авторефераты диссертаций БЕСПЛАТНАЯ БИБЛИОТЕКА РОССИИ

КОНФЕРЕНЦИИ, КНИГИ, ПОСОБИЯ, НАУЧНЫЕ ИЗДАНИЯ

<< ГЛАВНАЯ
АГРОИНЖЕНЕРИЯ
АСТРОНОМИЯ
БЕЗОПАСНОСТЬ
БИОЛОГИЯ
ЗЕМЛЯ
ИНФОРМАТИКА
ИСКУССТВОВЕДЕНИЕ
ИСТОРИЯ
КУЛЬТУРОЛОГИЯ
МАШИНОСТРОЕНИЕ
МЕДИЦИНА
МЕТАЛЛУРГИЯ
МЕХАНИКА
ПЕДАГОГИКА
ПОЛИТИКА
ПРИБОРОСТРОЕНИЕ
ПРОДОВОЛЬСТВИЕ
ПСИХОЛОГИЯ
РАДИОТЕХНИКА
СЕЛЬСКОЕ ХОЗЯЙСТВО
СОЦИОЛОГИЯ
СТРОИТЕЛЬСТВО
ТЕХНИЧЕСКИЕ НАУКИ
ТРАНСПОРТ
ФАРМАЦЕВТИКА
ФИЗИКА
ФИЗИОЛОГИЯ
ФИЛОЛОГИЯ
ФИЛОСОФИЯ
ХИМИЯ
ЭКОНОМИКА
ЭЛЕКТРОТЕХНИКА
ЭНЕРГЕТИКА
ЮРИСПРУДЕНЦИЯ
ЯЗЫКОЗНАНИЕ
РАЗНОЕ
КОНТАКТЫ


Pages:     | 1 |   ...   | 2 | 3 || 5 |

«СОДЕРЖАНИЕ ЗООЛОГИЯ Никулин А. Д., Чистяков Д. В. Экология рукокрылых (Chiroptera, Vespertilioni- ...»

-- [ Страница 4 ] --

Такой широкий охват биологических, физико-химических и медицинских проблем и полученные в ходе проведенных исследований новые приоритетные результаты, под вергнутые всестороннему системному анализу, побудили американских издателей пред ложить С. Н. Лызловой обобщить опыт работы лаборатории в виде монографии, кото рая вышла в свет в Издательстве CRC Press в 1991 г. [11].

Потребности практического здравоохранения продолжают диктовать необходи мость сотрудничества нашей кафедры с ведущими медицинскими учреждениями Санкт-Петербурга. Креатинкиназный тест был использован при разработке моделей формирования алкогольной зависимости, скрининге наследственных миопатий [11], ис следовании влияния фармакологических препаратов [27, 28], а также для диагностики гипоксических состояний плода и новорожденных детей [21, 28].

Несмотря на то, что изучение креатинкиназы на кафедре ведется на протяжении уже нескольких десятилетий, этот объект оказался настолько удачным и универсаль ным с точки зрения энзимологии, что его исследования продолжаются до сих пор, но уже на новом методическом уровне [8].

Креатинкиназная реакция реакция двухсубстратная и, более того, обратимая и не может быть полноценно описана методами традиционной михаэлисовой кинети ки, основанной на целом ряде исходных постулатов, главный из которых участие в реакции только одного субстрата. Разнообразные более поздние усложнения исходно го кинетического уравнения Михаэлиса Ментен так и не позволили выйти за рамки односубстратной модели и потому сложные ферментативные процессы принято ана лизировать по частям, когда изменяется концентрация только одного действующего реагента, а концентрации всех остальных участников реакции фиксируются на по стоянном уровне.

Такой подход не только приводит к утрате значительной части информации, содер жащейся в экспериментальных данных, и не позволяет проверить адекватность приня той к рассмотрению кинетической модели, но и осложняет методику математического планирования эксперимента и результатов его анализа, что еще более ухудшает ситуацию.

Теоретические модели, описывающие ферментативные процессы любой степени сложности, существуют уже достаточно давно, и наиболее известный и удобный так называемый диаграммный метод создания подобных моделей был разработан в на шем университете группой физиков-теоретиков под руководством чл.-корр. АН СССР М. В. Волькенштейна в 1960–1970-е годы. Метод базируется на теории графов. Пер вые попытки практического применения этого метода были предприняты учеником и соавтором М. В. Волькенштейна В. Е. Стефановым, перешедшим работать на нашу кафедру [11;

12, с. 284]. Однако ограниченность экспериментальных методик того вре мени не позволила получить опытные данные высокой степени точности и в полной мере задействовать необходимый математический аппарат. Лишь с появлением лабо раторного аналитического оборудования, управляемого персональным компьютером, и с разработкой в нашей лаборатории специального программного обеспечения впервые на примере креатинкиназной реакции удалось выполнить полноценное описание слож ного кинетического процесса с одномоментным расчетом всех реальных физических констант (константы Михаэлиса не имеют строго определенного физического смыс ла) [15, 19, 25, 26]. В настоящее время с учетом приобретенного опыта нами ведется разработка новой современной методологии анализа кинетики сложных ферментатив ных реакций, которая включает рекомендации по построению кинетических моделей (одной или нескольких), соответствующих: предполагаемому механизму реакции;

мате матическому планированию и лабораторной организации кинетических исследований;

статистическому анализу результатов с учетом особенностей принятой к рассмотрению математической модели;

а также компьютерному моделированию, необходимому для проверки справедливости сделанных выводов [16, 18, 23, 24].

Важным направлением в работе кафедры биохимии в области энзимологии стало модельное изучение физико-химического механизма каталитической активности фер ментов и их регуляторных свойств. На основе формальной модели Дегани/Дегани структурно-функциональной организации олигомерных ферментов, постулировавшей наличие каналов связи между субъединицами олигомерных ферментов, проведены ис следования возможных молекулярных механизмов реализации таких каналов. Проана лизированы доступные структурные данные по большому числу олигомерных фер ментов, представляющих все классы белковых катализаторов. Выдвинута гипотеза о том, что роль таких каналов могут играть непрерывные системы водородных связей, выявленные в их структуре, и предложен механизм функционирования этих систем, объясняющий феномен аллостерической регуляции, а также положительной и отрица тельной кооперативности, включая такой крайний случай, как реактивность половины от числа активных центров ( флип-флоп механизм ) [10, 35]. Идентифицированы воз можные каналы переноса энергии в ATP/GTP-зависимых белках [5, 22, 29, 34, 37].

В последнее десятилетие в энзимологических исследованиях, проводимых группой биомоделирования, стали широко использоваться современные методы вычислительной химии, что позволило получить принципиально новые данные о базовых физических механизмах процессов, происходящих в молекуле фермента в ходе каталитического ак та [9, 17, 30]. Было показано, что ион магния в составе комплекса с ATP(GTP) способен генерировать сигнал, который может распространяться по пути, образованному опреде ленными группами аминокислотных остатков и молекул воды, входящих в сольватную оболочку [36, 37]. На основе сформулированных в результате теоретического анализа представлений были проведены модельные экспериментальные исследования с заме ной активирующего магниевого кофактора энергетической накачкой, создаваемой ла зерным облучением, косвенно подтвердившие основные положения постулированного механизма функционирования MgATP(MgGTP)-зависимых ферментов [38].

В последние годы энзимологические исследования, в частности исследования меха низма действия ферментов, субстратом которых является комплекс иона магния с ATP, вышли на квантово-механический уровень. Именно такой анализ позволил объяснить стадии катализируемого ферментом химического превращения и сопряженные с ним процессы, связанные с изменениями спинового состояния комплекса. Было выдвинуто предположение о том, что в клетке Mg выступает в качестве спинового катализатора, активность которого связана с переходом катиона Mg из синглетного (S) в триплетное (T) состояние с образованием свободных ион-радикалов в фемтосекундном интервале времени и описан ранее неизвестный ион-радикальный путь распада ATP [31]. Такая реакция протекает со скоростями на десять порядков выше, чем обычный гидролиз, и может лежать в основе сверхбыстрых процессов самоорганизации биомолекулярных систем. Аргументами в пользу реализуемости этого механизма в живых системах слу жит тот факт, что в клетке энергетическая разница между S- и T-состояниями может быть небольшой и чувствительной к внешним воздействиям и белковому окружению, в результате чего комплекс может легко переходить из S-состояния в Т-состояние, что и определяет путь распада ATP [9, 39].

В течение нескольких лет в рамках сотрудничества с американскими коллегами профессорами Г. Мизиорко (зав. отд. биохимии и молекулярной биологии Университета Канзас-Сити, штат Миссури) и Д.-Д. Ким (Медицинский центр штата Висконсин) ве дутся сравнительные структурно-функциональные исследования двух ключевых АТР зависимых ферментов мевалонатного пути биосинтеза холестерина мевалонаткиназы и мевалонатдифосфатдекарбоксилазы, по структурному подобию относящихся к супер семейству GHMP-киназ. Результаты работы планируется использовать для поиска и це ленаправленного синтеза высокоспецифичных ингибиторов ферментов, которые могли бы выступать в качестве антимикробных факторов (ингибиторы мевалонаткиназы) и антираковых препаратов (ингибиторы мевалонатпирофосфатдекарбоксилазы). Иссле дования проводятся на рекомбинантных белках методами сайт-специфического мута генеза, рентгеноструктурного анализа и структурного моделирования с последующим изучением кинетики мутантных и диких форм ферментов. В белковый банк данных внесены три новые структуры: апомевалонаткиназа человека, комплекс мевалонатки назы крысы с фарнезилпирофосфатом и апомевалонатдифосфатдекарбоксилазой че ловека, впервые полученной в высокоочищенном виде. Картированы аминокислотные остатки, обеспечивающие ретроингибирование мевалонаткиназы и стадию декарбокси лирования мевалонатдекарбоксилазной реакции [33, 42, 43].

Разработка сотрудниками кафедры, специализирующимися в области энзимологии, новых высокотехнологичных методологий и полученные за последние годы оригиналь ные приоритетные данные служат хорошей основой для воспитания молодого поколе ния профессионалов биохимиков и молекулярных биологов. Для студентов уже более 50 лет читается лекционный курс Энзимология, проводятся практикумы по отдель ным разделам энзимологии, читается выросший из спецпрактикума по энзимологии курс Персональный компьютер для биохимика, реализуется магистерская програм ма Энзимология.

Активная и разнообразная научно-педагогическая и организаторская деятельность кафедры биохимии ЛГУ/СПбГУ привела к созданию уникальной университетской эн зимологической школы, традиции которой поддерживаются и системно развиваются ее учениками во многих научных, учебных и клинических учреждениях не только России, но и за рубежом.

Литература Монографии, главы в монографиях 1. Антипенко А. Е., Калинский М. И., Лызлова С. Н. Метаболизм миокарда при различных функциональных состояниях. Екатеринбург: Изд-во Уральского университета, 1992. 211 с.

2. 80-летие кафедры биохимии биолого-почвенного факультета // Вестн. С.-Петерб. ун-та.

Сер. 3. 2009. Вып. 1. 182 с.

3. Владимиров Г. Е. Об энергетической функции аденозинтрифосфорной кислоты в клетке // Фосфорилирование и функция. Л.: Изд-во ИЭМ, 1960. С. 44–49.

