авторефераты диссертаций БЕСПЛАТНАЯ БИБЛИОТЕКА РОССИИ

КОНФЕРЕНЦИИ, КНИГИ, ПОСОБИЯ, НАУЧНЫЕ ИЗДАНИЯ

<< ГЛАВНАЯ
АГРОИНЖЕНЕРИЯ
АСТРОНОМИЯ
БЕЗОПАСНОСТЬ
БИОЛОГИЯ
ЗЕМЛЯ
ИНФОРМАТИКА
ИСКУССТВОВЕДЕНИЕ
ИСТОРИЯ
КУЛЬТУРОЛОГИЯ
МАШИНОСТРОЕНИЕ
МЕДИЦИНА
МЕТАЛЛУРГИЯ
МЕХАНИКА
ПЕДАГОГИКА
ПОЛИТИКА
ПРИБОРОСТРОЕНИЕ
ПРОДОВОЛЬСТВИЕ
ПСИХОЛОГИЯ
РАДИОТЕХНИКА
СЕЛЬСКОЕ ХОЗЯЙСТВО
СОЦИОЛОГИЯ
СТРОИТЕЛЬСТВО
ТЕХНИЧЕСКИЕ НАУКИ
ТРАНСПОРТ
ФАРМАЦЕВТИКА
ФИЗИКА
ФИЗИОЛОГИЯ
ФИЛОЛОГИЯ
ФИЛОСОФИЯ
ХИМИЯ
ЭКОНОМИКА
ЭЛЕКТРОТЕХНИКА
ЭНЕРГЕТИКА
ЮРИСПРУДЕНЦИЯ
ЯЗЫКОЗНАНИЕ
РАЗНОЕ
КОНТАКТЫ


Pages:   || 2 | 3 | 4 |
-- [ Страница 1 ] --

Биология: традиции и инновации в ХХI веке

Материалы I Всероссийского

конгресса студентов и аспирантов-биологов

«Симбиоз Россия-2008» с международным участием

6-10 июля 2008 года

Издательство

Казанского государственного университета

2008

1

Биология: традиции и инновации в ХХI веке

Материалы I Всероссийского

конгресса студентов и аспирантов-биологов «Симбиоз Россия-2008» с международным участием 6-10 июля 2008 года Издательство Казанского государственного университета 2008 2 УДК 575:577:579:58:61 ББК 28.4:28.57:28.67:28.704:

Научный редактор: к. б. н., доцент Татьяна Валерьевна Балтина Материалы I Всероссийского конгресса студентов и аспирантов биологов «Симбиоз Россия - 2008» с международным участием/Под ред. Т. В.

Балтиной – Казань: КГУ, 2008. – 129 с Представлены материалы I Всероссийского конгресса студентов и аспирантов биологов «Симбиоз Россия 2008» с международным участием, проходившем с 6-10 июля 2008 года в г.Казани по направлениям:

молекулярная биология, микробиология, генетика, фундаментальная медицина, физиология, нейробиология, биохимия, физиология растений, биотехнологии и нанотехнологии, разнообразие живого мира и экология.

Печатается по решению редакционно-издательского совета Учебно методической комиссии биолого-почвенного факультета Казанского государственного университета.

Симпозиум: Молекулярная биология, микробиология, генетика УДК 577. МОЛЕКУЛЯРНАЯ ДИНАМИКА БЕЛКА МОГ С ИСПОЛЬЗОВАНИЕМ ПРОГРАММЫ GPAMP ДЛЯ ГРАФИЧЕСКИХ ПРОЦЕССОРОВ NVIDIA G Алишева Д.А., Тарасов Д.С.

Казанский государственный университет Введение На сегодняшний день компьютерные эксперименты играю очень важную роль в современных исследованиях. Молекулярная динамика позволяет изучать динамику сложных макромолекул, включая биологические системы такие, как белки, нуклеиновые кислоты (ДНК и РНК), мембраны [1].

Динамические события могут играть ключевую роль в контролировании процессов, которые влияют на функциональные свойства биомолекул.

Молекулярная динамика – довольно мощная техника, но конечно у нее есть свои ограничения. Первое из них - это использование Ньютоновских законов для движения атомов, когда всем известен тот факт, что системы на атомарном уровне подчиняются квантовым законам и требуют решения уравнения Шредингера. Нередко можно столкнуться со случаями, когда время релаксации физических свойств большого числа атомов – степень большей величины, чем достижимое время моделирования [2]. Ограниченный размер так же может быть проблемой. В этом случае необходимо сравнить размер ячейки молекулярной динамики с корреляционной длиной интересующих пространственных корреляционных функций.

Основные экспериментальные методы получения данных о строении белков на сегодняшний день – это рентгеновская кристаллография и ЯМР.

Главные проблемы получения информации о строении белков с помощью экспериментальных методов представляют особый интерес для теоретических методов предсказания пространственной структуры белков из аминокислотной последовательности, что часто относят к проблеме фолдинга белка [3]. Механизм, по которому белок сворачивается в свою нативную структура долгое время был объектом интереса с экспериментальной и с теоретической стороны. Белки принимают единственную структуру, соответствующую минимуму свободной энергии при физиологических условиях. Полагается, что для каждой аминокислоты есть 3 конформации, тогда для полипептидной цепи, скажем, из 100 аминокислот будет примерно 1048 конформаций. [3].

Конечная цель для некоторых в данной области – это полное атомистическое моделирование процесса фолдинга из случайной стартовой структуры в явном растворителе. Данные симуляции очень ограничены из-за времени, требующегося для моделирования, и большого числа вовлеченных участков. При выборе объекта моделирования необходимо учитывать ограничения молекулярной динамики и имеющиеся вычислительные способности. Для возможности адекватной оценки полученных данных желательно иметь данные о строении биологической системы, полученные ЯМР-спектроскопией или рентгеновской кристаллографией. По всем этим параметрам идеальной моделью может служить миелин-олигодендроцит гликопротеин (МОГ).

МОГ – ключевой ЦНС-специфичный аутоантиген для основной демиелинизации во множественном склерозе. Множественный склероз – это воспалительное заболевание ЦНС, характеризующееся местным разрушением миелина и дегенерацией аксонов. Моделирование молекулярной динамики миелин олигодендроцит гликопротеина стало целью данной работы. Изучив параметры строения, и смоделировав поведение белка в растворе, можно использовать полученные данные для исследования различных мутаций, приводящих к нарушению димеризации моноверов данного белка и, как следствие, к заболеванию.

Основная часть Все моделирование было проведено с помощью программы GPAMP, созданной нашей научной группой, с использованием силового поля amber99.

Программа GPAMP для графических процессоров NVIDIA G 80 была написана специально для ускорения молекулярной динамики, в результате скорость расчета возросла в несколько раз, а время, затрачиваемое на моделирование, соответственно сократилось. Расчет производился на персональном компьютере – ноутбуке Acer Aspire 5920G Intel Core 2 duo processor T7500 с частотой 2.2Ghz и 1GB оперативной памятью для оптимизации первоначальной структуры белка, - а так же c использованием ресурсов персональной видеокарты NVIDIA GeForce 8800 GT для расчета молекулярной динамики белка МОГ в растворителе (вода). Временной шаг составил 1 фс.

Белок миелин олигодендроцит гликопротеин был смоделирован в периодической коробке без растворителя, моделирование в вакууме было проведено для оптимизации молекулы. Был построен график изменения соляных мостиков между атомами аминокислотных остатков в течение молекулярной динамики и вычислено RMS расстояние.

Затем белок был растворен в водной коробке и минимизирована его энергия с помощью программы HyperChem 7.0. Для оптимизации белка в воде проведена молекулярная динамики при 0К в течение 32 пс. Результаты были взяты для следующего шага и смоделирована молекулярная динамика белка при 300К в течение 350 пс. В результате было обнаружено возможных соляных мостиков между атомами аминокислотных остатков. В ходе молекулярной динамки выявлено, что большинство соляных мостиков являются стабильными в течение всего времени динамики.

Для белка МОГ в растворителе было рассчитано изменение среднего квадратичного отклонения полученной структуры от исходной структуры, данные которой получены с помощью рентгеновской кристаллографии, в течение времени молекулярной динамики.

Отклонение от исходной структуры, данные о которой получены кристаллографией, колеблется в ожидаемых пределах (до 1,5 ангстрем, что является отличным показателем) и демонстрирует приближение структуры белка к конформации с наименьшей энергией. Во время расчета RMS расстояния не наблюдается никаких сдвигов, что свидетельствует о том, что конформационное пространство вокруг исходной структуры является локальным минимумом.

Чтобы проверить, не являются ли небольшие значения RMS расстояния результатом гашения важных межмолекулярных движений или замораживания степеней свободы молекулы, была рассчитана RMS флуктуация (см. график 1).

изменение R MS флуктуац ии в белке МОГ в раство рителе в течение в ремени 0, 0, RMS флуктуация, 0, 0, ангстрем 0, 0, 0, 0, 0, 50000 100000 150000 200000 250000 300000 время, ф с График 1. Изменение RMS флуктуации в течение времени Как видно из графика 1, никаких эффектов гашения или заморозки степеней свободы не наблюдается. Структура белка свободно колеблется вокруг оптимальной конформации с минимальной энергией.

Выводы Белок миелин олигодендроцит гликопротеин был смоделирован в системе растворителя – воды. В ходе молекулярной динамики основные соляные мостики между атомами аминокислотных остатков оставались стабильными, что свидетельствует о хорошей стабильности данного мономера.

Расчет RMS расстояний показал, что конформационное пространство вокруг структуры белка близко к локальному минимуму. Расчет RMS флуктуации, показал, что данные, полученные при расчете RMS расстояния, не являются результатом гашения межмолекулярного движения и заморозки степеней свободы молекулы.

Литература 1. Krl M. Analysis of the effect of electrostatic energy truncation in molecular dynamics simulations of immunoglobulin G light chain dimmer/ M. Krol// Journal of Molecular Modeling - 10.1007/s00894-003-0147-8 – 2003.

2. Ercolessi F. A molecular dynamics primer/ International School For Advanced Studies (SISSA-ISAS) in Spring College in Computational Physics, ICTP – Trieste – 1997.

3. Leach A.R. Molecular Modeling. Principals and applications: 2 edition/ A. R.

Leach – England, Edinburgh: Prentice Hall – 2001 – 773 p.

УДК 579.22;

579.083. РИБОНУКЛЕАЗНАЯ АКТИВНОСТЬ БЕЛКОВ АРХЕЙ HALOBACTERIUM SALINARUM NRC- Асафова А.С., Ильинская О.Н.

