепления локусов продуктов амплификации с геном a-амилазы и эстеразы-I и двумя RAPD-маркерами (P57#1000, P10#1300).

Локализация продуктов RAPD при помощи линий пшеницы, дополненных хромосомами ячменя, в большинстве случаев, оказалась затруднительной. Часть полиморфных продуктов ПЦР у сортов Одесский 115 и Гольф отсутствуют у Betzes;

во вторых, полиморфные продукты ПЦР, присутствующие у данных сортов, имеются и у пшеницы Продукт амплификации присутствует в Chinese spring. P6# электрофоретическом спектре ДНК сорта Betzes и идентифицируется на 4 хромосоме, аллель продукта P57#1000 в 900 нуклеотидов присутствует как у пшеницы так и у Betzes (рис.24). Продукт P44#560 идентифицируется на четвертой хромосоме, что позволяет третью группу сцепления отнести к данной хромосоме (рис. 25).

Направленную амплификацию проводили с помощью 10 пар праймеров. В результате ПЦР образуется до 20 воспроизводимых продуктов амплификации, которые могут быть использованы как молекулярные маркеры при картировании.

Среди этих десяти пар только две показали полиморфизм между сортами Одесский 115 и Гольф - P82/P83 и P92/P93. Пара праймеров P82 и P83 была подобрана для последовательности геномной ДНК пшеницы pTaq546 (Liu, et al., 1992) по координатам 2356 и 3897. Данный участок ДНК содержит тандемный повтор 5` TAAG-3` и более длинный инвертированный повтор. При использовании этих праймеров для амплификации геномной ДНК ячменя и пшеницы в жестких условиях амплификации (1.5 mM MgCl2 в реакционном растворе и 550C температура отжига) образовывалось до 30 воспроизводимых продуктов амплификации. У сортов ячменя данные продукты амплификации были полиморфными на 50 %. Полиморфные продукты с этими праймерами не аллельны, и наследуются независимо друг от друга, так как данная пара праймеров фланкирует разные участки хромосомы. Из амплифицированных с этой парой праймеров продуктов ПЦР в образцах комбинации №106 только продукт P82/83#450 оказался полиморфен. Праймированный локус продукта P82/83#450 показал ассоциацию с локусами продуктов P56#840 и P69#840 в 5-й группе сцепления.

Информация о паре праймеров P92 и P93, получена из работы Kleinhofs, et al., (1993) где она использовалась при картировании генома ячменя в комбинации Morex/Steptoe. Локус продукта P92/93#580, фланкируемый этими праймерами, показал сцепление с геном, кодирующим эстеразу 5.

Два произвольных праймера Р22 и Р66 имели идентичные первые нуклеотидов на 3`-конце (Табл.1). Продукты амлификации, полученные с помощью этих праймеров были идентичными, что свидетельствует о том, что для выявления полиморфизма достаточно применять праймеры не более 15 нуклеотидов. Увеличение размера праймера не вносит существенных изменений.

Выше было показано, что локус P6#900 тесно сцеплен с геном кодирующим b амилазу. Возможно, этот продукт является cтруктурной частью гена b-амилазы.

Косвенным доказательством данного утверждения является тот факт, что присутствие продукт P6#900 в образцах сцеплено с менее подвижным, имеющим большую молекулярную массу изоферментом, отсутствие продукта P6#900 сопровождается более подвижной формой фермента (рис.16,17). При сравнении b-амилазной активности, обусловленной аллелями Bmy IBr и Bmy IAr, контролирующими соответственно «быстрый» и «медленный» изофермент (Нецветаев, 1992), оказалось, что более «быстрый» вариант b-амилазы характеризуется несколько меньшей амилолитической активностью, связанный с точечной мутацией в области структурной части изофермента, приводящей к изменению аминокислотного состава и снижению ферментативной активности (Netsvetaev, 1994). Возможно, последовательность праймера связывается именно с этим участком гена b-амилазы. При наличии мутации в зоне праймирования праймера P6 не происходит инициация синтеза продукта P6#900. Однако, возможно, что продукт P6#900 не является структурной частью гена, кодирующего и локализуется на некотором расстоянии от него.

b-амилазу, Определенную информацию можно будет получить только после сиквенирования продукта P6#900.