4. Ивашкин В. Т., Васильев В. Ю., Северин Е. С. Уровни регуляции функциональной ак тивности органов и тканей. Л., 1987. 272 с.

5. Карасев В. А., Стефанов В. Е., Курганов Б. И. Надмолекулярные биоструктуры: орга низация, функционирование, происхождение. Итоги науки и техники. М., 1989. Т. 31. 200 с.

6. Лызлова С. Н. Фосфагенкиназы. Л.: Изд-во ЛГУ, 1974. 168 с.

7. Пантелеева Н. С. Миозин: 18 О обмен и фосфорилирование. Л.: Изд-во ЛГУ, 1975. 200 с.

8. Стефанов В. Е., Лызлова С. Н. Креатинкиназа // Белки и пептиды. М.: Наука, 1995.

Т. 1. С. 123–129.

9. Тулуб А. А., Стефанов В. Е. Спинтроника нуклеотидов. Сверхбыстрые реакции в био логии. СПб.: Наука, 2010.

10. Karasev V. A., Stefanov V. E. Chemical organization of supramolecular biostructures // Organization of Biochemical systems: structural and regulatory aspects. Nova Science Publishers, Inc., 1996. P. 125–157.

11. Lyzlova S. N., Stefanov V. E. Phosphagen kinases. USA. CRC Press, 1991. 222 p.

Учебники и учебные пособия 12. Березин И. В., Клесов А. А. Практический курс химической и ферментативной кине тики. М.: Изд-во МГУ, 1976. 320 с.

13. Владимиров Г. Е., Лызлова С. Н. Энзимология. Л., 1962. 256 с.

14. Владимиров Г. Е., Пантелеева Н. С. Функциональная биохимия, избранные главы. Л.:

Изд-во ЛГУ, 1965. 240 с.

15. Лянгузов А. Ю., Петрова Т. А., Шишов А. К. Электромиграционные методы анализа белков-ферментов. СПб.: Изд-во СПбГУ, 1992. 56 с.

16. Стефанов В. Е., Петрова Т. А., Лянгузов А. Ю. Методы компьютерного моделирова ния и анализ ферментативной кинетики. СПб.: Золотое сечение, 2007. 102 с.

17. Стефанов В. Е., Тулуб А. А. Введение в квантовую биологию. Методы компьютерного моделирования в анализе биомолекулярных систем. СПб.: Изд-во СПбГУ, 2006. 75 с.

18. Ферменты и нуклеиновые кислоты / Под ред. В. Г. Владимирова, С. Н. Лызловой. СПб.:

Изд-во СПбГУ, 1997. 152 с.

Авторские свидетельства и патенты 19. Берзинь-Берзит Р. В., Петрова Т. А., Васильев В. Ю., Путере М. П., Неймане М. А.

Способ получения креатинкиназы ММ из скелетных мышц. Авт. св-во СССР № 1398397. Дата приоритета 10.06.1986. Дата регистрации 22.01.1988.

20. Васильев В. Ю., Калацкий Ю. М., Петрова Т. А., Стефанов В. Е. Способ интегральной экспресс-оценки загрязнения окружающей среды. Патент РФ № 2359036. Дата приоритета 26.09.2007. Дата регистрации 20.06.2009.

Статьи 21. Арутюнян А. В., Павлова Н. Г., Константинова Н. Г., Павленко А. В., Кащеева Т. К., Лызлова Л. В., Козина Л. С., Русина Е. И., Михайлов А. В., Шелаева Е. В. Биохимические маркеры нарушения развития мозга плода человека // Нейрохимия. 1996. Т. 13, № 3. С. 187– 193.

22. Карасев В. А., Стефанов В. Е. Эволюционный структурно-функциональный подход к надмолекулярным структурам // Успехи биол. химии. 1991. Т. 32. С. 114–145.

23. Лянгузов А. Ю., Петрова Т. А. Методология исследования сложных ферментативных реакций // Вестн. С.-Петерб. ун-та. 1998. Сер. 3. Вып. 4. № 24. С. 58–72.

24. Лянгузов А. Ю., Петрова Т. А., Стефанов В. Е. Новый подход к расчету параметров в ферментативной кинетике // Доклады Академии наук (биохимия, биофизика, молекулярная биология). 2009. Т. 424, № 5. С. 692–695.

25. Матюшичев В. Б., Лянгузов А. Ю., Петрова Т. А. Оценка качества уравнения стаци онарной скорости для двухсубстратной ферментативной реакции // Биохимия. 1991. Т. 56.

С. 1661–1664.

26. Матюшичев В. Б., Лянгузов А. Ю., Петрова Т. А., Лапко А. В. Проверка адекват ности кинетических уравнений для двухсубстратной ферментативной реакции (на примере креатинкиназы) // Вестн. ЛГУ. 1991. Сер. 3. Вып. 2. № 10. С. 70–76.

27. Матюшичев В. Б., Соколов И. Н., Петрова Т. А., Лянгузов А. Ю., Гончарова В. И., Петрова Т. Н. Сдвиги креатинкиназной активности и белкового спектра развивающейся мы шечной культуры, обработанной креатинфосфатом // Вестник АМН. 1992. № 5. С. 61–65.

28. Солодкова И. В., Петрова Т. А., Потиха О. В., Лянгузов А. Ю. Эффективность при менения пирацетама при внутриутробной гипоксии плода. Контроль за содержанием изо форм креатинкиназы // Антигипоксанты и актопротекторы: итоги и перспективы. СПб., 1994.

С. 136.

29. Cтефанов В. Е. Моделирование в структурно-функциональном анализе биомолекуляр ных систем // Биохимические и молекулярно-биологические основы физиологических функ ций. Нервная система. Вып. 37. СПб.: Изд-во СПбГУ, 2004. С. 112–140.

30. Стефанов В. Е. Исследования наностуктур биологического происхождения и биологи чески значимых наносекундных процессов методами компьютерного моделирования // Вестн.

С.-Петерб. ун-та. 2009. Сер. 3. Вып. 1. С. 36–48.

31. Тулуб А. A., Стефанов В. Е. Окислительные свойства [Mg(H2 O)6 ] в триплетном и син глетном состоянии определяют энергетику распада молекулы аденозинтрифосфата // Журн.

неорганической химии. 2009. Т. 54. С. 1188–1195.

32. Engelhart V. A., Ljubimova M. N. Myosin and adenosinetriphosphatase // Nature. 1939.

Vol. 144, N 3650. Р. 668–669.

33. Fu Z., Voynova N. E., Herdendorf T. J., Miziorko H. M., Kim J.-J. P. Biochemical and struc tural basis for feedback inhibition of mevalonate kinase and isoprenoid metabolism // Biochemistry.

2008. Vol. 47. P. 3715–3724.

34. Karasev V. A., Stefanov V. E. Origin of oligomeric enzymes: population-template model // Evolutionary Biochem. and Related Areas of Physicochem. Biol. Moscow, 1995. P. 377–407.

35. Stefanov V. E., Karasev V. A. Flip-op mechanism in the enzymatic catalysis: model for kinetic description or physical reality? // An. Quim. 1990. Vol. 86. P. 903–909.

36. Stefanov V. E., Tulub A. A. Mechanisms of biological eects of metal mediated by inter actions with nucleotide cofactors of proteins // Metals Ions in Biology and Medicine. Paris: John Libbey Eurtext, 2002. Vol. 7. P. 89–93.

37. Stefanov V. E., Tulub A. A. Migration of protons in a chain of tyrosine residues // Int. J.

Quant. Chem. 2001. Vol. 84, N 4. P. 409–415.

38. Tulub A. A., Stefanov V. E. Activation of Tubulin Assembly into Microtubules upon a Series of Repeated Femtosecond Laser Impulses // J. Chem. Phys. 2004. Vol. 121, N 22. P. 1134–1135.

39. Tulub A. A., Stefanov V. E. New horizons of adenosinetriphosphate energetics arising from interaction with magnesium cofactor // Europ. Biophys. J. 2008. Vol. 37, N 8. P. 1309–1316.

40. Vasiliev V. Yu., Kalatzky Yu. M., Petrova T. A., Stefanov V. E. Method for monitoring water pollution based on induced uorescence in the biomolecular test-system // Proceedings of V In ternational Conference Current Problems in Optics of Natural Waters. St. Petersburg, Russia, September 8–11, 2009. P. 144–148.

41. Vladimirov G. E., Vlasova V. G., Kolotilova A. I., Lyzlova S. N., Panteleeva N. S. The free energy hydrolysis of adenosine triphosphoric acid // Nature. 1957. Vol. 179, N 4574. P. 1350–1351.

42. Voynova N. E., Fu Z., Battaile K. P., Нerdendorf T. J., Kim J.-J. P., Miziorko H. M. Human mevalonate diphosphate decarboxylase: characterization, investigation of the mevalonate diphos phate binding site, and crystal structure // Archives of Biochemistry and Biophysics. 2008. Vol. 480.

P. 58–67.

43. Voynova N. E., Rios S. E., Miziorko H. M. Staphylococcus aureus mevalonate kinase: isola tion and characterization of an enzyme of the isoprenoid biosynthetic pathway // J. Bacteriology.

2004. Vol. 186. P. 61–67.

Статья поступила в редакцию 28 июня 2010 г.

УДК 576.3+537.67 Вестник СПбГУ. Сер. 3. 2010. Вып. М. Л. Куранова, А. Е. Павлов, И. М. Спивак, С. В. Сурма, Б. Ф. Щеголев, П. А. Кузнецов, В. Е. Стефанов ВОЗДЕЙСТВИЕ ГИПОМАГНИТНОГО ПОЛЯ НА ЖИВЫЕ СИСТЕМЫ Вопросы воздействия магнитных и электромагнитных полей на биологические объ екты изучаются достаточно давно. И, если механизмы действия ионизирующего из лучения рассмотрены детально [1, 2], то механизмы воздействия электромагнитного излучения ниже теплового порога до сих пор не известны.

Особый интерес представляет изучение воздействия сверхслабых электромагнитных и магнитных полей, энергия квантов поля которых находится ниже характеристической энергии химического превращения. Данных, подтверждающих наличие биологического действия подобных полей, достаточно [3, 4], однако сам механизм воздействия поля достоверно не известен.

Предпринималось множество попыток объяснения физической природы биологи ческих эффектов сверхслабых полей [5–13], однако все они сталкиваются с необходи мостью экспериментального подтверждения. Отсутствие ясных представлений о поста новке эксперимента оставляет все разработки на уровне гипотез. Известно, что электро магнитный фон очень сильно различается не только в пространстве, но и во времени.

Одной из основных проблем, с которой сталкиваются экспериментаторы, является невозможность стандартизировать условия проведения экспериментов [14]. Этот фак тор лежит в основе низкой воспроизводимости опытов. По-видимому, условия нуле вого магнитного поля позволяют унифицировать проведение экспериментов. Кроме того, исследования магнитного вакуума играют важную роль в изучении возможно сти адаптации человека к условиям открытого космоса.

Для понимания биологического действия ослабленного геомагнитного поля исследо вателями применяются 2 принципиально различных похода. Первый основан на прин ципе активной компенсации геомагнитного поля, например с помощью трех пар взаим но перпендикулярных колец (кольца Гельмгольца), и заключается в создании магнит ного поля, равного по величине, но противоположного по направлению геомагнитному.