Казанский государственный университет Оценивали рибонуклеазную активность в разных фракциях белков галобактерий Halobacterium salinarum NRC-1. Эта активность обнаружена в белковых фракциях 13-15, в составе которых представлены в основном средне- и низкомолекулярные полипептиды. Вестерн-блоттинг с использованием моноклональных антител позволил выявить специфическую РНКазную активность фактора инициации трансляции архей aIF-5A.

УДК 579.22.518:579.253.2:579.253.55:579. ВЛИЯНИЕ ИСТОЧНИКОВ АЗОТА НА ПОДВИЖНОСТЬ И СВОЙСТВА КЛЕТОЧНОЙ ПОВЕРХНОСТИ AZOSPIRILLUM BRASILENSE О.Э. Варшаломидзе, А.В. Шелудько, Е.Г. Пономарева, В.Е. Никитина,Е.И. Кацы Институт биохимии и физиологии растений и микроорганизмов РАН, Саратов На полужидких средах эффективность распространения азоспирилл – бактерий вступающих в ассоциативные взаимодействия с растениями, зависит от присутствия в среде источника азота и его химической природы и определяется свойствами бактериальной поверхности, изменяющимися под действием этих факторов. Свойства бактериальной поверхности влияют на возникающие между подвижными бактериями межклеточные контакты, обусловленные лектин–углеводными взаимодействиями.

УДК 573. БИОЛОГИЧЕСКИЙ ФУНДАМЕНТ ФИЛОЛОГИИ, ЛИНГВИСТИКИ И НАУКИ В ЦЕЛОМ А.К. Барсуков, Д.Г. Болкисев, Ю.Н. Воробьев1, А.А. Грызлов, В.А. Ефимов2, В.Д. Злобин, В.Г. Ившин, Ф.М. Касимов, О.В. Кожевникова, А.И. Кузнецов, Л.П. Лапшина, И.А. Лебедев, О.Ю. Нестерова, М.Н. Перминов, А.Н. Разумов3, Е.А. Соловьев, А.Д. Суслова, А.А. Тойдорова Удмуртский государственный университет, г. Ижевск Казанский государственный университет им. В.И. Ульянова-Ленина, г.

Казань Санкт-Петербургский государственный аграрный университет, Санкт Петербург РНЦ ВМиК, Москва Пропасть, разделяющая нравственно выхолощенное естествознание и абстрактно-гуманитарные науки, грозит уничтожить если не все человечество, то нынешнюю глобальную цивилизацию. В случае катастрофы культуры наступит эпоха социального хаоса. Поэтому потребности общественного бытия и дальнейшего жизнеустройства человечества состоят в том, чтобы истинная наука стала продолжением праведной духовности с целевым развитием единения естественной и гуманитарной составляющей в методологии познания мира. Для решения задачи восстановления целостной системы знаний необходимо дать жизненно состоятельный ответ на вопрос «для чего быть науке?», в т.ч. физико-математической биологии и сопряженным направлениям научно-технического прогресса. Очевидно, что ответ должен быть всеобъемлющим, вытекающий из духовного наследия Российской многонациональной цивилизации с учетом современного уровня развития естественных, гуманитарных наук и на основе их взаимного проникновения друг в друга. Именно во взаимном проникновении наук возможно устремиться к истине, в т.ч. избежать глобального кризиса технократии, от последствий которого укрыться невозможно.

В 2003 году отчасти завершен международный проект, известный в междисциплинарной области фундаментальных наук (математики, физики, химии и биологии) как «Геном человека». Его структурное завершение для гуманитарной составляющей культуры человечества имеет огромнейшее значение, несравнимо большее, чем для профессионального научного естествознания. Для естественников это «Полет на Луну, Марс и т.д». Для гуманитариев – в 5 мкм ядре каждой из 10 триллионов клеток содержится 2 метровая нить ДНК, в которой закодирован конкретный образ конкретного человека. Хорошо известно, что в состав человеческого тела входят белки, совокупность которых и комплексов на их основе достигает 1 млн разнообразных вариаций. Такова основа хорошо известной бездуховной формулировки: «Жизнь - есть способ существования белковых тел».

Проблема в другом: является ли способ существования белковых тел Жизнью? Установлено, что 2-метровая нить ДНК состоит из 4 качественно различных нуклеотидов-букв, массив которых из 3,2 млрд. и на основе аминокислот-слов кодирует около 29-120 тыс. белков-предложений. К примеру, Эллочка Щукина обходилась 30 словами, словарный запас произведений А.С. Пушкина представлен 20 тыс. слов, геном каждой клетки человека – библиотека из 1000 томов, по 1000 страниц в каждом. Козьма Прутков утверждал, что «люди подобны колбасам, чем их начинят, с тем они и живут». В буквальном смысле афоризм К. Пруткова используется химиками-биологами, профессиональная подготовка которых не уделяет должного внимания физико-математическим наукам: «Человек как колбаса начинен ДНК, причем длина ДНК в отдельно взятом человеке в 1000 раз больше, чем расстояние от Земли до Солнца». В рамках «гуманитарной значимости завершения структурных исследований генома» нас более всего интересуют эволюционистские теории происхождения человека. Их в настоящее время всего лишь две.

Первая, «дарвиновская теория», обрела конкретику. Человек произошел от общего предка человекошимпанзе (не от гориллы и прочих человекообразных), неандерталец и прочие кроманьонцы к человеку никакого отношения не имеют. При этом биологи в силу методологической ограниченности сконцентрировали усилия на малой части ДНК (не более 5%), которая обеспечивает биосинтез индивидуальных белков и регуляторных РНК. Всю остальную, не кодирующую белки, структуру ДНК около 95% биологи посчитали мусорной, приобретенной человечеством в каком-то непонятном процессе эволюции в течение 5-6 млн. лет. Вторая теория – человек-человечество произошли от первоЕвы, которая проживала 150- тыс. лет тому назад в Африке и имела монголоидный тип.

Обсуждаемые теории происхождения человека и возраста человечества базируются на результатах численных измерений гомологии нуклеотидных последовательностей и количества нейтральных мутаций в геноме человека и человекообразных обезьян. Совершенно иной вопрос, как интерпретируются эти результаты, прошедшие обязательную математическую обработку.

Конечно можно себе представить, что когда-то обезьяны прыгали по елкам пальмам планеты Земля. Часть из них подверглась вирусной инфекции – есть категория вирусов, ДНК либо ДНК-копии которых способны ковалентно интегрироваться с клеточным геномом (Более подробно изложено в вестнике РАН том 70, № 5, 2000 г. стр. 1-19). Ослабевшие от болезни обезьяны стали ходить по земле. Одна из них под елкой или пальмой нашла интеллект и примерила на себя. Именно завалявшийся в кустах и под деревьями интеллект, обнаруженный обезьяной, позволил ей соотносить издаваемые ею физиологические звуки с конкретными жизненными явлениями.

Впоследствии обезьяна запела и научилась созидать. Все изложенное полностью соответствует хорошо известной марксистской формуле: «Жизнь есть способ существования белковых тел».

Физико-математический подход при изучении биологических объектов принципиально иной. Во-первых, физики не приемлют абстракции от молекулы через обезьяну к человеку. Такую собственную позицию они объясняют сверхсложностью биологических объектов. В частности, осмысление информационного содержания двухметровой нити ДНК для физиков-математиков считается задачей сверхтрудной. Обработка текста из 3,2 млрд. букв требует избыточного количества дорогостоящей исследовательской техники и физико-математических экспериментальных подходов. Тем не менее, физико-математическое направление исследований ДНК породило волновую генетику, согласно которой как минимум 95% ДНК звучит и поет. Именно песни ДНК являются регулятором мозаики биосинтеза индивидуальных белков организма. Полагаем, что песни живого мира должны быть созвучны пониманию Жизни, которая без материальных носителей информации невозможна. Следовательно, способ существования белковых тел есть материальная основа жизни. Однако способ существования белковых тел жизнью назвать нельзя, поэтому предлагаются магическо мистические интерпретации. «Магия», с точки зрения естественников, это то, что объективно действует, однако принципы действия остаются за пределами восприятия чувств и понимания человека.

Хотя язык, человеческая речь есть средство оказания «нефизического»

воздействия на мир, т.е. магией, но, наряду с этим, языку свойственна некая своя «магия слова» именно в этом специфическом смысле: объективно действует, а что именно? как действует? почему? – непонятно… Совокупный «магический эффект» стиха и песни определяется термином звукопись, смысл которого в терминах естествознания не определен. Социологической практикой установлено, что поэтическое творчество народа в словах и мелодии заставляют задуматься каждого и всех, и жить по принципу «семь раз отмерь, один раз отрежь».

Об эффективности музыкальной психофизиологии с использованием народных песен накоплено достаточно много фактического материала в реабилитационной и восстановительной медицине. На основании опыта такой «музыкальной психотерапии» полиции Канады удалось существенно снизить вандализм молодежи на поездах пригородного сообщения за счет изменений в программах железнодорожного вещания в пользу репертуара народной и классической музыки и исключения поп-, рок-хитов и эстрадной бессмыслицы. Следовательно, творчество народных ансамблей формирует общественно полезную социологию и дееспособную психологию. Под дееспособной психологией мы понимаем знание и умение каждого выступать в роли врачевателя собственных душевных ран. В. Гюго утверждал, что «поэзия не в форме мыслей, а в самих мыслях». Народное творчество всегда имеет целевую установку: «Люди, давайте станем человеками». В эпоху научно-технического прогресса обсуждаются иные ценности, которые в песнях и творчестве народа, в принципе не упоминаются.

С учетом изложенного, в данном контексте необходимо обсудить некую надуманную проблематику «о доверии народному языку» с целью изложения однозначных выводов по данному вопросу. Во-первых, язык народов России – это общий всем нам язык в развитии объединяющей нас культуры. По мнению А.С. Пушкина: «Язык мой – враг мой;

все ему доступно», т.е. язык наш как объективная данность в некотором смысле «знает» больше, чем знает любой из его носителей лично и все они вместе взятые. И это действительно так, если учесть воззрения теории информации и достижения физиологии высшей нервной деятельности. Очевидно также, что народный язык обладает своей собственной подвижностью (А.С.Пушкин: «Он обо всем болтать себе привык»). Подвижность языка в своей основе имеет коллективную психику.