Таблица Анализ наследования продуктов ПЦР и биохимических маркеров, показавших сцепление в популяции № Группы Генетические факторы Число семей Процент Хром c сцепле АхВ Фенотипы рекомбина осом ния ции а BB bb 11.9 с 3. 1 Est5 x P92/93#594 29. AA 6 aa 37 4.8 с 1. P9#1150 x P92/93#594 100.6 I AA 12 aa 61 12.9 с 3. Est5 x P9#1150 27. AA 34 aa 4 0.0 с 0. 2 BmyI x P6#900 140.0 IV AA 0 aa 74 1.4 с 0. BmyI x P9#680 123. AA 2 aa 72 1.4 с 0. P6#900 x P9#680 123. AA 2 aa 72 30.4 с 5. 3 P39#2300 x P69#1050 7. AA 38 aa 22 10.6 с 2. P39#2300 x P44#560 57. AA 7 IV aa 55 14.1 с 2. P52#912 x P44#560 45. AA 65 aa 6 15.5 с 2. P52#1190 x P52#912 41. AA 25 aa 68 10.6 с 2. 4 P66#2320 x P63#700 63. AA 21 aa 64 21.8 с 3. P66#2320 x P10#1300 22. AA 54 aa 25 17.2 с 3. P10#1300 x P53#700 30. AA 52 aa 19 1.0 с 0. 5 P56#840 x P69#840 131. AA 3 aa 52 18.6 с 3. P69#840 x P82/83#450 29. AA 29 V aa 41 17.6 с 3. P39#118 x P82/83#450 28. AA 47 aa 15 13.0 с 3. 6 P2#1300 x P2#604 36. AA 47 aa 16 рис.24. Электрофорез продуктов амплификации праймером Р6 линий c пшеницы Chinese spring, дополненных хромосомами ячменя. 1 - Betzes;

2,11 Chinese spring;

3 - хромосома I;

4 - хромосома II;

5 - хромосома III;

6,7 - хромосома IV (стрелками показан продукт P6#900);

8,9 - VI;

10 - VII.

рис.25. Электрофорез продуктов амплификации c праймером Р44 линий пшеницы Chinese spring, дополненных хромосомами ячменя. 1,9,10 - Betzes;

2 Chinese spring;

3 - хромосома I;

4 - хромосома II;

5 - хромосома III;

6 - хромосома IV;

7 - VI;

8 - VII. Стрелкой показан продукт P44#560.

5.2. Маркерный анализ количественных признаков Одним из наиболее распространенных подходов при анализе количественной изменчивости является, так называемый, биометрический подход, основы которого заложены в работах Гальтона, Фишера, Райта, Мазера. В современной генетике принято, что количественные признаки находятся под контролем полигенных систем.

Биометрический подход предполагает, что, хотя свойства полигенов аналогичны свойствам менделевских генов, определяющих альтернативные признаки, количественные признаки контролируются большим числом генов, вклад каждого из которых в изучаемый признак может быть не одинаков. Допущение незначительности индивидуальных эффектов генов по сравнению со степенью экологической изменчивости количественных признаков обусловливает необходимость применения для их анализа методов, отличных от методов обычной менделевской генетики (разложение дисперсий и ковариаций, определение коэффициента наследственности и так далее).

Трактовка термина «полигенный» основывается на следующих положениях (Жученко и др., 1978):

1) признак может быть полигенным, более того, можно предположить, что каждый из генов генома оказывает в какой-то мере влияние на данный признак. Но, если расщепление по некоторым из них обусловливает большую часть всей наследственной изменчивости, можно считать. что признак контролируется именно этим небольшим числом генов и вряд ли такое упрощение является слишком грубым для большинства приложений. Идентификация каждого из этих основных генов представляется вполне реальной задачей;

2) гены, контролирующие многие количественные признаки, могут быть распределены по геному и в пределах отдельных хромосом не равномерно, а в виде компактных блоков, рекомбинационное разрушение которых происходит редко в силу локализованности кроссоверных обменов (Жученко, 1980;

Жученко, Король, 1985).

Целостность сравнительно протяженных сегментов хромосом может поддерживаться также естественным отбором (Левонтин, 1978).

Одним из вариантов менделевского анализа количественной изменчивости как в контролируемых скрещиваниях, так и в случае родословных произвольной структуры является построение моделей, основанных на простейших гипотезах о генетической природе наиболее подходящего описания на основе статистических критериев. Другой подход связан с использованием маркерных генов.