Недостатки такого подхода следующие: во-первых, область практически однородного скомпенсированного магнитного поля крайне невелика и составляет 20% от объема, ограниченного кольцами, что серьезно затрудняет размещение там лабораторного жи вотного;

во-вторых, сам биологический объект полностью открыт для всевозможных наводок переменных электромагнитных полей техногенного характера 50–100 и 400 Гц, а также высокочастотных наводок.

Второй подход это экранирование замкнутого объема материалом с большой маг нитной проницаемостью. В данном случае техногенные наводки не страшны, однако при использовании в качестве экранов аморфных магнитомягких материалов требует ся размещение биологических объектов по оси экранирующих цилиндров или в центре Работа выполнена при поддержке РФФИ (грант № 09-04-01208), Министерства образования и науки России (грант № 2.1.1/485) и программы ПРАН (Генофонды и генетическое разнообразие).

c М. Л. Куранова, А. Е. Павлов, И. М. Спивак, С. В. Сурма, Б. Ф. Щеголев, П. А. Кузнецов, В. Е. Стефанов, экранирующих сфер, что продиктовано особенностью прохождения магнитно-силовых линий в таких материалах.

В наших исследованиях были использованы оба этих подхода. При изучении воз действия ослабленного геомагнитного поля на уровне целого организма в компенсаци онную установку помещалось лабораторное животное крыса линии SHR. Было об наружено, что в условиях компенсированного поля у животного наблюдались резкие колебания АД (артериальное давление) и ЧСС (частота сердечных сокращений), но систематизировать данные эффекты не удалось вследствие влияния индивидуальных особенностей лабораторных животных на степень и характер проявления магнитобио логического эффекта. Сложности интерпретации результатов на уровне целого орга низма явились побудительным мотивом для проведения экспериментов на более про стом по организации биологическом уровне.

В качестве моделей были выбраны две клеточные линии: эпителиоидная карцинома HeLa и первичные фибробласты человека VH-10. Предполагалось, что растущие в усло виях нормального геомагнитного поля клетки будут воспринимать его экранирование как стрессорное воздействие и, возможно, демонстрировать классический клеточный ответ на повреждение. К настоящему времени механизм глобального клеточного ответа хорошо изучен [15]: большинство генов, продукты которых вовлечены в него, клони рованы и секвенированы. Основным белком, вовлеченным в процессы поддержания клеточной стабильности, является антионкоген Р-53, появление которого в фосфори лированной форме может служить маркером запуска глобального клеточного ответа на повреждение [16–18].

Известно, что любое клеточное изменение требует энергетических ресурсов. Источ ником АТФ в клетке являются митохондрии, которые в нормально пролифирирующих клетках культуры образуют сеть, выполняющую интегрирующую функцию в энерге тической системе клетки. В работе [19] показано, что структура митохондриальной сети является крайне пластичной и способна к реорганизации при действии поврежда ющих агентов. Таким образом, для предварительного анализа реакции клетки на гипо геомагнитное поле нами было выбрано исследование Р-53 статуса и митохондриальной сети изучаемых клеток.

Материалы и методы исследования Компенсация геомагнитного поля. Компенсация геомагнитного поля осу ществлялась с помощью трех пар взаимно перпендикулярных колец Гельмгольца. Для управления токами в обмотках колец установки был разработан и создан трехканаль ный усилитель тока, позволяющий раздельно регулировать каждую из трех компонент вектора индукции магнитного поля.

Экранирование геомагнитного поля. Для исследования влияния сверхслабых магнитных полей на биологические объекты клеточного и субклеточного уровней была создана экранирующая камера, представляющая собой цилиндр (D = 26 см, L = 84 см), покрытый десятками слоев экранирующего материала, изготовленного на основе спла ва из аморфного магнитомягкого материала АМАГ-172. Общее количество слоев рав но 40. Все слои намотаны в одну сторону и сгруппированы в 4 независимых пакета по 10 слоев в каждом с воздушными промежутками 3 мм между пакетами. С одно го торца у цилиндра фиксированная заглушка, с другого съемная крышка. Заглуш ка и крышка имеют экранирующее покрытие, идентичное покрытию цилиндра. Кон струкция съемной крышки позволяет избежать появления магнитных дыр в экране.

Внутри камеры предусмотрена подставка из немагнитного материала, позволяющая устанавливать биологические объекты в центре экранирующей камеры. Многослойная организация магнитного экрана позволила получить коэффициент экранирования, рав ный 250 по постоянной составляющей внешнего магнитного поля, ослабляя магнитное поле земли (48 мкТл) до величины 0,192 мкТл в центре закрытой камеры. Принимая во внимание заявленные производителем магнитомягкого материала АМАГ-172 его ча стотные характеристики, следует отметить высокую степень экранирования и от любых высокочастотных помех и наводок.

Приборы для измерений и обработка данных. Измерения магнитных полей проводились однокоординатным магнитометром FLUXMASTER (1 нTл to 200 мкTл) производства Германии, а также трехкоординатным магнитометром HB0302.1А (Рос сия) с разрешающей способностью 0,1 мкТл, снабженного специально разработанным для PC (персонального компьютера) программным обеспечением для контроля как составляющих, так и суммарного вектора магнитного поля в режиме реального вре мени. Для регистрации переменных составляющих электромагнитного поля в рабочих объемах используются преобразователи (датчики) индукции магнитного поля НВ- и НВ-0303.1 с рабочим диапазоном частот (плоский участок АЧХ) соответственно 5–10000 Гц и 1–1000 кГц. Для снятия данных с указанных датчиков (оцифровки и ввода сигнала в компьютер) используется PC-осциллограф PCS-500 фирмы Welleman (Бельгия). Анализ частотного спектра осуществлялся с помощью программного пакета PC-Lab 2000SE.

Исследования воздействия магнитного поля на гомеостаз сердечно-сосудистой си стемы биологического объекта (лабораторная крыса): 1) АД и его вариабельности;

2) ЧСС и ее вариабельности в зависимости от исходного состояния (уровень АД, тип наркоза, состояние антиоксидантной системы) этого объекта проводилось с помощью оригинального АД- и ЧСС-измерительного комплекса, созданного на основе датчика для прямого измерения артериального давления Baxter, и оригинальной компьютер ной программы KardioPlus, которая позволяет оценивать частоту сокращения сердца, а также изменение влияния на вариабельность ритма разных регуляторных систем.

Микроскопия и анализ изображений. Анализ фиксированных на предметных стеклах клеток проводили при помощи лазерного сканирующего конфокального мик роскопа LSM-5 Pascal (C. Zeiss, Германия), оборудованного объективом 63/1.4 и арго новым лазером (458/488 нм).

Статистическая обработка результатов. Статистическая обработка и представление графиков проводились с использованием пакета программ Excel (Mi crosoft).

Модельные системы. Для экспериментов в условиях компенсации использова лись как широко известные крысы линии Wistar, так и обычный модельный объект для исследования фармакологического действия гипотензивных препаратов гипертензив ные крысы линии SHR. Для контроля брали крыс линии WKY, близкой к опытной.

Животное помещалось на немагнитный столик в геометрическом центре установки, где поле наиболее однородно. Крыса наркотизировалась раствором оксибутирата на трия внутрибрюшинно. Датчик ЧСС и АД вводился в бедренную артерию животного, сигнал с которого поступал на усилитель и через аналого-цифровой преобразователь РПГ-ВЧ на персональный компьютер, где и анализировался.

Клетки выращивали в пластиковых флаконах на чашках Петри (Nunclon, США) и предметных стеклах, помещенных в чашку Петри, на среде F-10 или DMEM (Био лот, Россия или Sigma, США) с добавлением 10%-ной фетальной сыворотки крупного рогатого скота (Sigma) и антибиотиков (100 ед./мл пенициллина, 100 мкг/мл стрепто мицина) при 37 С в атмосфере с содержанием 5% СО2. Клетки HeLa эпителиоидная карцинома человека, полученная из коллекции клеточных культур Института цитоло гии РАН. Клеточный штамм VH-10 диплоидные фибробласты крайней плоти маль чика 11 лет, используемые в исследовании в качестве клеток здорового донора [20, 21].

Клетки любезно предоставлены профессором А. Кольман (A. Kolman, Стокгольмский университет, Швеция).

Регистрация Р-53. Иммунофлуоресцентный анализ Р-53 проводили на фиксиро ванных клетках. Выращенные на покровных стеклах до субконфлуэнтного состояния клетки фиксировали 4%-ным раствором формальдегида в PBS (фосфатный буфер) на льду в течение 10 мин. После интенсивной промывки PBS клетки пермеабилизировали в 0,5%-ном растворе Тритона X-100 (Sigma) в PBS в течение 5 мин, промывали PBS и помещали на 30 мин в 1%-ный раствор бычьего сывороточного альбумина (BSA, Sigma) в PBS. Для визуализации дикого типа и большинства мутантных форм белка Р-53 мето дом непрямой иммунофлуоресценции клетки сначала в течение 60 мин инкубировали с коммерческими поликлональными кроличьими антителами к человеческому белку Р- (1:50 Santa Cruz, США), затем 30 мин с козьими антителами к кроличьему гамма глобулину, сконьюгированными с флуоресцеинизотиоционатом (FITC, Sigma), в разве дении 1:300. Между инкубациями с антителами стекла промывали 30 мин в 0,1%-ном растворе Tween 20 (Sigma) в PBS. После окрашивания препараты заключали в раствор пропилгаллата в 90%-ном глицерине, препятствующий выгоранию флуоресценции.

Исследование митохондриальной сети. Окрашивание митохондрий произ водили на живых клетках. Клетки линий HeLa и VH-10 выращивались на покров ных стеклах в чашках Петри. Митохондрии окрашивали коммерческими красителями MitoTracker Orange CM-H2TMRos и MitoTracker Green FM (Molecular Probes, USA), которые флюоресцировали лишь при попадании в митохондрию. Краситель инкубиро вали c культурой клеток в концентрациях Orange 100 нМ, Green 50 нМ в течение 40 мин в инкубаторе, затем отмывали чистой культуральной средой. После окрашива ния препараты заключали в раствор пропилгаллата в 90%-ном глицерине, препятству ющий выгоранию флуоресценции. Клетки помещали в экранирующую камеру на 0,5, и 3 ч, вне камеры находились контрольные клеточные культуры, экспозиция проводи лась в термостате при 37 С и предварительно прогретой камере. Через заданные проме жутки времени экспериментальные и контрольные клетки прижизненно окрашивались MitoTracker Orange CM-H2 TMRos и MitoTracker Green. Визуально подсчитывалось количество клеток с реорганизующейся митохондриальной сетью в 10 полях зрения на каждый препарат при сравнительно одинаковой плотности посева. Составлялись таблицы зависимости количества клеток от времени экспозиции в камере.

Обработка H2 O2. Клетки обрабатывались H2 O2 в концентрации 500 мкM в тече ние 1 ч перед окрашиванием в стандартных условиях культивирования.