Следовательно, народный язык не зависит от намерений и воли каждого даже в условиях социального расслоения общества. Однако, не следует забывать, что в обществе может сформироваться «элитарное» меньшинство, которое с помощью «оранжевых фондов» будет волевым образом оказывать воздействие на жизнь языка в обоих древних смыслах этого слова (воздействовать на речь, т.е. культуру речи, и на сам народ – носитель языка).

Во-вторых (Язык мой – враг мой) – характеристика особенностей личностной языковой культуры, культуры мышления и коллективной психики носителей языка. При осмыслении народных песен язык становится как бы «врагом», поскольку народ знает все, а с помощью языка выходит за пределы субъективного понимания человеком смысла праведной Жизни.

Причем такое индивидуальное открытие дается конкретному человеку через собственную жизнь языка. Язык народной песни несет в себе смысл объективной Правды-Истины. Именно поэтому даже олигархически настроенный школьник чувствует себя супротивником Истины, и это видится ему как агрессия против него лично со стороны его родного языка.

Дееспособная психология утверждает, что человеку в процессе образования необходимо давать навыки для восприятия всякого народного языка в его исторически сложившемся в каждую эпоху виде. Смысл языка-песни народных ансамблей - объективная данность бытия Мироздания, которую всякий человек, входя в жизнь, осваивает в той или иной субъективной мере.

Менее затратная образовательно-воспитательная стратегия опирается на атеистические предубеждения. Полагают, что некогда какая-то обезьяна в естественном отборе случайно (т.е. беспричинно и бесцельно) «сама собой»

обрела интеллект. С помощью обретенного интеллекта «элитарная обезьяна»

дошла до мысли, что издаваемым ею различным звукосочетаниям она может придавать значения того или иного житейского смысла. При этом не обсуждаются в подобного рода теориях вопросы: «Что такое интеллект, и как он устроен?», «Что такое мысль, из чего она состоит и как устроена?». Если же исходить из самой современной атеистической теории преображения общего предка шимпанзе и человека, то:

наличие генетически обретенных в процессе 5 млн. лет анатомических и психоалгоритмических особенностей, объективно обуславливающих способность «обезьяны» вида «Homo sapiens» к осмысленной и членораздельной речи, становится еще одной беспричинно-бессмысленной невероятной случайностью в биологии и истории;

Филология, лингвистика и философия приобретают самоизолированный от остальной науки смысл, и каждая из них превращается в исследовательский подход по регистрации и толкованию отрывков и композиций мелодичного мычания, ржания, завывания и скулежа представителей разных популяций вида «Homo sapiens».

УДК 579. ВЛИЯНИЕ РАЗЛИЧНЫХ ДОМЕНОВ БЕЛКА MOD(MDG4) НА ОБРАЗОВАНИЕ «ИНСУЛЯТОРНЫХ ТЕЛЕЦ» В ЯДРАХ КЛЕТОК DROSOPHILA MELANOGASTER И.А. Волков, А.К. Головнин Институт Молекулярной биологии Российской академии наук, Москва Инсуляторами называются регуляторные элементы, которые, находясь между энхансером и промотором, блокируют их взаимодействие. Известно, что с основным компонентом инсулятора Su(Hw) белком Su(Hw) связывается белок Mod(mdg4). Для этого белка предполагается ключевая роль в формировании инсуляторного комплекса. Цитологически белок Mod(mdg4) локализуется в ядре и образует компактные скопления белка, так называемые «инсуляторные тельца», или спеклы. [1] Был проведен анализ полученных конструкций с различными мутациями гена белка Mod(mdg4). Было показано, что образование компактных скоплений белка Mod(mdg4) и его цитологическая локализация зависят от ZnFinger типа FLYWCH и глютамин богатого района. Более детальное исследование показало, что проникновение белка Mod(mdg4) в ядро обеспечивается районом NLS, а распределение «инсуляторных телец» зависит от ZnFinger типа FLYWCH.

Было показано in vivo, что образование и перераспределение спеклов в ядре не связано с процессом инсуляции. Таким образом, была подвергнута сомнению широко распространенная модель действия Su(Hw)-зависимых инсуляторов, утверждающая, что конгломераты инсуляторных белков являются основанием функциональных петель хроматина и отвечают за инсуляцию. [2] Для белка Mod(mdg4) ранее был показан открытый недавно тип посттрансляционной модификации – _умолирование. В белке Mod(mdg4) было выявлено два сайта связывания для белка SUMO, главного участника процесса модификации. Было показано in vitro, что при нарушении обоих сайтов для прикрепления белка SUMO происходит перераспределение белка Mod(mdg4) в клетке: наблюдалось исчезновение спеклов и равномерное распределение белка Mod(mdg4) в ядре. В настоящее время эффект от нарушения в белке Mod(mdg4) сайтов связывания для белка SUMO проверяется in vivo.

Литература [1] Golovnin A. et al Integrity of the Mod(mdg4)-67.2 BTB domain is critical to insulator function in Drosophila melanogaster. Mol. Cell. Biol. 2007, 27:963 974;

[2] Golovnin A, Melnikova L, Volkov I, Kostuchenko M, Galkin A & Georgiev P ‘Insulator bodies’ are aggregates of proteins but not of insulators.

EMBO reports, УДК 575.11+58. КЛОНИРОВАНИЕ СИМБИОТИЧЕСКИХ ГЕНОВ ГОРОХА ПОСЕВНОГО (PISUM SATIVUM L.) С ИСПОЛЬЗОВАНИЕМ СИНТЕНИИ ГЕНОМОВ БОБОВЫХ РАСТЕНИЙ В.А. Жуков, Т.С. Рычагова, В.С. Титов, А.Ю. Борисов, И.А. Тихонович ГНУ ВНИИ Сельскохозяйственной Микробиологии РАСХН, Санкт Петербург Более 40 регуляторных генов гороха посевного (Pisum sativum L.) вовлечены в симбиотические взаимодействия с грибами арбускулярной микоризы и клубеньковыми бактериями. Для клонирования этих генов используют два подхода: поиск ортологичных мутаций у модельных бобовых растений и функциональное картирование – выбор генов-кандидатов у модельных растений на основании их генетической локализации и физиологической и биохимической роли с последующим клонированием ортологичных генов у гороха. В статье описано клонирование симбиотических генов гороха PsSym37 и PsK1, участвующих в рецепции бактериальных сигнальных молекул, а также симбиотического гена PsCoch, регулирующего активность меристем азотфиксирующего клубенька.

УДК 577. ИЗУЧЕНИЕ СТАТУСА МЕТИЛИРОВАНИЯ ГЕНОВ BASP1, PDLIM4, IFI30, ARL6IP ПРИ РАКЕ ПРЕДСТАТЕЛЬНОЙ ЖЕЛЕЗЫ И.И. Ибрагимова, А.Н. Фаттахова Казанский Государственный Университет им. В.И. Ульянова-Ленина, Казань Рак предстательной железы занимает третье место среди всех онкологических заболеваний среди мужчин в развитых странах. Известно, что успешное лечение данного заболевания зависит от точности прогноза и ранней диагностики, которая затруднена вследствие бессимптомного протекания болезни. Все существующие на данный момент методы, используемые для постановки диагноза рак предстательной железы, являются дорогостоящими, болезненными и не всегда эффективными. Очевидно, что необходима разработка новых методов ранней диагностики.

Было уставлено, что в многостадийном процессе развития опухолей нарушение функций клеточных генов может происходить не только из-за генетических событий, но и в результате эпигенетических нарушений, которое сопровождается изменением профиля экспрессии без затрагивания первичной структуры ДНК. Одним из таких эпигенетических изменений ДНК является метилирование цитозина в составе CpG-динуклеотида, следствием чего является невозможность узнавания факторами транскрипции метилированной последовательности регуляторного участка, что приводит к значительному снижению уровня транскрипции гена, вплоть до полной ее блокировки.

В данной работе был исследован статус метилирования промоторных участков потенциальных генов-супрессоров опухолевого роста BASP1, PDLIM4, IFI30, ARL6IP в клеточных линиях рака предстательной железы LNCaP, MDA2b, DU145, PC-3 и в клетках нормальной ткани. В ходе исследований было показано, что CpG-островки промоторной области гена BASP1 метилированы во всех четырех клеточных линиях рака предстательной железы. Промотор гена PDLIM4 - только в клеточной линии LNCaP, ген IFI30 – в клеточных линиях LNCaP и PC-3. При изучении промоторного участка гена ARL6IP было установлено, что CpG-островки неметилированы во всех клеточных линиях. Результаты сиквенирования промоторных участков всех вышеперечисленных генов показали отсутствие метилирования в клетках нормальной ткани предстательной железы.

Полученные данные позволяют рассматривать гены BASP1, PDLIM4, IFI как потенциальные биологические маркеры ранней диагностики рака предстательной железы.

УДК 595.773:577.112. ПЕПТИДНЫЕ ВЕКТОРА В ТРАНСПОРТЕ БИОМАКРОМОЛЕКУЛ ЧЕРЕЗ ГЕМАТОЭНЦЕФАЛИЧЕСКИЙ БАРЬЕР Е. М. Карасева, Г.А. Кислик, С.В. Саранцева Петербургский институт ядерной физики им. Б.П.Константинова РАН, Гатчина На модели Drosophila melanogaster изучена способность векторных пептидов, содержащих домены белковой трансдукции, пенетратина (pAntp 43-58), являющегося производным гомеобоксного белка Antennapedia Drosophila и дендримера D5, доставлять физиологически активные пептиды в клетки мозга Drosophila. Пенетратин и дендример, меченый биотином, вводили в брюшко мух, и исследовали их распределение на фиксированных срезах головного мозга. Аналогичные эксперименты были проведены и для меченого биотином, пептида», содержащего «терапевтического последовальность пенетратина и последовательность нейропротективного пептида COG133, миметика рецепторного сайта аполипопротеина Е.

Дендример, пенетратин и пенетратин-COG133 обнаруживались в клетках головного мозга Drosophila. Следовательно Drosophila melanogaster может быть использована для первичного скрининга новых лекарственных препаратов в лечении заболеваний центральной нервной системы.

УДК 579.2+579.26+579. ИССЛЕДОВАНИЕ АДГЕЗИВНЫХ СВОЙСТВ АКТИНОБАКТЕРИЙ РОДА RHODOCOCCUS С ПОМОЩЬЮ Tn5 МУТАГЕНЕЗА А.В. Криворучко1, Е.В. Рубцова2, М.К. Серебренникова Пермский государственный университет, Пермь Институт экологии и генетики микроорганизмов УрО РАН, Пермь Цель настоящей работы – исследование адгезивной активности алканотрофных родококков с помощью Tn5 мутагенеза. В результате электропорации клеток родококков транспозомой EZ::TNTM KAN-2Tnp TransposomeTM создана библиотека мутантных клонов, характеризующихся различной адгезивной активностью в отношении жидких (н-гексадекана) и твердых (полистирола) гидрофобных субстратов. Выявлена прямая зависимость между адгезивной и эмульгирующей активностью полученных мутантов. Экспериментально обосновано стимулирующее влияние Rhodococcus-биосурфактантов на процесс адгезии родококков к гидрофобным субстратам.