Использование маркеров значительно увеличивает эффективность и разрешающие возможности менделевского подхода, позволяя определить вклад отдельных хромосом и их сегментов без жестких ограничивающих предположений об общим числе локусов, определяющих изменчивость изучаемого количественного признака (Серебровский, 1970;

Soller et al., 1976). Как известно, оценка эффекта целых хромосом и их плеч возможна также на основе цитогенетических методов нуллисомного, моносомного, трисомного, транслокационного анализов, индуцированных нехваток, межлинейного замещения хромосом.

Для определения сцепления молекулярных маркеров с локусами количественных признаков предложены модели Jensen J. (1989) и Simpson S.P. (1989), в которых оценка параметров рекомбинации локусов количественных признаков относительно двух молекулярных маркеров производится методом максимального правдоподобия.

В работе Simpson S.P. (1989) рассматривается самоопыляющаяся популяция как модель для детекции сцепления между локусом QTL и локусами ПДРФ. Автор показал, что достаточно несколько имбредных линий для анализа значения маркеров и определил их влияние на фенотип. Jensen J. (1989) использовал метод максимального правдоподобия для оценки частоты рекомбинации локусов QTL и маркерных локусов на дигаплодных линиях. Маркерами с известной локализацией являются ген устойчивости к гербициду DDT (ddt) и ген s (короткие остья), локализованные в хромосоме и сцепленые в 31% рекомбинации. Количественный локус массы одного зерна (Kw1) был сцеплен с геном s, то есть схема расположения локусов такова: ddt-s Kw1.

Нашей задачей стоял анализ сцепления локусов продуктов амплификации с локусами количественных признаков. Для этого были проанализированы за два года (1994-1995) 150 линий популяции №106 по следующим количественным показателям:

продуктивность, озерненность, число зерен на одном растении, масса 1000 зерен и кустистость. Покрываемый маркерами размер генома составил шестую часть (237 сМ), то есть достаточную для предварительного анализа при определении сцепления QTLs с молекулярными маркерами. Для этого проводился статистический анализ средних величин между аллелями маркера, используя t-критерий Стюдента и F-критерий Фишера (Лакин,1990).

В результате были получены следующие данные.

а) Все количественные показатели проявившиеся сцепление с определенными маркерами в одном году не идентифицируются в другом году с этой группой сцепления.

б) Достоверные результаты по t-критерию на высоком уровне значимости иногда были недостоверны по F-критерию (табл. 11).

в) Основные достоверные данные получены на 3 и 4 группах сцепления и один раз с 6 группой сцепления.

Количественный показатель “продуктивность” достоверно проявился в 3 и группах сцепления. В 3 группе сцепления данный показатель определяется только в 1995 году между локусами P69#1050 и P39#2300 (Табл.11). В 4 группе сцепления достоверным оказалось сцепление данного показателя с локусом P66#2300 в году.

“Озерненность” идентифицируется на 3 и 4 группах сцепления. Локализация данного локуса идентифицируется между локусами P39#2300 и P44#560 3 группы в 1995 году и между P63#700 и P66#2320 четвертой группе сцепления в 1994 году.

“Число зерен на одном растении” идентифицируется в 3 группе сцепления между локусами P69#1050, P39#2300 и P44#560 в 1995 году;

в 4 группе сцепления идентифицируется с локусом P66#2300 в 1994 году.

“Масса 1000 зерен” идентифицируется с маркером P66#2300 четвертой группы сцепления и с P2#604 и P2#1300 шестой группы за 1995 год.

“Кустистость” в 1994 году идентифицируется между локусами P66#2300 и P63#700 четвертой группы сцепления.

Таким образом, достоверные результаты, полученные в 1995 году в третьей группе сцепления, не проявлялись в 1994 году, но идентифицировались в четвертой группе сцепления этого года. Основные маркеры показавшие достоверные результаты в третьей группе сцепления: P69#1050, P39#2300 и P44#560. В четвертой группе за 1994-1995 годы - P66#2300. Поэтому, эти маркеры можно рекомендовать для анализа селекционно-генетического материала.



Pages:     | 1 || 3 |
 





 
© 2013 www.libed.ru - «Бесплатная библиотека научно-практических конференций»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.