Результаты исследования и их обсуждения Лабораторные животные. Проведенные опыты показали, что динамика изме нения регистрируемых параметров у гипертензивных и нормотензивных крыс под воз действием компенсационного поля направлена в противоположные стороны. У нормо тензивных животных наблюдалось повышение уровня артериального давления (со до 163 мм рт. ст.) с последующим медленным снижением до исходного уровня. Парал лельно (а возможно, упреждающе) наблюдалось увеличение частоты сердечных сокра щений. И если уровень артериального давления через 100–110 мин восстанавливался до исходного уровня, то частота сердечных сокращений оставалась высокой.

В таких же условиях у гипертензивной крысы (линия SHR) уровень артериально го давления под воздействием компенсационного поля монотонно снижался (со 165 до 137 мм рт. ст.). Одновременно наблюдался рост частоты сердечных сокращений. Мо мент выключения компенсационного поля сопровождался развитием аритмии и резким снижением артериального давления. В течение последующих 100–120 мин регистриру емые параметры восстанавливались до исходного уровня.

Однако данные отклонения были нерегулярными и плохо воспроизводимыми в раз личных сериях опыта. Вероятно, это связано с тем, что ответ целого организма являет ся комплексным, и различные его системы взаимно компенсируют стрессорное воздей ствие с целью сохранения общего гомеостаза. Таким образом, выделить мишень дей ствия поля на организменном уровне достаточно сложно. Это стало причиной поиска более просто организованной модели, которой, например, является клеточная культура.

Клеточные культуры. Клеточные культуры сейчас основная модель для ис следований действия различных факторов на биологические объекты.

К настоящему времени сформулировано достаточно подробное представление об ак тивации и взаимодействии различных сигнальных путей клетки в ответ на стрессорные условия. Наиболее полно изучены клеточные реакции на повреждение ДНК.

Большинство повреждений ДНК не являются результатом только ошибок репли кации. Множество повреждений возникает в любое время клеточного цикла под дей ствием как экзогенных, так и эндогенных факторов. Так, ультрафиолетовые лучи вы зывают образование пиримидиновых димеров, 6,4-фотопродуктов, аддуктов, разрывов и прочие повреждения ДНК. Под действием химических агентов происходят разного рода модификации нуклеотидов, возникают межнитевые сшивки, конформационные дефекты [22].

Наиболее подробно изучены эффекты действия ионизирующего рентгеновского из лучения [1, 2], в результате которого в молекуле ДНК возникают двунитевые разрывы [23, 24]. Они могут приводить к клеточной гибели или стабильным хромосомным пере стройкам [25–27], что и является главной причиной летального и мутагенного действия ионизирующей радиации. Появление в ДНК двунитевых разрывов запускает каскад внутриклеточных реакций, опосредуемых различными сигнальными путями, и приво дит к развитию глобального клеточного ответа на повреждение, включающего актива цию специфических чекпойнтов, возникающих в ответ на повреждение ДНК. Следстви ем этого являются возможная остановка клеточного цикла, усиление репарационных процессов и изменение конформации хроматина [1, 25–27].

Известно, что любое клеточное изменение требует энергетических ресурсов. Источ ником АТФ в клетке являются митохондрии, которые в нормально пролифирирующих клетках культуры образуют сеть, выполняющую интегрирующую функцию в энер гетической системе клетки. Показано [19], что структура митохондриальной сети яв ляется крайне пластичной и способна к реорганизации в ответ на действие поврежда ющих агентов. В качестве модели мы исследовали два типа клеток нормальные и опухолевые, поскольку ответ этих типов клеток на повреждение может различаться.

В качестве маркеров реакции клетки на стрессорные воздействия был выбран белок Р-53, так как он является основным белком, вовлеченным в процессы поддержания клеточной стабильности, появление которого в фосфорилированной форме может слу жить маркером запуска глобального клеточного ответа на повреждение ДНК [16–18] и состояние митохондриальной сети исследуемых клеток.

Изучение влияния гипогеомагнитных условий на культуры клеток HeLa и VH- проводили в два этапа. Первым шагом было определение присутствия белка Р-53 в детектируемых количествах. Через 1 ч после экспозиции клеток в экранированных геомагнитных условиях, как в клетках линии HeLa, так и VH-10, в ядрах выявляет ся яркое специфическое зеленое свечение, соответствующее появлению детектируемых Рис. 1. Выявление белка Р-53 в клетках культуры VH-10:

A свечение Р-53 в ядрах клеток, экспонированных в течение 1 ч в условиях экранирования;

Б отсутствие свечения в клетках контроля Рис. 2. Выявление митохондриальной сети интерколирующим красителем MitoTracker Green FM Клеточная культуры VH-10. A контроль: упорядоченная, регулярная митохондриальная сеть;

состояние митохондриальной сети после трехчасовой экспозиции в условиях экранирования Б Рис. 3. Среднее количество клеток в культуре (в процентах) с реорганизованной митохондриальной се тью после 0,5, 1 и 3 ч экспозиции в гипомагнитных условиях Темные столбцы опыт, светлые контроль данных методом количеств белка Р-53 (рис. 1). Это свидетельствует о стабилизации белка Р-53 в ядре клетки и показывает, что Р-53 и опосредуемые им сигнальные пути активно вовлечены в адаптацию клетки к условиям уменьшения геомагнитного поля.

Наблюдаемый эффект на обеих клеточных линиях был одинаков, но в дальнейшем мы продолжим работу на первичных фибробластах VH-10, так как эти клетки крупнее и результаты более наглядны.

Следующим этапом было выявление состояния митохондриальной сети в контроле и после различных экспозиций в условиях экранированного геомагнитного поля. Во всех клетках, экспонированных на 1 и 3 ч в условиях экранирования, наблюдалась реорганизация митохондриальной сети, которая в норме упорядочена и располагается преимущественно вокруг ядра (см. рис. 1;

2). Уже через час после помещения клеток в измененные условия, митохондриальная сеть распадалась, образуя как одиночные скопления, так и крупные нерегулярные конгломераты в цитоплазме клетки (рис. 1, А;

2, Б). Количество клеток с такой реорганизованной сетью росло с увеличением времени экспозиции (рис. 3). Следует отметить, что и в контрольной группе также встречались клетки с нерегулярной митохондриальной сетью, но их число не велико.

Выводы 1. В условиях экранированного геомагнитного поля на клетках линии HeLa и VH- показано, что белок Р-53 и опосредуемые им сигнальные пути активно вовлечены в адаптацию клетки к условиям гипогеомагнитного поля.

2. Обнаруженный эффект по исследованным параметрам оказался сходным с кле точным ответом на повреждение ДНК.

Авторы выражают глубокую признательность за сотрудничество и помощь сотруд никам лаборатории экспериментальной физиологии и фармакологии Федерального центра сердца, крови и эндокринологии им. В. А. Алмазова и коллегам из Института конструкционных материалов Прометей.

Литература 1. Belyaev Ya. I., Harms-Ringdahl M. Eects of gamma-rays in the 0,5–50 cGy range on the conformation of chromatin in mammalian cells // Radiat. Res. 1996. Vol. 145. P. 687–693.

2. Heussen C., Nackerdien Z., Smit B. J., Bohm L. Irradiation damage in chromatin isolated from V-79 Chinese hamster lung broblasts // Radia. Res. 1987. Vol. 110. P. 84–94.

3. Polk C. Biological eects of low-level low-frequency electric and magnetic elds // IEEE Trans. on Educ. 1991. Vol. 34. P. 243–249.

4. Berg H., Zhang L. Electrostimulation in cell biology by low-frequency electromagnetic elds // Electro-Magnetobiol. 1993. Vol. 12. P. 147–163.

5. Smith S. D., McLeod B. R., Libo A. R. Calcium cyclotron resonance and diatom mobility // Bioelectromagnetics. 1987. Vol. 8. P. 215–227.

6. Lednev V. V. Possible mechanism for the inuence of weak magnetic elds on biological systems // Bioelectromagnetics. 1991. Vol. 12. P. 71–75.

7. Blanchard J. P., Blackman C. F. Clarication and application of an ion parametric resonance model for magnetic eld interactions with biological systems // Bioelectromagnetics. 1994. Vol. 15.

P. 217–238.

8. Libo A. R., McLeod B. R., Smith S. D. Resonance transport in membranes, in electromag netics in biology and medicine // Ed. by C. T. Brighton, S. R. Pollack. San Francisco: San Francisco Press, 1991. P. 67–77.

9. Binhi V. N. Interference of ion quantum states within a protein explains weak magnetic eld’s eect on biosystems // Electro-Magnetobiol. 1997. Vol. 16. P. 203–214.

10. Brocklehurst B., McLauchlan K. A. Free radical mechanism for the eects of environmental electromagnetic elds on biological system // Int. J. Radiat. Biol. 1996. Vol. 69. P. 3–24.

11. Бинги В. Н., Савин А. В. Физические проблемы действия слабых магнитных полей на биологические системы // УФН. 2003. Т. 173, № 3. С. 265–300.

12. Binhi V. N. Nuclear spins in primary mechanisms of biomagnetic eects // Biophysics. 1995.

Vol. 40. P. 677–691.

13. Prato F. S., Carson J. J. L., Ossenkopp K. P., Kavaliers M. Possible mechanism by which extremely low frequency magnetic elds aect opioid function // FASEB J. 1995. Vol. 9. P. 807–814.

14. Lacy-Hulbert A., Wilkins R. C., Hesketh T. R., Metcalfe J. C. No eect of 60 Hz electromag netic elds on myc or P-actin expression in human leukemic cells // Radiat. Res. 1995. Vol. 144.

P. 9–17.

15. Siegel R. M., Lenardo M. J. Apoptosis signaling pathways // Curr. Prot. Immun. 2002.

Vol. 11. P. 9.

16. Kim S. T., Kastan M. B. Involvement of the cohesin protein Sms1 in ATM-dependent and independent response to DNA damage // Genes Dev. 2002. Vol. 16. P. 560–570.

17. Lane D. The p53 pathway // Genome Inform. 2007. Vol. 19. P. 194.

18. Kuribayashi K., El-Deiry W. S. Regulation of programmed cell death by the p53 pathway // Adv. Exp. Med. Biol. 2008. Vol. 615. P. 201–211.

19. Bernard G., Bellance N., James D. Mitochondrial bioenergetics and structural network organization // J. Cell Science. 2007. Vol. 120, N 5. P. 838–848.

20. Kolman A., Bohusov T., Lambert B., Simons J. W. Induction of 6-thioguanine-resistant a mutants in human diploid broblasts in vitro with ethylene oxide // Envir. Molec. Mutagen. 1992.

Vol. 19, N 2. P. 93–97.

21. Nygren P., Fridborg H., Csoka K., Sundstrm C. et al. Detection of tumor-specic cytotoxic o drug activity in vitro using the uorometric microculture cytotoxicity assay and primary cultures of tumor cells from patients // Int. J. Cancer. 1994. Vol. 56, N 5. P. 715–720.

22. Sti T., O’Driscoll M., Rief N., Iwabuchi K. et al. ATM and DNA-PK function redundantly to phosphorylate H2AX after exposure to ionizing radiation // Cancer Res. J. 2004. Vol. 64, N 7.

P. 2390–2396.

23. Chovanec. M., Naslund M., Spivak I. et al. Rejoing of DNA strand breaks induced by propylene oxide and epichlorohydrin in human diploid broblasts // Envir. Molec. Mutagen. 1998.

Vol. 32. P. 223–228.