УДК579.222. ГЕНЕТИЧЕСКАЯ МОДИФИКАЦИЯ МЕТАБОЛИЗМА МЕТИЛОТРОФНЫХ ПРОДУЦЕНТОВ ПОЛИГИДРОКСИБУТИРАТА Б.Ц. Ешинимаев, А.А. Лапин.

Институт биохимии и физиологии микроорганизмов им Г.К. Скрябина РАН Пущинский государственный университет Введение Многие прокариоты синтезируют и запасают поли-3 гидроксибутират (ПГБ) при несбалансированных условиях роста (дефицит азота, фосфатов, кислорода или магния) в виде цитоплазматических гранул [3]. Биополимер обладает полезными свойствами биоразлагаемостью, биосовместимостью, термопластичностью и поэтому имеет очевидное практическое значение для биотехнологии, сельского хозяйства и медицины.

В качестве вероятных продуцентов биополимера являются аэробные метилотрофы бактерий, использующих метан (метанотрофы) или его окисленные и замещенные производные (метилобактерии) как источники углерода и энергии, обладающие значительным метаболическим потенциалом для практического использования.

В настоящее время развитие различных отраслей народного хозяйства выдвигает проблему утилизации загрязняющих окружающую среду твердых отходов, среди которых 90% занимают персистентные пластмассы.

В связи с этим разработка и производство деградабельных биопластиков полигидроксибутирата (ПГБ) и полилактона, являются важными задачами микробной биотехнологии. Наибольшее внимание привлекает ПГБ и его сополимер с валератом ПГБ/В, используемые в биомедицине, сельском хозяйстве и нанотехнологии. В настоящее время известны работы по получению ПГБ с использованием высших растений [2] и гетеротрофных бактерий, в том числе генетически модифицированных штаммов E. Coli [1].

Ввиду низкой стоимости и доступности метана и метанола производство ПГБ на их основе является перспективным направлением биотехнологии.

Целью нашей работы является конструирование метилотрофных продуцентов ПГБ с высокими выходами и высокой молекулярной массой.

Работа проводится по двум направлениям:

1) Изучение физиологических параметров роста и накопления ПГБ у метилобактерий;

2) Получение метаболически модифицированных мутантов и трансформантов метилотрофных бактерий с повышенным уровнем синтеза ПГБ и высокой пластичностью биополимера.

3) Конструирование и дизайн праймеров на консервативные фрагменты гена phaC, кодирующего ПГБ-синтазу у метилотрофных бактерий и дальнейший филогенетический анализ.

4) Определить нуклеотидные последовательности гена phaC, кодирующей ПГБ-синтазу у Меthylobacterium extorquens G10.

Результаты Скрининг метилобактерий выявил Methylobacterium extorquens G10 в качестве перспективного продуцента ПГБ. Наработаны опытные партии полимеров, которые тестируются на возможность использования в биомедицине и нанотехнологии.

Для создания метаболически модифицированных штаммов M. extorquens G10 нами получены генетические конструкции в плазмидных векторах, в составе которых находятся гены изоцитратлиазы (aceA), и ПГБ-синтазы (phaC). Для отработки процедуры генетической модификации продуцента, в качестве модельного организма использовался Methylobacterium extorquensAM1.

Основываясь на предположении, что увеличение уровня глиоксилата в клетке может влиять на скорость роста, выход биомассы и ПГБ был клонирован ген aceA, кодирующий изоцитратлиазу, из E.coli К-12 в Methylobacterium extorquens AМ1, для введения дополнительного источника глиоксилата. Ген aceA был клонирован в вектор pCM160 под регуляцию промотора метанолдегидрогеназы и коньюгативно перенесен из E.coli S17-1 в Methylobacterium extorquens AМ1. Предварительные физиологические эксперименты выявили увеличение скорости роста и выход биомассы у трансформанта, несущего ген изоцитратлиазы относительно штамма дикого типа. Выявлено два пика накопления ПГБ: в начале фазы активного роста трансформанта и в стационарной фазе. Снижение уровня ПГБ в фазе активного роста трансформанта, видимо, связано с необходимостью дополнительного расхода углерода для роста и деления клеток. Методом ВЭЖХ у трансформантов Methylobacterium extorquens AМ1 выявлено увеличение выхода ПГБ от 2 до 10 % относительно контроля (табл.1) и повышение скорости роста. Сходные данные по увеличению выхода ПГБ были получены на Methylobacterium extorquensG10.

В дальнейшем мы получили штаммы M. extorquens G10 со встроенным в хромосому геном aceA. У данных штаммов происходило увеличение выхода ПГБ, причем скорость роста не уменьшалась.

Возможный путь увеличения выхода ПГБ является увеличение дозы гена ПГБ-синтазы. Известно, что ПГБ-синтаза этого метилотрофа относится к I типу. На основании множественного выравнивания ПГБ-синтаз, наиболее близких к ПГБ-синтазе аэробной метилобактерии Methylobacterium extorquens AM1, были выявлены 4 консервативных области подходящих для дизайна 5 праймеров. С использованием пары праймеров C11f:

ATCGTGCCCTGGATCAACAA-3 и C31r: TCC(S)CGTTCCAGTACA(R)CAG(R)TCGAA-3. удалось амплифицировать специфичные ПЦР-фрагменты длиной около 560 п.н. у нескольких метанотрофов II типа и метилобактерий, с сериновым путем ассимиляции формальдегида. Секвенирование и филогенетический анализ фрагментов последовательности гена phaC выявил группирование метанотрофов II типа и метилобактерий в один кластер.

Таблица Накопление ПГБ в биомассе клеток у M. extorquens G10 и M. extorquens AM в различные фазы роста Время, ч G10pCM160 G10aceA AM1 pCM160 AM1aceA % ПГБ % ПГБ % ПГБ % ПГБ 42 35 18 10 72 36 42 10,5 96 35 39 24 Накопление 57,9 70 22 ПГБ Нами была определена нуклеотидная последовательность гена ПГБ синтазы Methylobacterium extorquensG10.Уровень сходства сходства данного гена с аналогичным у Methylobacterium extorquensAM1 составил 99%. Мы клонировали ген ПГБ-синтазы из Methylobacterium extorquens AM1 в G10.

Увеличение дозы гена phaC в M. extorquens G10 повысила выход ПГБ (табл.2) Дополнительная копия гена ПГБ-синтазы, незначительно повлияла на скорость роста, снизив его.

Таблица Накопление ПГБ в биомассе клеток у M. extorquens G10 с увеличенной дозой гена ПГБ-синтазы в различные фазы роста Время, ч G10pCM160 G10phaC 2 G10phaC % ПГБ % ПГБ % ПГБ 42 35 47 72 24 74 96 63 55 Накопление ПГБ 57 66 Ожидается, что накопление генетических конструкций и их экспрессия в исходных продуцентах ПГБ позволит получить штаммы, обладающие способностью к быстрому росту на метаноле и активному синтезу ПГБ с большей молекулярной массой.

Работа выполнена при поддержке гранта РНП 2.1.1.2671.

Выводы 1. Клонирование гена aceA в Methylobacterium extorquens AM увеличивает скорость роста, выход биомассы и ПГБ у трансформантов.

2. Амплифицированы и секвенированы фрагменты генов phaC у Methylobacterium extorquens G10 и некоторых аэробных метанотрофов.

3. Сравнение нуклеотидных последовательностей генов phaC выявил группирование аэробных метилотрофных бактерий в один кластер.

4. Клонирован ген ПГБ-синтазы Methylobacterium extorquens AM1 в G10, получены трансформанты с увеличенным выходом ПГБ.

Литература 1.Md. M. Kabir · K. Shimizu. Fermentation characteristics and protein expression patterns in a recombinant Escherichia coli mutant lackingphosphoglucose isomerase for poly(3-hydroxybutyrate) production Microbial Biotech.V. 66.244-255. 2. Yoshikatsu Suzuki., Minoru Kurano., Yuko Arai., Hideo Nakashita., Yoshiharu Doi., Ron Usami., Kohki Horikosh., Isamu Yamaguchi. Enzyme ingibitors to increase Poly-3-hydroxybytirate production by transgenic Tobacco., Biotech. Biochem. V.66 2537-2542. 2002.

3.Ellar D., Lundgren D.G.,Ocamura K.,Marchessault R.H. Morphology of poly--hydroxybytirate granu les J.Mol.Biol. P. V.35 489-502. 1968.

УДК 577.218+577.152.277* ЭНДОРИБОНУКЛЕАЗНАЯ АКТИВНОСТЬ СУБЪЕДИНИЦ ПРОТЕАСОМ И ЕЁ РЕГУЛЯЦИЯ С ПОМОЩЬЮ ПОСТТРАНСЛЯЦИОНЫХ МОДИФИКАЦИЙ.

Т.Н.Моисеева1, Н.Ю.Семенова2, П.В.Кучина2, А.Г. Миттенберг Институт цитологии РАН, Санкт-Петербург Санкт-Петербургский государственный университет Протеасомы представляют собой мультисубъединичные рибонуклеопротеиновые комплексы, известные в основном благодаря своему участию в расщеплении многих клеточных белков с помощью убиквитин зависимого механизма. Однако позже были обнаружены и неканонические активности протеасом, такие как способность к расщеплению РНК и геликазная активность. Возможность регулировать стабильность как белка, так и кодирующей его мРНК, позволила бы говорить о протеасоме как об одном из важнейших компонентов системы контроля регуляции экспрессии генов, однако характеристики РНКазной активности протеасом изучены ещё очень мало. В данной работе мы исследовали способность компонентов 20S протеасомы к расщеплению индивидуальных РНК в различных условиях.

Эксперименты подтвердили наличие эндорибонуклеазной активности у субъединиц 5 и 1, а также позволили предположить её присутствие и у субъединицы 7. Кроме того удалось выявить зависимость способности этих субъединиц к расщеплению РНК от статуса их фосфорилирования и присутствия в реакционной среде двухвалентных катионов.

УДК: 579.8. ФЕНОМЕНОЛОГИЯ МИКОПЛАЗМЕННЫХ ИНФЕКЦИЙ РАСТЕНИЙ: ОСОБЕННОСТИ УЛЬТРАСТРУКТУРЫ КЛЕТОК VIGNA RADIATA L., ИНФИЦИРОВАННЫХ MYCOPLASMA GALLISEPTICUM S А.А. Музыкантов, Е.Н. Антуфьева, А.А. Пономарева Казанский институт биохимии и биофизики КазНЦ РАН, Казань В результате наших исследований впервые показано, что клетки Mycoplasma gallisepticum S6 (возбудитель респираторных микоплазмозов птиц, контаминант вирусных вакцин) способны инфицировать растения Vigna radiata L. – проникать в растения через корневую систему, распространяться по тканям и вызывать патологические, характерные для фитомикоплазмозов, изменения ультраструктуры их клеток. При этом заражение V. radiata L.

адаптированными формами M.gallisepticum S6 (клетки, образующиеся в неблагоприятных условиях роста) вызывает более выраженный фитопатогенный эффект, чем заражение растений неадаптированными формами микоплазмы (клетки, образующиеся в оптимальных условиях роста). Выявление у M.gallisepticum S6 фитопатогенных свойств определяет необходимость нового подхода к исследованиям молекулярных основ взаимодействия этой микоплазмы с высшими эукариотами и индукции фитоплазмозов.

ПОЛУЧЕНИЕ РЕКОМБИНАНТНОГО ШТАММА PICHIA RASTORIS, НЕСУЩЕГО ГЕНЕТИЧЕСКУЮ КОНСТРУКЦИЮ ДЛЯ ПРОДУКЦИИ РАСТВОРИМОГО РЕЦЕПТОРА ИНТЕРЛЕЙКИНА-2 ЧЕЛОВЕКА Новикова С.В.

Нижегородский государственный университет им. Н.И. Лобачевского, Нижний Новгород С использованием технологии рекомбинантных ДНК получен рекомбинантный штамм дрожжей Pichia pastoris, несущий генетическую конструкцию для продукции растворимой формы CD25 антигена человека.

УДК 577. ТРАНСКРИПЦИОННАЯ РЕГУЛЯЦИЯ ГЕНОВ БИОСИНТЕЗА ЭКТОИНА У ГАЛОАЛКАЛОФИЛЬНОГО МЕТАНОТРОФА METHYLOMICROBIUM ALCALIPHILUM 20Z Мустахимов И.И., Решетников А.С., Хмеленина В.Н.

Институт биохимии и физиологии микроорганизмов РАН, Пущино, Россия;

Пущинский государственный университет, Пущино, Россия.

Осмоадаптация микроорганизмов включает накопление в клетках органических осмопротекторов, в частности, эктоина. Механизмы регуляции на уровне транскрипции генов биосинтеза эктоина (ectABC) не исследованы.

Методом инвертированной ПЦР определена нуклеотидная последовательность гена ectR, расположенного в дивергентном направлении от ect-оперона, кодирующего ферменты биосинтеза эктоина у галоалкалофильного метанотрофа Methylomicrobium alcaliphilum 20Z.

Продуктом этого гена является белок, проявляющий гомологию с транскрипционными регуляторами MarR-семейства. Методом задержки в геле показано, что белок EctR связывается с фрагментом ДНК M. alcaliphilum 20Z, содержащим промоторную область ect-оперона. Картирование сайта узнавания ДНК белком-регулятором EctR показало, что EctR связывается с асимметричным участком ДНК длиной 27 п.н., содержащим предполагаемую -10 последовательность промотора ectР1.

УДК 575.113:57.032:576. КЛОНИРОВАНИЕ ЧЕЛОВЕЧЕСКИХ ГЕНОВ OCT4, SOX2, CMYC И KLF4, ИСПОЛЬЗУЕМЫХ ДЛЯ ПОЛУЧЕНИЯ ИНДУЦИРОВАННЫХ ПЛЮРИПОТЕНТНЫХ СТВОЛОВЫХ КЛЕТОК Парпиева С.Ш.1, Шафигуллина А.К. 2, Кудряшова Н.B.1, Блатт Н.Л. 1, Киясов А.П. 2, Исламов Р.Р. 2, Ризванов А.А.1, Казанский государственный университет, г. Казань;

Казанский государственный медицинский университет, г. Казань Введение Актуальность разработки методов генно-клеточной терапии для лечения различных заболеваний человека очевидна. Как известно, эмбриональные стволовые клетки являются недифференцированными (ЭСК) предшественниками множества клеток взрослого организма, т.е. по своей природе они плюрипотентны и при введении in vivo способны мигрировать к органу с нарушенной функцией, участвуя в процессах регенерации [1]. Но работы по исследованию ЭСК очень ограничены во многих странах мира, что связано с многочисленными политическими, религиозными и биоэтическими проблемами. Под сомнение, в первую очередь, ставится этичность использования стволовых клеток, как в исследовательских, так и в терапевтических целях [2]. В связи с этим, альтернативой ЭСК могут стать индуцированные плюрипотентные стволовые клетки (induced pluripotent stem cells - iPS клетки), обладающие всеми характеристиками ЭСК. Получение iPS клеток возможно путем репрограммирования соматических клеток методом генетической модификации транскрипционными факторами Oct4, Sox2, cMyc и Klf4, основная функция которых состоит в поддержании клеток в недифференцированном пролифилирующем состоянии [3]. Детальное изучение биологических свойств клеток, механизмов их iPS дифференцировки с последующим допуском к использованию в клинической практике осуществило бы настоящий прорыв в аутологичной трансплантологии, решив проблему источника клеточного материала для различных биомедицинских приложений и проблему гистосовместимости, поскольку исходные соматические клетки получают от самого донора.

Проводимые в настоящее время эксперименты по репрограммированию соматических клеток основаны на использовании ретровирусных экспрессионных систем. Это связано с созданием на их основе эффективных векторов для стабильной генетической модификации, поскольку ретровирусы интегрируют в геном клетки-хозяина, стабильно реплицируясь с ним и не проявляют цитопатического действия на клетку. Но, интегрированный провирус может вызвать спонтанную активацию, либо инактивацию гена в кодирующей или регуляторной областях, что, в свою очередь, способно изменить нормальный статус клетки и направить ее по пути злокачественного перерождения [4]. Поэтому очевидна необходимость разработки биологически безопасных способов невирусной доставки генетической информации в клетки. Целью данной работы является клонирование человеческих генов Oct4, Sox2, cMyc и Klf4 в экспрессионные плазмидные векторы для исследования из влияния на дифференцировку соматических клеток.

Клонирование генов Oct4, Sox2, cMyc и Klf4 в плазмидные векторы pcDNA 3.1 и pBudCE 4. Для получения человеческих генов Oct4, Sox2, cMyc и Klf4, мы выделяли мРНК из культуры человеческих клеток HeLa, А549 и ЭСК человека, т.к. в них уровень экспрессии данных транскрипционных факторов находится на высоком уровне. Выделенную мРНК использовали для проведения ОТ-ПЦР с использованием специфичных праймеров к мРНК соответствующего гена.

Прямые праймеры с 5’-конца имеют искусственно созданный сайт узнавания рестрикционного фермента, оптимизированную последовательность Козак, которая влияет на эффективность инициации трансляции мРНК, и старт кодон. Обратные праймеры с 5’-конца содержат сайт узнавания рестриктазой и терминирующий кодон. Метод, используемый нами для проведения ОТ ПЦР, позволил синтезировать цепь кДНК по матрице мРНК и осуществить ПЦР амплификацию кДНК в ходе одной реакции.

Продукты ПЦР амплификации первоначально клонировались в плазмиду pGEM-T Easy по технологии ТА-клонирования. Метод ТА-клонирования основывается на свойстве Taq полимеразы неспецифично присоединять единичный аденозин к 3’-концам ПЦР-продукта, который может быть использован для лигации с вектором, имеющим комплементарные выступающие 3’ Т концы. Продукты лигации трансформировали в компетентные клетки E.coli штамма XL1blue с помощью CaCl2 метода, а затем высеивали на селективные среды с антибиотиком ампицилином. Далее проводился ПЦР-скрининг колоний с использованием ПЦР праймеров, что и при постановке ОТ-ПЦР. Визуализацию ПЦР-позитивных клонов проводили методом электрофоретического разделения в агарозном геле в присутствии бромистого этидия на УФ трансиллюминаторе. Выделенную из трансформантов плазмидную ДНК подвергли автоматическому секвенированию, в результате чего были отобраны клоны идентичные последовательностям интересующих нас генов, полученных из базы данных GeneBank. На следующем этапе было проведено субклонирование генов из плазмиды pGEM-T Easy в экспрессионный вектор pcDNA 3.1. Для этого плазмиды pGEM-Oct4, pGEM-Sox2, pGEM-cMyc, pGEM-Klf4 и pcDNA 3. расщепляли уникальными эндонуклеазами рестрикции и по липким концам осуществляли лигацию. Плазмидные вектор pcDNA 3.1 позволяет экспрессировать рекомбинантные гены в эукариотных клетках под контролем непосредственно раннего промотера цитомегаловируса человека (immediate early CMV promoter). Трансформацию компетентных клеток и ПЦР-скрининг проводили аналогично вышеописанному методу для pGEM-T Easy.

Определение нуклеотидной последовательности фрагментов Oct4, Sox2, cMyc и Klf4 проводили на автоматическом секвенаторе с использованием стандартных праймеров T7 и BGH reverse, результаты которого подтвердили правильность полученных конструкций. Для получения плазмидных конструкций, одновременно экспрессирующих два трансгена, проводили субклонирование в экспрессионный плазмидный вектор pBudCE 4.1 (Рис 1).

Рис 1. Рестрикционные карты двухкассетных экспрессионных плазмид pBud Sox2-Oct4 (6608 п.н.) и pBud-cMyc-Klf4 (7381 п.н.) Данная плазмида содержит две экспрессионные кассеты и, также как и pcDNA 3.1, позволяет экспрессировать рекомбинантные гены в эукариотных клетках под контролем непосредственно раннего промотера цитомегаловируса человека и промотора фактора транскрипции EF1.

Заключение В ходе работы полученные генетические конструкции pcDNA-cMyc, pcDNA-Klf4, pcDNA-Sox2, pcDNA-Oct4, позволяющие экспрессировать соответствующие транскрипционные факторы в эукариотических клетках.

Кроме того, получены двухкассетные экспрессионные плазмиды pBud-cMyc Klf4 и pBud-Sox2-Oct4.