24. Huang L., Shyder A. R., Morgan W. F. Radiation-induced genomic instability and its impli cations for radiation carcinogenesis // Oncogene. 2003. Vol. 22, N 37. P. 5848–5854.

25. Fei P., El-Deiry J. P53 and radiation responses // Oncogene. 2003. Vol. 22, N 37. P. 5774– 5783.

26. Zhou B.-B., Bartek J. Targeting the checkpoint kinases: chemosensitization versus chemo protection // Nature Reviews Cancer. 2004. Vol. 4. P. 216–225.

27. Iliakis G., Wang Y., Guan J., Wang H. DNA damage checkpoint control in cells exposed to ionizing radiation // Oncogene. 2003. Vol. 22, N 37. P. 5834–5847.

Статья поступила в редакцию 28 июня 2010 г.

УДК 578.22HIV:612.017.12 Вестник СПбГУ. Сер. 3. 2010. Вып. Е. В. Ворожцова, И. В. Духовлинов, Н. А. Климов, А. П. Козлов УСИЛЕНИЕ ИММУНОГЕННОСТИ ПЛАЗМИДНОЙ ДНК, ЭКСПРЕССИРУЮЩЕЙ БЕЛОК GAG ВИРУСА ИММУНОДЕФИЦИТА ЧЕЛОВЕКА, ПРИ КО-ТРАНСФЕКЦИИ ПЛАЗМИДОЙ, НЕСУЩЕЙ ГЕН ДЕФЕНСИНА- Введение В настоящее время эпидемия синдрома приобретенного иммунодефицита (СПИД), заболевания, вызываемого вирусом иммунодефицита человека, выросла до масштаба пандемии. Задача создания профилактической вакцины против данного вируса до сих пор не решена.

Белок Gag вируса иммунодефицита человека синтезируется в виде белка-предше ственника (р55), распадающегося при сборке вирусной частицы на ряд зрелых бел ков р17, р24, р7/9, р6, р2, р1. В белках, кодируемых геном gag, содержатся участки c относительно консервативными последовательностями аминокислот, в которых также картировано большое число В- и Т-клеточных иммуногенных эпитопов, представля емых многими аллелями HLAI и HLAII человека и мыши [1–3]. Поэтому белок Gag рассматривается в качестве перспективного иммуногена для создания вакцины против ВИЧ.

ДНК-иммунизация заключается во введении в организм рекомбинантных плазмид ных ДНК, обеспечивающих внутриклеточный синтез целевых белков-иммуногенов [4].

Синтез белков-иммуногенов при ДНК-иммунизации может продолжаться длительное время, до двух месяцев, индуцируя гуморальный и клеточный иммунный ответ. Однако для внедрения ДНК-иммунизации в практику здравоохранения необходимо повысить иммуногенность плазмидных ДНК, что должно привести как к снижению дозы ДНК, так и к уменьшению числа иммунизаций. Показано, что иммуногенность плазмидных ДНК можно повысить путем введения вместе с ДНК-иммуногеном хемакинов, усилива ющих иммунный ответ [5–9]. К числу хемакинов, обладающих иммуномодулирующим действием, в частности, относится дефенсин-2 [5, 6, 8]. Представляется перспектив ным использовать в качестве иммуномодулятора для ДНК-вакцинации дефенсин-2, например, путем введения в организм двух плазмидных ДНК, одна из которых экс прессирует целевой белок-иммуноген, а другая дефенсин-2. В данной работе изу чен иммунный ответ мышей на введение плазмиды, синтезирующей белок Gag ВИЧ- (рВМСgagA(Hum)), при совместном введении с плазмидой-помощницей, экспрессиру ющей дефенсин-2 (рВМСdef-2).

Материалы и методы исследования Плазмиды. Плазмида pBMC, созданная в Биомедицинском центре [10], содержит следующие регуляторные элементы: промотор предранних белков цитомегаловируса, сайт полиаденилирования и терминации транскрипции гормона роста быка и репли катор ColE1. На рис. 1 представлена последовательность нуклеотидов синтетическеого гена gagА(Hum).

c Е. В. Ворожцова, И. В. Духовлинов, Н. А. Климов, А. П. Козлов, CTCGAGATGGGCGCCCGCGCCAGCGTGCTGAGCGGCGGCAAGCTGGACGC CTGGGAGAAGATCCGCCTGCGCCCCGGCGGCAAGAAGAAGTACCGCATCA AGCACCTGGTGTGGGCCAGCCGCGAGCTGGAGCGCTTCGCCCTGAACCCC AGCCTGCTGGAGACCAGCGAGGGCTGCCAGCAGATCCTGGAGCAGCTGCA GCCCACCCTGAAGACCGGCAGCGAGGAGGTGAAGAGCCTGTACAACACCG TGGCCACCCTGTACTGCGTGCACCAGCGCATCGAGATCAAGGACACCAAG GAGGCCTTGGACAAGATCGAGGAGATCCAGAACGAGAACAAGCAGAAGAC CCAGCAGGCCACCGGCACCGGCAGCAGCAGCAAGGTCAGTCAGAACTACC CCATCGTGCAGAACGCCCAGGGCCAGATGACCCACCAGTCCATGAGCCCC CGCACCCTGAACGCCTGGGTGAAGGTGATCGAGGAGAAGGCCTTCAGCCC CGAGGTGATCCCCATGTTCAGCGCCTTGAGCGAGGGCGCCACCCCCCAGG ACAGCAACATGATGCTGAACATCGTGGGCGGCCACCAGGCCGCCATGCAG ATGTTGAAGGACACCATCAACGAGGAGGCCGCCGAGTGGGACCGCCTGCA CCCCGCCCAGGCCGGCCCCTTCCCCCCCGGCCAGATGCGCGAGCCCCGCG GCAGTGACATCGCCGGCACCACCAGTACCCTGCAGGAGCAGATCGGCTGG ATGACCAGCAACCCCCCCATCCCCGTGGGCGACATCTACAAGCGCTGGAT CATCCTGGGCCTGAACAAGATCGTGCGCATGTACAGCCCCGTGAGCATCC TGGACATCCGCCAGGGCCCCAAGGAGCCCTTCCGCGACTACGTGGACCGC TTCTTCAAGACCCTGCGCGCCGAGCAGGCCACCCAGGAGGTGAAGAACTG GATGACCGAGACCCTGCTGGTCCAGAACGCCGACCCCGACTGCAAGGCCA TCCTGCGCGCCCTGGGCCCCGGCGCCACCCTGGAGGAGATGATGACCGCC TGCCAGGGCGTGGGCGGCCCCGGCCACAAGGCCCGCGTGTTGGCCGAGGC CATGAGTCAGGTGCAGAACGCCAACATCATGATGCAGAAGAGTAACTTCC GCGGCCCCAAGCGCATCAAGTGCTTCAACTGCGGCAAGGAGGGCCACCTG GCCCGCAACTGCCGCGCCCCCCGCAAGAAGGGCTGCTGGAAGTGCGGCAA GGAGGGCCACCAGATGAAGAACTGCACCGAGCGCCAGGCCAACTTCCTGG GCCGCATCTGGCCCTCCAGCAAGGGCCGCCCCGGCAACTTCCCCCAGAGC CGCCCCGAGCCCAGCGCCCCCCCCGCCGAGGACTTCGGCCGCGGCGAGGA GATCACCCCCCCCCTGAAGCAGGAGCAGAAGGACCGCGAGCAGCACCCCC CCAGCATCTCCCTGAAGAGCCTGTTCGGCAACGACCCCTTGAGCCAGTAA GAATTC Рис. 1. Последовательность нуклеотидов синтетическеого гена gagА(Hum) Добавленные сайты для рестрицирующих эндонуклеаз EcoRI (GAATTC) и XhoI (CTCGAG) выделены жирным шрифтом Синтез гуманизированного гена белка Gag. Ген, кодирующий белок Gag ви руса иммунодефицита человека 1-го типа субтипа А (ВИЧ-1(А)), был получен методом химического синтеза по последовательности, приведенной на рис. 1.

Выделение и стимуляция перитонеальных макрофагов мыши. Перитоне альные макрофаги мышей были получены путем промывания брюшной полости жи вотных 0,34 М стерильным раствором сахарозы (по 4 мл на мышь). Клетки осаждали центрифугированием, ресуспендировали в среде RPMI-1640, содержавшей 10% эмбри ональной сыворотки теленка, и инкубировали при 37 С и 5% СО2 в течение суток.

Кроме того, клетки стимулировали добавлением липополисахарида из Esсherichia coli (LPS) до конечной концентрации 10 нг/мл с последующей инкубацией при 37 С и 5% СО2 в течение суток.

Получение РНК и кДНК. Выделение РНК из стимулированных макрофагов осуществляли, используя набор TRI Reagent (Sigma, USA), по методике изготовителя.

Синтез кДНК проводили с помощью набора Revert Aid First Strand cDNA Synthesis Kit (Fermentas).

Получение кДНК дефенсина-2. Амплификацию кДНК дефенсина-2 про водили методом полимеразной цепной реакции (ПЦР) в 50 мкл буфера: 10 мМ Трис-HCl рН 8,3, 1,25 мМ MgCl2, 50 мМ KCl, 200 мкМ каждого из дНТФ, 20 пМ каждого из праймеров, 200 нг ДНК и 1 ед. полимеразы Pfu (Fermentas, Литва).

Использовали праймеры: def-For 5 -TTTCTСGAGTTCGCAACAGGGGTTCTTC-3 и def-Rev 5 -ACCATGGAATTСGACCACTGCCACACC-3. В последовательности прайме ров были введены сайты для рестрицирующих эндонуклеаз EcoRI (GAATTC) и XhoI (CTCGAG), по которым затем осуществляли клонирование в экспрессионный вектор pBMC. Отсутствие мутаций и правильность сборки проверяли секвенированием по Сэн геру.

Бактериальные штаммы. Для проведения генно-инженерных работ использо вали клетки E. coli DH10B/R (Gibko BRL, США) с генотипом F-mcrA (mrr-hsdRMS mcrBC) 80dlacZM 15 lacX74 deoR recA1 endA1 araD139 (ara,leu)769 galU galK rpsL nupG.

Эукариотические клеточные линии. Изучение экспрессии белков проводили в клетках эпителия почки эмбриона человека 293Т.

Иммуноблоттинг. После электрофореза белков в ПААГ [12] перенос проводи ли по методу Вестерн-блота [13]. Для обнаружения рекомбинантного белка дефенсин 2-FLAG блоты инкубировали с антисывороткой к пептиду FLAG (Sigma, США), для обнаружения белка Gag инкубацию проводили сывороткой ВИЧ-инфицирован ного пациента, разведенной в 200 раз. Для обнаружения рекомбинантного белка, со держащего петид Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys (FLAG), использовали антитела производства фирмы Сигма. В качестве вторых антител использовали белок А, ко ньюгированный с пероксидазой хрена (CибЭнзим, Россия). После промывки блота в ФСБ-твин с 0,1%-ным обезжиренным молоком, его помещали в раствор субстрата (3,3 -диаминобензидин, 0,06% Н2 О2 ) на 5 мин. Реакцию останавливали, промывая блот водой. Проявленный блот высушивали и сканировали.