Полученные плазмидные векторы планируются использовать для изучения влияния исследуемых транскрипционных факторов на дифференцировку соматических клеток, а так же в экспериментах по котрансфекции с целью получения iPS клеток.

Благодарности Работа частично поддержана грантом РФФИ 08-04-01680-а “Изучение дедифференцировки гемопоэтических стволовых клеток пуповинной крови человека в плюрипотентные клетки методом генетической модификации факторами транскрипции Oct4, Sox2, cMyc и Klf4” и грантом НАТО NR.RIG.983007 “Combination gene and stem cell therapy for treating neurodegenerative diseases”. Благодарим Региональный центр коллективного пользования физико-химических исследований веществ и материалов (РЦКП ФХИ) при Казанском государственном университете за предоставление материально-технической поддержки. Коллектив авторов выражает благодарность Киселеву С. Л. за предоставление мРНК эмбриональных стволовых клеток человека.

Список литературы Киселев С.Л., Лагарькова М.А. Эмбриональные стволовые клетки 1.

человека // Природа. – 2006. - №10.

Репин. В.С., Ржанинова А.А., Шаменков Д.А. Эмбриональные стволовые 2.

клетки: фундаментальная биология и медицина // – М.: Изд-во Мир, 2003. – 348с.

3. Kazutoshi Takahashi, Koji Tanabe, Mari Ohnuki, Megumi Narita, Tomoko Ichisaka, Kiichiro Tomoda, Shinya Yamanaka. Induction of Pluripotent Stem Cells from Adult Human Fibroblasts by Defined Factors. // Cell. – 2007. - Р. 1-12.


Прасолов В.С., Иванов Д.С. Ретровирусные векторы в генной терапии // 4.

Вопросы медицинской химии. – 2000. - № 3.

УДК 577. СВОЙСТВА И РОЛЬ РЕКОМБИНАНТНОЙ ПИРОФОСФАТЗАВИСИМОЙ 6-ФОСФОФРУКТОКИНАЗЫ ТЕРМОТОЛЕРАНТНОГО ОБЛИГАТНОГО МЕТАНОТРОФА METHYLOCOCCUS CAPSULATUS BATH Розова О.Н.1,, Мустахимов И.И.1, Решетников А.С. 1. Пущинский государственный университет, Пущино 2. Институт биохимии и физиологии микроорганизмов РАН, Пущино rozovaolga1@rambler.ru Введение Облигатные метанотрофы – уникальная группа бактерий, использующих метан в качестве источника энергии и углерода. Метанотрофы представлены тремя основными типами, различающимися организацией конструктивного метаболизма. Метанотрофы I типа ассимилируют С1-субстрат на уровне формальдегида рибулозомонофосфатным (РМФ) путем, представители II типа – сериновым путем, а метанотрофы X типа реализуют одновременно три пути С1-ассимиляции - РМФ, сериновый и рибулозобисфосфатный. У всех метанотрофов обнаружена активность пирофосфатзависимой 6 фосфофруктокиназы (ПФК), обратимо катализирующей одну из ключевых стадий гликолиза/глюконеогенеза, однако этот фермент отсутствует у не растущих на метане метилобактерий, за исключением Amycolatopsis methanolica [1] и Methylibium petroleiphilum [4]. Предполагается, что функция ПФК не связана непосредственно с путями ассимиляции С1-субстрата, но важна при росте на метане. Логично полагать, что определение организации генов pfk у метанотрофов, их филогенетический анализ, а также изучение свойств фермента предоставят новую информацию, способствующую выяснению эволюции и роли ПФК в метаболизме этих бактерий. Доступность аннотированного генома метанотрофа Х типа Mc. capsulatus Bath позволила нам использовать основанную на клонировании и экспрессии в E. coli методологию получения и очистки ПФК. В задачи данной работы входили биохимическая и филогенетическая характеристика ПФК-His6-tag Mc.

capsulatus Bath.

Результаты Анализ генома M. capsulatus Bath выявил одну копию гена pfк (1263 п.н.) и отсутствие гена АТФ-зависимой 6-фосфофруктокиназы. Ген pfк Mс.

capsulatus Bath кодирует полипептидную цепь из 420 аминокислот с рассчитанной молекулярной массой субъединицы – 45,3 кДа.

Ген pfк Mc. capsulatus Bath клонирован в вектор pET22b+ и экспрессирован в E. coli BL21(DE3). С помощью аффинной хроматографии на Ni-NTA-агарозе получен гомогенный препарат ПФК-His6-tag с удельной активностью 7,6 Е/мг белка и электрофоретической подвижностью субъединицы 45 кДа. Методом нативного градиентного электрофореза установлена Мr фермента – 90 кДа, таким образом, ПФК Mc. capsulatus Bath является гомодимером. Активность ПФК зависит от присутствия ионов Mg2+, однако Co2+ и Mn2+ (10 µM) способны заменять Mg2+ (с активностью 63% и 48%, соответственно). Полученные кинетические параметры фермента согласуются с данными для ПФК из других микроорганизмов, за исключением высокого значения Км к фруктозо-6-фосфату (2,27 мМ) (табл.

1). Тестирование потенциальных эффекторов (пирувата, цитрата, фосфоенолпирувата, АТФ, АДФ, АМФ, НАДФ, НАД и НАДФН) показало отсутствие аллостерической регуляции ПФК. Следовательно, функционирование фермента в прямом или обратном направлении регулируется на уровне концентрации субстратов и продуктов.

ПФК Mc. capsulatus Bath строго специфична к ФФн в качестве донора фосфатной группы, но проявляет активность с седогептулозо-7-фосфатом (Км – 0,03 мМ), а также с рибулозо-5-фосфатом (Км – 4,05 мМ) в качестве акцепторов фосфата. Инкубация ПФК с седогептулозо-1,7-бисфосфатом ( мМ) или рибулозо-1,5-бисфосфатом (5 мМ) в присутствии 15 мМ NaH2PO приводила к образованию ФФн. Таким образом, реакции с С7- и С5 – фосфосахарами также обратимы. Интересно отметить, что активность ПФК из M. methanica 12 с седогептулозо-7-фосфатом составила тысячные доли от активности с фруктозо-6-фосфатом. Предположено, что различные свойства ПФК M. methanica 12 и Mc. capsulatus Bath связаны с реализацией разных путей С1-ассимиляции и различной функцией фермента у этих метанотрофов.

Наличие малого межгенного участка между геном pfk и следующей за ним ОРС (2133 п.н.), продукт которой гомологичен Н+-пирофосфатазе V-типа из Geobacter sulfureducens и Rhodospirillum rubrum (62 и 58% идентичности транслированной аминокислотной последовательности, соответственно). С помощью ОТ-ПЦР показано, что гены pfк и hpp находятся в одном опероне.

Методом удлинения праймера определена стартовая точка транскрипции, находящаяся на 30 нуклеотидов выше от стартового кодона гена pfк. Анализ нуклеотидной последовательности Mc. capsulatus Bath выше стартовой транскрипционной точки обнаружил области предполагаемых прокариотных промоторов (-10 TAAGTT и -35 TTGTAA, рис. 1).

Таблица 1. Основные свойства ПФК различных микроорганизмов Мethylomonas Amycolatopsis Dictyoglomus Methylococcus Параметры methanica methanolica thermophilum capsulatus [3] [1] [5] [данная Vmax, Е/мг:

Прямая 840 107 6,2 7, реакция Обратная н.о.

850 0,6 7, реакция Км, мМ:

ФФн 0,051 0,2 0,022 0, Фруктозо-6- 0,39 0,4 0,228 2, Ф Фн 1,7 0,84 4,1 8, Фруктозо- 0,1 0,025 2,9 0, 1,6-Ф Mg2+:

В прямой н.о.

0,038 0,04 0, реакции В обратной н.о.

0,35 0,77 реакции Mr, кДа 92 170 74,8 Число 2х45 4х45 2х37,4 2х субъединиц Оптимум pH 8,0 7,5 5,7-6,3/7-7,5 7, Оптимум температуры, н.о.

40 35-46 °C Эффекторы нет Нет н.о. нет -35 - AGACGTGCGGGTCGAAACTTGTTGTAACGGAGGGGGCGTTTGTTCTAAGTTAGGCG +1 pfk CCAGCCAACGATACTCAAAGGGGAGGCGGTTCATGGCGGCGCGGAATGCTTTCTAT MAA RNA FY Рис. 1. Промоторная область оперона pfk-pph.

Предполагаемая последовательность Шайн-Дальгарно выделена курсивом, стрелкой указан +1 нуклеотид мРНК.

Следующий за стоп-кодоном гена hpp инвертированный повтор предположительно формирует шпильку (5’-cctcctgcctcctccgcccggcgggaggg-3’, свободная энергия G=-18.3 кКал/моль). Этот участок похож на ро независимый транскрипционный терминатор с ГЦ-богатой основой. Однако полиТ последовательность в ДНК отсутствует. Анализ эволюционных взаимосвязей между ПФК из Mc. capsulatus Bath и других организмов выявил, что ПФК Mc. capsulatus Bath относится к подгруппе В2 фосфофруктокиназ II типа, согласно предложенной классификации [2].

ПФК из Mc. capsulatus Bath имеет высокий процент гомологии с ферментами из нитрифицирующих бактерий Nitrosomonas europaea и Nitrosospira multiformis (74 и 73% идентичности, соответственно), а также из факультативного метилотрофа Methylibium petroleiphilum PM1 (71%). У этих бактерий имеются черты сходства как в конструктивном, так и энергетическом обмене. Первый этап окисления метана у метанотрофов катализирует метанмонооксигеназа, а окисления NH+4 у нитрификаторов – аммониймонооксигеназа, в свою очередь, у M. petroleiphilum PM1 имеется толуолмонооксигеназа. Эти ферменты требуют для активности НАДН или восстановленных компонентов дыхательной цепи (цитохром сН). Возможно, данная особенность организации дыхательной цепи у этих бактерий обуславливает наличие АТФ-сберегающего фермента. Кроме того, они реализуют РБФ-цикл С1-ассимиляции. Высокий процент сходства генов pfk филогенетически удаленных бактерий, имеющих общие метаболические черты, позволяет предполагать аналогичные функции, а также латеральный перенос генов ПФК. В то же время, значительная дивергенция ПФК Mc.

capsulatus Bath и M. methanica 12 (16% идентичности аминокислотной последовательности) может отражать независимое происхождение фермента у метанотрофов, подтверждая гипотезу о «сумасшедшем» горизонтальном переносе генов фосфофруктокиназ [2] и указывая на значительную роль ПФК в метаболизме метана.

Работа выполнена при поддержке грантов РФФИ 08-04-01484а и РНП 2.1.1. Литература 1. Alves A.M.C.R., Euverink G.J.W., Hektor H.J., Hessels G.I., J. van der Vlag, Vrijbloed J.W., Hondmann D., Visser J., Dijkhuizen L. Enzymes of glucose, methanol metabolism in the actinomycete Amycolatopsis methanolica//J.

Bacteriol. -1994. - V. 176. №22. P.6827-6835.

2. Bapteste E., D. Moreira, and H. Philippe. Rampant horizontal gene transfer and phospho-donor change in the evolution of the phosphofructokinase//Gene 2003.- V. 318. P. 185-191.

3. Beschastny, A.P., A.P. Sokolov, V.N. Khmelenina, and Y.A. Trotsenko..

Purification and properties of pyrophosphate-dependent phosphofructokinase of obligate methanotroph Methylomonas methanica//Biochemistry (Moscow) 1992.- V. 57. Р. 1215-1221.

4. Kane, S. R., A.Y. Chakicherla, P.S.G. Chain, R. Schmidt, M.W. Shin, T.C.

Legler, K.M. Scow, F.W. Larimer, S.M. Lucas, P.M. Richardson, and K.R.

Hristova. Whole-genome analysis of the methyl tert-butyl ether-degrading beta-Proteobacterium Methylibium petroleiphilum PM1//J. Bacteriol.- 2007. V. 189. P. 1931-1945.

5. Ronimus, R.S., and H.W. Morgan. The biochemical properties and phylogenies of phosphofructokinases from extremophiles//Extremophiles -2001.- V. 5. P.

357–373.

УДК 576, МОЛЕКУЛЯРНЫЕ ОСНОВЫ УСТОЙЧИВОСТИ МИКОПЛАЗМ (ACHOLEPLASMA LAIDLAWII PG8) К ОКИСЛИТЕЛЬНОМУ СТРЕССУ А.И. Сорвина, Е.С. Медведева Казанский институт биохимии и биофизики КазНЦ РАН, Казань Большой интерес к системе образования и метаболизации активных форм кислорода (АФК) у микоплазм связан с уникальными способностями этих бактерий преодолевать окислительный стресс. Нами впервые показано, что несмотря на отсутствие у Acholeplasma laidlawii PG8 каталазы и пероксидазы клетки микоплазмы отличаются высокой устойчивостью к Н2О2.

Результаты биохимического, геномного и протеомного анализов A.laidlawii PG8 свидетельствуют о наличии у микоплазмы тиоредоксина – белка, играющего важную роль в поддержании восстановленных условий клеточной среды у про- и эукариот. Данные протеомного анализа клеток A.laidlawii PG свидетельствуют также о возможности изменений структуры и/или экспрессии тиоредоксина при адаптации микоплазмы к стрессорам.


УДК 616.155.11: [616.98:578.828.6] ХАРАКТЕР АЛЬТЕРНАТИВНОГО СПЛАЙСИНГА мРНК, КОДИРУЮЩИХ РАСТВОРИМЫЕ ФОРМЫ FAS-АНТИГЕНА, ПРИ РАКЕ ТОЛСТОГО КИШЕЧНИКА Н.А. Сахарнов ННГУ им. Н.И. Лобачевского, Нижний Новгород Fas (CD95) - антиген является одним из мембранных рецепторов, передающих цитотоксический сигнал в клетку-мишень при связывании со специфическим лигандом. В нашей работе установлено, что клетках крови больных раком толстого кишечника экспрессируется широкий спектр форм мРНК Fas–антигена, среди которых преобладает мембранная форма.

Выявлено, что количественное содержание мРНК доминирующей растворимой формы FasTMdel преобладает над мембранной в 22 раза.

УДК 579. БИОКАТАЛИТИЧЕСКОЕ РАЗДЕЛЕНИЕ (R, S)-АЦЕТАТА ПАНТОЛАКТОНА С ИСПОЛЬЗОВАНИЕМ АКТИНОБАКТЕРИЙ РОДА RHODOCOCCUS Н.М. Субботина Пермский государственный университет Проведен скрининг штаммов актинобактерий из Региональной профилированной коллекции алканотрофных микроорганизмов, способных к гидролизу межмолекулярной сложноэфирной связи ацетата пантолактона.

Среди коллекционных культур выявлены наиболее активные продуценты карбоксильных эстераз. Подобраны оптимальные условия региоселективного 50%-ного расщепления (R, S)-ацетата пантолактона.

ХАРАКТЕРИЗАЦИЯ ДИКИХ И МУТАНТНЫХ ФОРМ НЕКОТОРЫХ ФЕРМЕНТОВ ПОДСЕМЕЙСТВА CYP74С ЦИТОХРОМОВ Р Я. Ю. Топоркова, Н. В. Ланцова, И. Р. Чечеткин, Л. Ш. Мухтарова, Ф. К. Мухитова, Ю. В. Гоголев, А. Н. Гречкин В формировании системной устойчивости растений к патогенам важная роль принадлежит ферментам липоксигеназной сигнальной системы растений. Ключевыми ферментами системы являются цитохромы Р семейства СYP74, подразделяющиеся на четыре подсемейства: CYP74A и СYP74В, специфичные к 13-гидропероксидам жирных кислот, СYP74С, отдающие предпочтение, но не абсолютно специфичные к 9 гидропероксидам, и СYP74D, включающие ферменты обоих типов.

Объектами настоящего исследования были ферменты CYP74C алленоксидсинтаза томата и LeAOS3 (Lycopersicon esculentum) гидропероксидлиаза люцерны MtHPL (Medicago truncatula).

Анализ структуры оксигенированных жирных кислот, осуществленный методом газовой хромато-масс-спектрометрии, показал, что LeAOS соответствует классу цитохромов P450, однако обладает некоторыми уникальными особенностями. Основным продуктом реакции с [1 С](10E,12Z,9S)-9-гидроперокси-10,12-октадекадиеновой кислотой является типичный алленоксидсинтазный метаболит – (12Z)-9-гидрокси-10-оксо-12 октадеценовая кислота (-кетол), образующийся в результате гидролиза короткоживущей окиси аллена (10E,12Z)-9,10-эпокси-10,12-октадекадиеновой кислоты (9,10-ЭОД). Другим продуктом был простагландин-подобный оксилипин – 10-оксо-11-фитоеновая кислота (10-оксо-ФЕК), выход которого по отношению к -кетолу составлял 1:8. Образование этого оксилипина связано с циклизацией 9,10-ЭОД и является существенным отличием LeAOS от других известных алленоксидсинтаз, которые не способны катализировать образование 10-оксо-ФЕК.

Для определения роли отдельных аминокислот в природе катализа CYP74 значительную информацию дает метод сайт-направленного мутагенеза. Конформация и активность белков меняются при замене отдельных аминокислот в активном центре;

изменение функционально незначимых участков не сказывается на свойствах фермента.

Для изменения с помощью сайт-направленного мутагенеза выбирали аминокислоты, входящие в состав консервативных доменов, таких как кислород-связывающий (уникальным свойством для CYP74 является вырожденность этого домена) и пролиновый домены, примыкающие непосредственно к гемовому железу. Выбор проводили на основе сравнения последовательностей гомологичных ферментов, в частности Р450, для которых есть данные рентгеноструктурного анализа.

Были проведены следующие замены: K307S, D359R, F300I, S302A и T366Y в LeAOS3, N285A, G288I и F287V в MtHPL. Замена F287V в MtHPL привела к существенным изменениям в катализе. Мутантная форма F287V сохранила способность утилизировать 13-гидроперекись -линоленовой кислоты. Однако мутант F287V не обладал активностью гидропероксидлиазы.

Вместо этого мутант F287V катализировал превращение гидроперекиси в эпоксиспирт (9Z,15Z)-11-гидрокси-12,13-эпокси-9,15-октадекадиеновую кислоту. Полученные данные свидетельствуют о роли консервативных ароматических аминокислот в кислород-связывающем домене ферментов CYP74.

УДК 532.532. ANALYSIS OF INTERACTIONS BETWEEN CHROMATIN DOMAIN BOUNDARIES OF ABD-B GENE OF DROSOPHILA MELANOGASTER.

S. Toshchakov, O. Kyrchanova, P. Georgiev Institute of Gene Biology RAS Moscow Enhancers of higher eukaryotes can find and communicate with their target promoters over long distance. However, the mechanism of this specific interaction is still poorly understood. Also it’s little known about proteins providing such contacts.

One of the most useful systems for studying of enhancer action is regulatory region of Abd-B gene of Drosophila. Segment-specific pattern of expression of Abd-B is determined by four enhancers which are flanked by boundaries, such as Mcp, Fab- and Fab-8 [3]. It was described previously that Mcp boundary interact with its copy over 5 kb distance putting remote enhancer and promoter in the close proximity [2], [1].

Here we have tested the communication ability of different boundaries by transgenic assay using yeast GAL4 activator. Also we have investigated the possible role of dCTCF protein in realization of boundary-boundary interactions.

It was shown that Fab-7, Fab-8 and Mcp can effectively interact with its own copy over a 5 kb of spacer DNA and the interaction ability of Fab-8 strongly depends on the presence of dCTCF binding sites. Also we have observed that interaction between Fab-8 and Fab-7 boundaries can occur only if tested Fab- fragment contains adjacent sequence called PTS. Hence we suppose that dCTCF protein is necessary but not sufficient for the correct functioning of chromatin domain boundaries of Abd-B.

Literature [1] Kyrchanova O, Toshchakov S, Parshikov A, Georgiev P. Study of the functional interaction between Mcp insulators from the Drosophila bithorax complex: effects of insulator pairing on enhancer-promoter communication. Mol Cell Biol. 2007 Apr;

27(8):3035-43. Epub 2007 Feb 5.

[2] Gruzdeva N, Kyrchanova O, Parshikov A, Kullyev A, Georgiev P. The Mcp element from the bithorax complex contains an insulator that is capable of pairwise interactions and can facilitate enhancer-promoter communication. Mol Cell Biol.

2005 May;

25(9):3682-9.

[3] Maeda RK, Karch F. The ABC of the BX-C: the bithorax complex explained. Development. 2006 Apr;

133(8):1413-22.