Трансформация клеток. Клетки линии 293Т и клетки E. сoli трансформировали с помощью методов, описанных в руководстве из работы [13].

Иммунизация лабораторных животных. Самок мышей линии BALB/c 9– 12-недельного возраста иммунизировали введением в четырехглавую мышцу бедра 100 мкг плазмидной ДНК рВМСgagA в 100 мкл физиологического раствора. Для иммунизации двумя плазмидными ДНК использовали 100 мкг рВМСgagA и 100 мкг рВМCdef-2 в общем объеме 100 мкл. Раствор двух плазмидных ДНК вводили в одном шприце. Повторную иммунизацию проводили на 4-й неделе. Титр антител анализи ровали на 2-й и 6-й неделях. В опыте по обнаружению белка р24 в сыворотке крови иммунизированных мышей плазмидные ДНК вводились трехкратно на 1, 4 и 8-й неделях.

Использовали диагностический набор Иммуноферментный анализ.

ВектоВИЧ-1 антиген р24 (Вектор-Бест, Россия), предназначенный для определения концентрации белка р24 (одного из конечных продуктов созревания белка р55 Gag) в сыворотке крови человека. Калибровочную кривую строили по стандартам р24, имею щимся в наборе, концентрацию белка р55 рассчитывали, исходя из соотношения моле кулярных весов белков р55 и р24, равного 2,29:1.

Статистический анализ результатов иммунизаций. При измерении тит ра антител и концентраций белка оценивали стандартное отклонение по выборке. Рас чет величины стандартного отклонения осуществляли по формуле (xi x) s=, n где n объем выборки, x среднее арифметическое число [14].

Результаты исследования и их обсуждение Молекулярный дизайн синтетического гена gagA(Hum) и получение экс прессионной плазмиды pBMCgagA(Hum). Дизайн синтетического гена, кодирую щего белок Gag ВИЧ-1 субтипа А, произвели, применяя кодоны с максимально высоким содержанием G и C, используемых в интенсивно экспрессируемых генах человека и мле копитающих, поскольку применение кодонов в природных генах ВИЧ-1 не является оп тимальным для достижения высокого уровня синтеза белков [15]. Последовательность синтетического гена gag(A)Hum, основанная на последовательности аминокислот, по лученной в результате секвенирования геномов вирусов, циркулирующих в России и странах Ближнего зарубежья [16], представлена на рис. 1. По сравнению с природным геном, в гене gagА(Hum) были произведены замены 329 А и Т на G и C с получением синонимических G,C-богатых кодонов. Ген gagА(Hum) был по сайтам рестрикции XhoI и EcoRI вставлен в плазмиду рВМС с получением экспрессионной плазмиды рВМС gagA(Hum) (рис. 2).

Клонирование кДНК дефенсина-2 мыши. Для получения кДНК де фенсина-2 выделили РНК из стимулированных перитонеальных макрофагов мыши, на которой была поставлена реакция обратной транскрипции. Далее на матрице полу ченной кДНК амплифицировали последовательность дефенсина-2. Секвенирование показало, что полученная последовательность кДНК идентична последовательности дефенсина-2 мыши, имеющейся в базе данных GanBank (рис. 3). Далее кДНК де фенсина-2 была клонирована по сайтам рестрикции XhoI и EcoRI в вектор рВМС (см. рис. 2). Для детекции синтеза дефенсина-2 с помощью иммуноблота был синте зирован искусственный ген, кодирующий рекомбинантный белок дефенсин-2-FLAG.

FLAG представляет собой иммуногенный пептид Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys, с которым связываются специфические моноклональные антитела [11]. Для создания та кого гена в праймер def-Rev была введена последовательность из 24 нуклеотидов, коди рующая FLAG. Амплифицированную с использованием данного удлиненного праймера последовательность клонировали по сайтам EcoRI и XhoI в вектор рВМС.

Обнаружение рекомбинантных белков Gag и дефенсина-2 в лизатах клеток 293, трансформированных плазмидными ДНК pBMCgagA(Hum) и pBMCdef-2. При электрофорезе белков лизатов клеток 293Т, трансформированных Рис. 2. Карта плазмиды pBMCdef-2-FLAG (А) и карта плаз миды pBMCgagA(Hum) (Б) Amp r ген устойчивости к ампициллину;

prCMV промотор предранних белков цитомегалоивируса;

BGHpA сайт полиаденили рования и терминации транскрипции;

ori репликатор;

BbvII, EcoRI, XhoI сайты узнавания рестриктаз;

GagA(Hum) последовательность гена gagA(Hum);

Def-2 последовательность, кодирующая дефенсин- мыши;

FLAG последовательность, кодирующая пептид FLAG CTCGAGATGA GGACTCTCTG CTCTCTGCTG CTGATCTGCT GCCTGCTGTT CTCCTACACC ACCCCCGCCG TGGGCAGCTT AAAGAGCATT GGCTACGAGG CCGAGCTGGA CCACTGCCAC ACCAACGGCG GCTACTGCGT GAGGGCCATT TGCCCCCCCT CCGCCAGGCG CCCCGGCAGC TGCTTCCCAG AGAAGAACCC CTGTTGCAAG TACATGAAAT GAGAATTC Рис. 3. Последовательность нуклеотидов кДНК дефенси на- Добавленные сайты для рестрицирующих эндонуклеаз EcoRI (GAATTC) и XhoI (CTCGAG) выделены жирным шрифтом плазмидной ДНК pBMCgagA(Hum) обнаружена белковая фракция с молекулярным весом 55 кДа, связывающаяся в иммуноблоте с сывороткой крови ВИЧ-инфицирован ного пациента и отсутствующая в лизатах клеток, трансформированных плазмидной ДНК рВМС, что указывает на синтез в трансформированных pBMCgagA(Hum), клет ках белка Gag р55 (рис. 4). В лизатах клеток 293Т, трансформированных плазмидной ДНК pBMCdef-2, обнаружена белковая фракция с молекулярным весом 4,6 кДа, свя зывающаяся с антителами к пептиду FLAG (рис. 5), что указывает на синтез реком бинантного белка дефенсин-2-бета-FLAG. Для дальнейших экспериментов участок, ко дирующий пептид FLAG, был удален путем амплификации кДНК дефенсина-2 бета с праймерами def-For и def-Rev и нового клонирования полученного продукта в вектор рВМС.

Обнаружение рекомбинантного белка Gag в сыворотках крови мышей после внутримышечного введения плазмидной ДНК рВМСgagA(Hum). Кон центрация белка Gag в сыворотках крови мышей, трехкратно иммунизированных плаз мидой pBMCgagA(Hum), определялась путем измерения концентрации антигена р24 с помощью иммуноферментного анализа (таблица). Максимальная концентрация анти гена р24 в сыворотках крови мышей наступала на 9-й неделе и оказалась равной 4 пг р24/мл, что в перерасчете на белок р55 составило 9,16 пг/мл.

Рис. 4. Экспрессия слитого белка дефенсин-2 FLAG в трансформированных клетках 293Т:

1 белковый маркер (Sigma, США);

2 лизат клеток, трансформированных плазмидой pBMC;

3 лизат клеток, трансформированных плазмидой pBMCdef-FLAG Рис. 5. Экспрессия белка Gag в транс формированных клетках 293Т:

1 клетки, трансформированные плаз мидой pBMCgag(Hum) разведение 1:25;

2 клетки, трансформированные плазми дой pBMCgag(Hum) разведение 1:5;

клетки, трансформированные плазмидой pBMCgag(Hum) разведение 1:1;

4 белковый маркер (Sigma) Накопление экстраклеточного белка р55 Gag в сыворотках крови мышей BALB/c Концентрация белка Gag в сыворотках крови иммунизированных мышей Срок Число введений Концентрация Концентрация белка Gag после первого введения плазмидной ДНК антигена р24 в сыворотке крови плазмидной ДНК, до забора крови в сыворотке крови, в пересчете на белок р55, дни пг/мл пг/мл 42 2 4,58 ± 1, 2 ± 0, 63 3 9,16 ± 2, 4 ± 1, 70 3 4,58 ± 1, 2 ± 0, П р и м е ч а н и е. Плазмидную ДНК рВМСgagA(Hum) в дозе 100 мкг/мышь вводили внутримы шечно в 1, 28 и 56-й дни.

Уровень гуморального иммунного ответа, возникающий у мышей после иммунизации плазмидой pBMCgagA или после совместной иммунизации плазмидами pBMCgagА и pBMCdef-2. У животных, иммунизированных плаз мидой pBMCgagA, на 6-й неделе титр антител к р24 составил всего 1:10 (рис. 6). Однако совместная иммунизация двумя плазмидными ДНК, pBMCgagA и pBMCdef-2 вызы вает формирование более сильного гуморального иммунного ответа, чем иммунизация только плазмидой pBMCgagA. Так, после двукратной иммунизации двумя плазмида Рис. 6. Уровень гуморального иммунного ответа у мы шей после иммунизации плазмидой pBMCGagA и совмест ной иммунизации плазмидами pBMCGagА и pBMCdef ДНК-иммунизацию производили в 1-ю и 4-ю недели ми на 6-й неделе титр антител к белку р24 превысил 1:1000 (см. рис. 6). Таким обра зом, совместная иммунизация двумя экспрессионными плазмидными ДНК способству ет увеличению титра антител к белку р24 в сыворотке крови лабораторных животных в 100 раз.

Заключение Внутримышечное введение мышам плазмиды, экспрессирующей белок Gag, приво дит к появлению данного белка в сыворотке крови. Белок Gag не имеет сигнального пептида, вследствие чего он неспособен к секреции из эукариотических клеток [17].

Однако известно, что Gag участвует во взаимодействии незрелой вирусной частицы с клеточной мембраной и направляет выход вирусных частиц в экстраклеточное про странство с помощью процесса, называемого выпочковыванием (budding) [17–19].

Возможно, что белок Gag, синтезируемый трансформированными клетками, также мо жет самостоятельно выходить из них с помощью подобного неканонического процесса.

В таком случае большая часть белка Gag будет находиться в экстраклеточном про странстве и в крови, индуцируя В-клеточный (гуморальный) иммунный ответ против данного вирусного белка.

Значительное увеличение титров антител к белку Gag при совместном внутримы шечном введении двух плазмидных ДНК, экспрессирующих Gag и дефенсин-2, может быть объяснено следующим образом.

Известно, что -дефенсины являются хемоаттрактантами для клеток, экспрессиру ющих рецептор CCR6, включая незрелые дендритные клетки и CD8+ Т-лимфоциты [5, 8]. Незрелые дендритные клетки способны эффективно захватывать антиген, после чего в них начинается активное образование комплексов пептид-МНСII, которые обра зуются в значительном количестве благодаря наличию большего числа МНСII-богатых компартментов (МIIСs). При последующем созревании дендритных клеток МIIСs пре вращаются в нелизосомальные везикулы, в которых и происходит транспортировка комплексов МНСII-пептид к поверхности клетки. В результате значительно повыша ется эффективность презентации иммуногенных эпитопов чужеродных белков [5]. При совместной иммунизации двумя плазмидными ДНК, возможно, дефенсин-2 вызыва ет аттрактацию иммунокомпетентных клеток, главным образом незрелых дендритных клеток, к месту инъекции, в котором происходит также синтез белка Gag. В результате эффективная презентация иммуногенных эпитопов белка Gag дендритными клетками вызывает усиление продукции антител к данному белку.


Подобный эффект усиления действия ДНК-иммуногена можно использовать для усиления эффективности ДНК-вакцин, обеспечивающих защиту человека и животных от многих патогенов. По-видимому, иммунизацию животного плазмидной ДНК, экс прессирующей целевой белок, совместно с плазмидой, экспрессирующей дефенсин-2, можно использовать для получения иммунной сыворотки и поликлональных антител к любому экстраклеточному белку без его предварительной очистки, если выделена и помещена в экспрессионную плазмиду кДНК данного белка. Такой способ может быть полезен, например, для получения антител к белкам, содержащимся в природных ис точниках в очень небольших концентрациях, в том числе для получения антител к гипотетическим белкам, экспрессию которых при различных патологических состоя ниях можно предположить на основании транскриптомного анализа.

Литература 1. Betts M. R., Yusim K., Koup R. A. Optimal antigens for HIV vaccines based on CD8+T-res ponse, protein length, and sequence variability // DNA and Cell Biology. 2002. Vol. 21, N 9. P. 665– 670.

2. Appay V., Papagno L., Spino CA. et al. Dynamics of T-cell responces in HIV infection // Journal of Immunology. 2002. Vol. 168, N 7. P. 3660–3666.

3. Kaul R., Rowland-Jones S. L., Kimani J. et al. New insights into HIV-1 specic cytotoxic T-lymphocyte responses in exposed, persistently seronegative Kenyan sex workers // Immunology Letters. 2001. Vol. 79, N 1–2. P. 3–13.

4. Curunathan S., Chang-Yu Wu, Freilag B. L. et al. DNA vaccines: a key for inducing long term cellular immunity // Current opinion in immunology. 2000. Vol. 12. P. 442–447.

5. Sozzani S., Allavena P., Vecchi A. et al. Chemokines and dendritic cell trac // Journal of Clinical Immunology. 2000. Vol. 20, N 3. P. 151– 6. De Smet K., Contreras R. Human antimicrobial peptides: defensins, cathelicidins and histatins // Biotechnology Letters. 2005. Vol. 27, N 18. P. 1337–1347.

7. Chang S. Y., Lee K. C., Ko S. Y. et al. Enhanced ecacy of DNA vaccination against Her-2/neu tumor antigen by genetic adjuvants // International Journal of Cancer. 2004. Vol. 111, N 1. P. 86–95.

8. Biragyn A., Surenhu M., Yang D. et al. Mediators of innate immunity that target immature, but not mature, dendritic cells induce antitumor immunity when genetically fused with nonim munogenic tumor antigens. // Journal of Immunology. 2001. Vol. 167, N 11. P. 6644–6653.

9. Ganz T. Defensins: antimicrobial peptides of innate immunity // Nature Reviews of Im munology. 2003. N 9. P. 710–720.

10. Мурашев Б. В., Мурашева И. В., Романович А. Э. и др. Создание и изучение иммуно логических свойств ДНК-вакцины на основе гена env ВИЧ-1 // Русский журнал ВИЧ/СПИД и родственные проблемы 2000. Т. 4, № 2. С. 29–36.

11. Chubet R. G., Brizzard B. L. Vectors for expression and secretion of FLAG epitope-tagged proteins in mammalian cells // Biotachniques. 1996. Vol. 20, N 1. P. 136–141.

12. Laemmli U. K. Cleavage of structural proteins during the assembly of the head of bacterio phage T4 // Nature. 1970. Vol. 227, N 5259. P. 680–685.

13. Sambrook J., Russell D. W. Molecular cloning. New York: Cold Spring Harbour Laboratoty Press, 2001.

14. Лакин Г. Ф. Биометрия. М.: Высшая школа, 1990. 352 с.

15. Haas J., Park E., Seed B. Codon usage limitation in the expression of HIV-1 envelope glycoprotein // Curr. Biol. 1996. 6. P. 315–324.

16. Машарский А. М., Еремин В. Ф., Климов Н. А., Козлов А. П. Клонирование и анализ полноразмерного генома вариантов ВИЧ-1, доминирующих среди иньекционных наркоманов стран бывшего СССР // Русский журнал ВИЧ/СПИД и родственные проблемы. 2002. Т. 6, № 1. С. 12–20.

17. Kuiken C., Foley B., Freed E. et al. HIV sequence compendium. 2002. (URL: http:// hiv-veb.lanl.gov).

18. Ono A., Orenstein J. M., Freed E. O. Role of the Gag matrix domain in targeting human immunodeciency virus type 1 assembly // Journal of Virology. 2000. Vol. 74, N 6. P. 2855–2866.

19. Bukrinskaya A. G. HIV-1 assembly and maturation // Archiv of Virology. 2004. Vol. 149, N 6. Р. 1067–1082.

Статья поступила в редакцию 28 июня 2010 г.

УДК 616.24-002.5+615.331 Вестник СПбГУ. Сер. 3. 2010. Вып. Е. Н. Черняева, П. В. Добрынин, Н. Е. Пестова, Н. Г. Матвеева, В. Ф. Жемков, А. П. Козлов ОБНАРУЖЕНИЕ МУТАЦИЙ, АССОЦИИРОВАННЫХ С УСТОЙЧИВОСТЬЮ К ОФЛОКСАЦИНУ В ГЕНАХ GYRA И GYRB, И МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКИЙ АНАЛИЗ ОФЛОКСАЦИН-УСТОЙЧИВЫХ ИЗОЛЯТОВ M. TUBERCULOSIS, ВЫЯВЛЕННЫХ В САНКТ-ПЕТЕРБУРГЕ В 2008 г.

Введение Широкое распространение штаммов Mycobacterium tuberculosis (МБТ), обладающих множественной лекарственной устойчивостью (МЛУ), т. е. устойчивостью одновремен но к двум наиболее активно применяемым противотуберкулезным препаратам (ПТП) изониазиду и рифампицину, является серьезным препятствием в борьбе против ту беркулеза (ТБ). Штаммы M.tuberculosis с МЛУ вызывают тяжелые прогрессирующие формы заболевания, требуют длительного, дорогостоящего лечения препаратами ре зервного ряда и часто приводят к летальным исходам. По данным ВОЗ, каждый год возникает 424 тыс. новых случаев МЛУ туберкулеза. Доля случаев МЛУ ТБ варьи рует в различных странах от 0% (некоторые страны Западной Европы) до 22,3% (Баку, Азербайджан). В 2008 г. было установлено, что более 5% случаев ТБ вызывается изо лятами, обладающими МЛУ [1].

Недостаток контроля или неправильное лечение туберкулеза с МЛУ приводит к возникновению широкой лекарственной устойчивости (ШЛУ). ТБ с ШЛУ вызывается бактериями, устойчивыми как к двум препаратам первого ряда изониазиду и рифам пицину, так и к любым фторхинолонам и, по крайней мере, к одному из трех инъекцион ных препаратов второго ряда (канамицин, капреомицин или амикацин) [2]. По данным ВОЗ, в 2006 г. было обнаружено 0,5 млн новых случаев заболевания с МЛУ ТБ. Рас пространенность случаев ШЛУ среди изолятов M. tuberculosis варьирует в различных регионах. Так, в странах бывшего Советского Союза около 10% случаев МЛУ ТБ бы ли отнесены к ШЛУ ТБ. В странах Западной и Восточной Европы этот показатель варьирует от 0 до 23,7%, однако уровень распространенности штаммов МБТ с МЛУ в них значительно ниже, а случаи ШЛУ ТБ единичны [3].

Наличие устойчивости к лекарственным препаратам значительно снижает вероят ность успешного лечения, поэтому для назначения корректной терапии необходимо применять современные молекулярно-генетические методы обнаружения устойчивости M. tuberculosis к ПТП, основанные на анализе точечных мутаций. Применение этих ме тодов позволяет сократить сроки определения лекарственной устойчивости до несколь ких дней.

Фторхинолоны являются антибиотиками широкого спектра действия, активными против M. tuberculosis. Они оказывают бактерицидное действие, ингибируя актив ность микобактериальной ДНК-гиразы. ДНК-гираза является топоизомеразой типа II c Е. Н. Черняева, П. В. Добрынин, Н. Е. Пестова, Н. Г. Матвеева, В. Ф. Жемков, А. П. Козлов, (КФ 5.99.1.3.), изменяющей топологическое состояние кольцевой ДНК посредством вне сения двунитевых разрывов в молекулу ДНК и проведения сквозь них другого двуните вого сегмента [4]. В результате этого происходит снятие напряжения в суперспирализо ванной кольцевой молекуле ДНК, возникающего в репликационной вилке в результате расплетания двойной спирали ДНК в ходе репликации.

ДНК-гираза представляет собой тетрамерный белок, состоящий из субъединиц двух типов А и B, которые кодируются генами gyrA и gyrB соответственно. Изучение ме ханизмов связывания хинолонов с гиразой показало, что хинолоны обладают высокой аффинностью не к самому ферменту, а к молекулам ДНК [5]. При этом связывание пре парата происходит с одноцепочечной ДНК, которая формируется при взаимодействии с ДНК-гиразой [6–8]. Образование тройного комплекса ДНК–фермент–фторхинолон приводит к нарушению процесса репликации бактериальной ДНК и гибели клетки.

Участок фермента, в котором происходит связывание ДНК и фторхинолонов, полу чил название хинолон-связывающего кармана (quinolone-binding pocket), в форми рование которого вовлечены обе субъединицы фермента. Обнаружено, что мутации в коротких областях генов gyrA и gyrB, кодирующих субъединицы фермента, приводят к формированию устойчивости к фторхинолонам у M. tuberculosis [9]. Участки генов gyrA и gyrB, в которых происходят мутации, ассоциированные с лекарственной устой чивостью, называют регионами, определяющими устойчивость к хинолонам (QRDR quinolone resistance determining region) [4, 10].

В настоящее время проводятся работы, посвященные изучению роли мутаций, ас социированных с устойчивостью МБТ к различным ПТП. Показано, что частоты му таций, связанных с развитием лекарственной устойчивости (ЛУ) у микобактерий, раз личаются в разных популяциях. Для эффективного применения молекулярно-биоло гических методов диагностики ЛУ нужно знать частоты мутаций, связанных с ЛУ в конкретном географическом регионе.

Цель данной работы изучение мутаций в генах gyrA и gyrB, ассоциированных с устойчивостью к препарату фторхинолонового ряда офлоксацину у изолятов M. tu berculosis, а также сравнение генотипов устойчивых к офлоксацину штаммов M. tubercu losis со штаммами, обладающими МЛУ, и штаммами, чувствительными ко всем ПТП, выявленным в Санкт-Петербурге в 2008 г.

Методика исследования Исследование проводили с культурами M. tuberculosis, выявленными в Санкт-Петер бурге в 2008 г., обладающими устойчивостью к офлоксацину в концентрации 2 мкг/мл по данным метода абсолютных концентраций с использованием питательной среды Ле венштейна Йенсена [11].

Материалом исследования послужила геномная ДНК, полученная из чистых куль тур M. tuberculosis. Культуры 30 офлоксацин-устойчивых изолятов для генетического исследования M. tuberculosis были отобраны случайным образом. Для молекулярно генетического анализа также случайно были отобраны 30 изолятов M. tuberculosis, чув ствительных ко всем ПТП, и 41 изолят с МЛУ.

В исследование мутаций в генах gyrA и gyrB было включено 30 образцов ДНК, полученных от M. tuberculosis, обладающих устойчивостью к офлоксацину, и 3 образца, чувствительных к данному противотуберкулезному препарату.

Клинический материал и данные по устойчивости к противотуберкулезным препа ратам были предоставлены бактериологической лабораторией Городского противоту беркулезного диспансера г. Санкт-Петербурга в рамках совместного проекта.

Выделение ДНК. Геномную ДНК микобактерий выделяли методом, описанным ранее [12], предварительно инактивировав микобактерии инкубацией пробирок с МБТ, растущими на питательной среде Левенштейна Йенсена, при температуре 90 С в тече ние 1 ч. Полученную ДНК использовали для амплификации фрагментов gyrA и gyrB, в которых ранее были обнаружены мутации, ассоциированные с лекарственной устой чивостью к фторхинолонам [9, 13].

ПЦР фрагментов генов gyrA и gyrB. Полимеразную цепную реакцию (ПЦР) проводили в объеме 50 мкл в тонкостенных полипропиленовых пробирках объемом 650 мкл, содержащих 10 мM Tris-HCl (рН 8,8);

50 мМ KCl;

1,25 мМ MgCl2 ;

200 мкМ каждого из dNTP;

20 пМ каждого из праймеров и 2,5 единицы Taq-полимеразы. В ка честве матрицы использовали 50 нг геномной ДНК микобактерий. Реакционную смесь прогревали 5 мин при 95 С для денатурации матричной ДНК. Реакцию амплификации осуществляли в термоциклере Eppendorf Mastercycler Personal в течение 35 следующих циклов: 0,5 мин при 95 C;

0,5 мин при 55 C;

45 с при 72 C. По окончании 35 циклов амплификации провели дополнительную инкубацию для достройки образовавшихся цепей ДНК: 5 мин при 72 C. Полученные амплификаты хранили при 20 C. Для ПЦР использовали праймеры, описанные ранее [9].

Секвенирование фрагментов генов gyrA и gyrB. Секвенирование ДНК вы полняли ферментативным методом по Сэнгеру с помощью набора DYEnamic ET Dye Terminator Cycle Sequencing Kit (GE Healthcare) по прилагающимся к нему инструк циям, применяя автоматический секвенатор MegaBACE 500 (GE Healthcare). Для се квенирования использовали немеченые специфические праймеры, использованные для ПЦР. Секвенирование ДНК проводили с обеих сторон ПЦР-продукта для всех ампли фицированных фрагментов генов gyrA и gyrB. Полученные в результате секвенирова ния нуклеотидные последовательности выравнивали для обнаружения мутаций в изу чаемых генах.

Анализ полученных данных проводили с помощью программы MegaBACE Sequence Analyzer v.4.0. Выравнивание и анализ хроматограмм осуществляли в программе Se quencher 4.8.

Молекулярно-генетический анализ изолятов M. tuberculosis. Молекуляр но-генетический анализ офлоксацин-устойчивых изолятов M. tuberculosis проводили методом сполиготипирования, как было описано ранее [14], применяя коммерческий набор (Isogen Life Science). Принадлежность исследуемых штаммов МБТ к извест ным семействам сполиготипов устанавливали, сравнивая их со сполиготипами, вне сенными в международную базу данных SpolDB-4. Кластерный анализ результатов генотипирования проводили, используя компьютерную программу R2.8.1. Принад лежность анализируемых сполиготипов к семействам штаммов M. tuberculosis бы ла определена путем сравнения с профилями сполиготипирования штаммов, внесен ных в международные базы данных (URL: http://cgi2.cs.rpi.edu/bennek и http:// www.pasteur-guadeloupe.fr:8081/SITVITDemo/index.jsp).

Результаты исследования и их обсуждение Результаты секвенирования ДНК показали, что 17 из 30 (56,6%) изолятов M. tuber culosis, устойчивых к офлоксацину, имели мутации в регионе QRDR гена gyrA, ассоци ированные с резистентностью к фторхинолонам, из них у 11 изолятов были мутации в 94-м кодоне, приводящие к замене D на G или A, 3 изолята имели мутацию A90V, еще 3 изолята имели замену S91P (табл. 1). У 28 из 30 офлоксацин-резистентных изолятов Таблица 1. Результаты анализа мутаций региона QRDR гена gyrA, ассоциированных с устойчивостью к фторхинолонам Мутация Число % в гене gyrA проанализированных изолятов 2 6, D94G 9 D94A 3 A90V 3 S91P Нет мутаций 13 43, была обнаружена замена S95T, являющаяся естественным полиморфизмом M. tubercu losis, не связанная с устойчивостью к противотуберкулезным препаратам.

Тринадцать (43,4%) офлоксацин-устойчивых изолятов M. tuberculosis не имели нук леотидных замен в проанализированной области гена gyrA, ассоциированных с лекар ственной устойчивостью (см. табл. 1).

Анализ фрагмента гена gyrB не обнаружил мутаций ни у одного из 30 изолятов M. tuberculosis, обладающих устойчивостью к офлоксацину.

В трех проанализированных образцах M. tuberculosis, чувствительных к офлоксаци ну, не было обнаружено замен в генах gyrA и gyrB, кроме естественного полиморфизма в кодоне 95 гена gyrA.

Результаты анализа сполиготипов M. tuberculosis, обладающих устой чивостью к офлоксацину. Сравнение сполиготипов офлоксацин-устойчи вых штаммов МБТ, штаммов, обладающих МЛУ, и штаммов, чувстви тельных ко всем ПТП. Геномная ДНК, выделенная из изолятов M. tuberculosis, об ладающих устойчивостью к офлоксацину, была использована для генетического анали за методом сполиготипирования. В результате сполиготипирования среди 30 офлокса цин-устойчивых изолятов было выявлено 7 различных сполиготипов, представленных в табл. 2. Двадцать два изолята (73,3%) имели одинаковый сполиготип ST1, относящийся к семейству M. tuberculosis Beijing.

Таблица 2. Результаты генетического анализа изолятов M. tuberculosis, обладающих устойчивостью к офлоксацину Сполиготип Код сполиготипа Количество % Семейство в восьмеричном в международной изолятов коде базе данных 000000000003371 3 10 Beijing ST 000000000003771 22 73, ST 000000000000771 1 3, ST 000000000003661 1 3, ST 775777777450771 Нет 1 3,33 T 357777777760771 1 3, 775740003760771 1 3,33 T ST Семейство M. tuberculosis Beijing было представлено четырьмя сполиготипами (к ним относилось 27 исследованных изолятов), семейство Т1 двумя сполиготипами (к ним относились 2 изолята), семейство Т3 одним сполиготипом (один изолят).

Генетический анализ изолятов M. tuberculosis с МЛУ также показал преобладание штаммов, относящихся к пекинскому семейству (более 85%), большинство из которых относилось к варианту ST1. Среди данной группы изолятов были обнаружены пред ставители семейства сполиготипов LAM9, T3, T4, 33 и 36 (табл. 3).

Таблица 3. Результаты генетического анализа изолятов M. tuberculosis, обладающих множественной лекарственной устойчивостью (МЛУ) Сполиготип Код сполиготипа Количество % Семейство в восьмеричном в международной изолятов коде базе данных 000000000003661 4 9,76 Beijing ST 000000000003671 1 2, ST 000000000003771 28 68, ST 000002000003671 Нет 1 2, 000002000003771 1 2, ST 774002000760771 Нет 1 2,44 T 777761007763771 1 2,44 T 777477607700771 1 2,44 LAM 777574200376071 1 2,44 777777607763771 1 2, ST 000000007760771 1 2,44 ST Анализ сполиготипов изолятов M. tuberculosis, чувствительных ко всем противоту беркулезным препаратам (табл. 4), также показал доминирование штаммов, принадле жащих к пекинскому семейству (Beijing family). К ним относились 18 (60%) из проана лизированных 30 изолятов. Однако разнообразие представленных сполиготипов было выше, чем в группе штаммов, устойчивых к офлоксацину, и группе штаммов с МЛУ.

Семейство Beijing было представлено семью различными сполиготипами, также были обнаружены штаммы, относящиеся к семействам Т1, Т2, 34, 35, 36, Haarlem 1 и LAM9.

Десять изолятов M. tuberculosis, принадлежащих к семейству Beijing, имели сполиготип ST1, доминирующий в группе проанализированных офлоксацин-устойчивых изолятов.

Сравнение частот обнаружения штаммов M. tuberculosis, относящихся к пекинскому семейству (тест хи-квадрат и тест Фишера на независимость) показало, что все три ис следованные группы образцов M. tuberculosis достоверно отличаются по преобладанию изолятов семейства Beijing (p = 0,013). Штаммы семейства Beijing достоверно чаще обладают МЛУ (p = 0,015) и устойчивостью к офлоксацину (p = 0,007).

Исследование генов gyrA и gyrB офлоксацин-устойчивых штаммов M. tuberculosis, распространенных в Санкт-Петербурге, показало, что анализ небольшого региона гена gyrA позволяет обнаружить, по крайней мере, половину (56,6%) случаев устойчивости к офлоксацину. В участке QRDR гена gyrA исследованные офлоксацин-устойчивые изоляты имели точечные мутации в кодонах 90, 91, 94. Самая распространенная му тация замена D на G или A в 94-м кодоне, была обнаружена у 30% исследованных изолятов. Относительно высокая вероятность формирования мутаций в 94-м кодоне гена gyrA, возможно, объясняется их оптимальным влиянием на формирование устой чивости к офлоксацину либо наименьшим негативным влиянием на функциональность продукта гена. Гены gyrA трех изолятов МБТ из нашей выборки, устойчивых к офлок сацину, несли мутацию A90V. В большинстве исследований была продемонстрирована корреляция между данной мутацией и устойчивостью в офлоксацину.

Мутации в кодонах 74 и 88, описанные ранее в литературе [15–18], в данном иссле довании обнаружены не были. Все обнаруженные в исследовании мутации в гене gyrA Таблица 4. Результаты генетического анализа изолятов M. tuberculosis, обладающих чувствительностью ко всем противотуберкулезным препаратам Сполиготип Код сполиготипа Количество % Семейство в восьмеричном в международной изолятов коде базе данных 000000000003371 1 3,33 Beijing ST 000000000003661 2 6, ST 000000000003671 1 3, ST 000000000003771 10 33, ST 000002000003661 Нет 2 6, 000002000003771 1 3, ST 000002000103771 Нет 1 3, 177777657760771 1 3,33 T ST 777777777760771 2 6, ST 777777777700001 Нет 1 3,33 T 711041003760661 1 3,33 LAM 711041007740661 1 3, 777741000160771 1 3, 777777607760771 1 3, ST 777777644020771 Нет 1 3,33 Haarlem 000000000503771 1 3,33 377737670000000 1 3,33 777000000000371 1 3,33 ST были описаны для офлоксацин-резистентных изолятов M. tuberculosis ранее [17, 19].



Pages:     | 1 |   ...   | 2 | 3 || 5 |
 





 
© 2013 www.libed.ru - «Бесплатная библиотека научно-практических конференций»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.