УЧАСТИЕ ГУАНИЛСПЕЦИФИЧНЫХ РИБОНУКЛЕАЗ BACILLUS THURINGIENSIS И BACILLUS CIRCULANS В ОТВЕТЕ КЛЕТОК НА ФОСФАТНОЕ ГОЛОДАНИЕ В. В. Ульянова, В. И. Вершинина Казанский государственный университет, Казань В почве бациллы часто сталкиваются с недостатком доступной формы фосфора. Для его извлечения из альтернативных источников они секретируют комплекс ферментов. У B.subtilis их синтез в условиях фосфатного голодания (Pho ответ) контролируется несколькими системами: сигнальная система PhoP-PhoR непосредственно регулирует экспрессию генов, индуцируемых фосфатным голоданием, белок переходного состояния AbrB и сигнальная система ResD-ResE, отвечающая за контроль процессов дыхания, являются активаторами системы PhoP-PhoR, а основной регулятор спорообразования Spo0A – ее репрессором. Ранее было показано, что синтез гуанилспецифичных рибонуклеаз B.thuringiensis (РНКазы Bth) и B.circulans (РНКазы Bci) осуществляется при снижении концентрации фосфора в окружающей среде до критических значений. Однако экспрессия гена РНКазы Bci в рекомбинантных штаммах B.subtilis, в отличие от таковой РНКазы Bth, не подвержена влиянию сигнальной системы PhoP-PhoR. В связи с этим целью настоящей работы явилось установление роли других регуляторов, вовлеченных в специфичный Pho ответ, в контроле экспрессии генов рибонуклеаз B.thuringiensis и B.circulans - сигнальной системы ResD ResE, а также Spo0A и AbrB белков.

В работе использовали нативный (контроль) и дефектные по ResE, ResD, Spo0A белкам штаммы B.subtilis, а также двойной spo0A/abrB мутант.

Указанные штаммы были трансформированы плазмидами pMZ58 и pMZ59, несущими полные гены гуанилспецифичных РНКаз Bth и Bci, соответственно, состыкованные с геном внутриклеточного ингибитора барстара. Плазмиды сохранялись в рекомбинантных штаммах в течение всего срока наблюдения (35 генераций). Все рекомбинантные штаммы активно синтезировали рибонуклеазу на бесфосфорной синтетической среде, однако уровень ее активности был различен. В штаммах с мутациями в генах resD и resE активность РНКазы Bth была снижена по сравнению с нативным штаммом на 94% и 14%, соответственно, в то время как в spo0A мутантах она в 3 (spo0A/abrB) и 5 (spo0А) раз превышала контрольное значение. Во всех штаммах, несущих плазмиду pMZ59 с геном РНКазы Bci, уровень РНКазной активности был сопоставим с контролем.

Таким образом, полученные данные свидетельствуют о том, что белок Spo0A негативно, а система ResD-ResE и белок AbrB позитивно контролируют экспрессию гена РНКазы Bth в клетках B.subtilis, в то время как синтез РНКазы Bci не подвержен влиянию со стороны этих регуляторов.

Следовательно, рибонуклеаза B.thuringiensis является членом Pho регулона, осуществляющего специфичный ответ клеток на фосфатное голодание, а рибонуклеаза B.circulans, по-видимому, участвует в неспецифичном Pho ответе, опосредованным общестрессовым сигма фактором В.

УЧАСТИЕ АДАПТИВНОГО МУТАГЕНЕЗА В РАЗВИТИИ УСТОЙЧИВОСТИ К КАНАМИЦИНУ У SALMONELLA TYPHIMURIUM Л. С. Ушакова, Э. В. Бабынин Казанский государственный университет Исследовали зависимость появления устойчивых к канамицину мутантов (KanR) у Salmonella typhimurium от концентрации антибиотика в среде, а также от типа среды. Полученные нами результаты указывают на возможность возникновения резистентных к канамицину мутантов в ответ на воздействие антибиотиком. Установлено действие этилметансульфоната (ЭМС) на появление антибиотикоустойчивых мутантов в условиях контакта с антибиотиком. Показано, что на среде с канамицином ЭМС вызывает повышение частоты KanR мутантов. Эти факты указывают на возможное участие адаптивного мутагенеза в развитии у бактерий устойчивости к антибиотикам.

УДК 579. ВЫСОКОТЕМПЕРАТУРНЫЙ СТРЕСС АКТИВИРУЕТ СИНТЕЗ ОКСИДА АЗОТА (NO) У LACTOBACILLUS PLANTARUM Д. Р. Яруллина, О. А. Смоленцева, О. Н. Ильинская Казанский государственый университет, г. Казань На примере NO-синтазной активности L. plantarum 8Р-А3 показано, что при высокотемпературном воздействии происходит увеличение продукции оксида азота, указывающее на участие микробного NO в стресс-реакциях бактерий и позволяющее рассматривать оксид азота как универсальный фактор стрессорного и адаптивного ответов клеток различного уровня организации.

УДК 579.873.6.017. СВЕТОКОРРЕКТИРУЮЩИЕ ПОЛИМЕРНЫЕ ПЛЕНКИ ДЛЯ СТИМУЛЯЦИИ ДЕСТРУКТИВНОЙ АКТИВНОСТИ МИКРООРГАНИЗМОВ НЕФТЕЗАГРЯЗНЕННЫХ ПОЧВ Филатов Д.А., Сваровская Л.И., Л.К. Алтунина Институт химии нефти СО РАН, г. Томск, Россия В полевых условиях исследовано влияние полиэтиленовых пленок с фотолюминесцентными свойствами на рост и оксигеназную активность микрофлоры загрязненных почв. Изучен стимулирующий эффект пленок на биоценоз нефтезагрязненных почв в концентрации 5 %. При этом численность основных групп аборигенной микрофлоры увеличивается на 2- порядка. Увеличение численности сопровождается повышением оксигеназной активности микроорганизмов. В конце опыта через 80 суток остаточное содержание нефти понижается на 96 %. Хроматографический анализ остаточных насыщенных углеводородов показал, что полностью элиминировали легкие углеводороды С9-С14, на 85-90 % уменьшилась концентрация углеводородов с большим молекулярным весом. Процессы деструкции затронули моно-, би- и триароматические соединения нефти. При этом коэффициент биодеструкции углеводородов нефти, определяемый по отношению суммы н-алканов (С17+ С18) к сумме изоалканов (пристан+фитан), увеличивается в 4-5 раз.

Симпозиум: «Биохимия, физиология растений и биотехнологии, нанотехнологии»

УДК 581. РЕЮВЕНИЛИЗАЦИЯ ДЛИТЕЛЬНО КУЛЬТИВИРУЕМЫХ КАЛЛУСОВ ГРЕЧИХИ ТАТАРСКОЙ А. А. Бетехтин, Н. И. Румянцева Казанский институт биохимии и биофизики КазНЦ РАН, Казань Исследовали процессы дедифференциации и дифференциации в морфогенном каллусе (МК) Fagopyrum tataricum. Установлено, что образование проэмбриональных клеточных комплексов (ПЭКК) и соматических зародышей (СЗ) происходит из одних и тех же инициалей.

Показано, что начальные стадии формирования СЗ в МК гречихи татарской не зависят от минерального состава среды и гормонов. Продемонстрирована возможность реювенилизации длительно культивируемых каллусов гречихи татарской через процесс дедифференциации соматических зародышей.

УДК 544.653:577.323. ПОЛУЧЕНИЕ И ХАРАКТЕРИСТИКА КОМПЛЕКСОВ ЗОЛОТЫХ НАНОЧАСТИЦ С БЕЛКАМИ О.В. Бондарь, И.И. Никитина, Э.Р. Булатов, А.А. Ризванов, М.В. Морозов*, А.Х. Гильмутдинов*, Ф.К. Алимова, Т.И. Абдуллин Казанский государственный университет, биолого-почвенный факультет * Казанский государственный университет, физический факультет, г.

Казань, о.v.bondar@mail.ru Золотые наночастицы, обладающие выраженными оптическими и электрохимическими свойствами, широко используют в качестве меток для создания чувствительных методов анализа биомолекул с использованием биосенсоров и биочипов. В частности, оптические свойства золотых наночастиц в видимой области спектра, основанные на явлении плазмонного резонанса, можно использовать как для обнаружения наночастиц, так и для детектирования биоафинных взаимодействий на их поверхности по изменению спектральных характеристик. Поэтому разработка и оптимизация методов синтеза, тестирования золотых наночастиц и получения их комплексов с биоспецифичными молекулами представляет значительный интерес.

В настоящем исследовании синтезированы препараты коллоидного золота размером от до нм путем восстановления 13 золотохлористоводородной кислоты цитратом натрия. Размер наночастиц оценивали по максимуму поглощения и данным атомно-силовой микроскопии.

Оптимизированы способы получения комплексов золотых наночастиц с иммуноглобулинами G кролика, авидином и протеином А посредством адсорбции белка на поверхности наночастицы. Исследованы условия стабилизации наночастиц белками при солевой агрегации по изменению спектра поглощения в диапазоне 500-600 нм. Комплексы охарактеризованы с использованием электрофореза в агарозном и полиакриламидном гелях и атомно-силовой микроскопии.

Полученные комплексы золотых наночастиц с биоспецифичными белками могут быть использованы в качестве меток для определения диагностически значимых антител и антигенов с помощью оптических и электрохимических иммунохимических сенсоров.

УДК 581.1:576.32/36:581. ИЗМЕНЕНИЕ РАДИАЛЬНОЙ САМОДИФФУЗИИ ВОДЫ В КОРНЯХ ОЗИМОЙ ПШЕНИЦЫ ПРИ ДЕЙСТВИИ ОРИЗАЛИНА И ДЛИТЕЛЬНОМ ИЗМЕРЕНИИ: ДАННЫЕ ЯМР ИССЛЕДОВАНИЙ М.А.Бочкарева, В.А.Тюрин, А.И.Маклаков, Л.П.Хохлова Казанский государственный университет Методом ЯМР с импульсным градиентом магнитного поля изучали радиальную самодиффузию молекул воды в зонах растяжения и дифференциации корней проростков озимой пшеницы при действии ингибитора полимеризации тубулиновых белков (оризалина) и при разных временах диффузии. Обнаружено оризалин-индуцированное увеличение коэффициентов диффузии промежуточной D2 и быстро затухающей D3 компонент диффузионного затухания. Эффект связывается с обусловленным разрушением цитоскелетных структур усилением обмена воды по градиенту водного потенциала между цитоплазмой (D2), вакуолью и апопластом (D3) через трансмембранные водные каналы (аквапорины). Обнаружена зависимость коэффициентов диффузии и населенностей промежуточной и быстро затухающей компонент от продолжительности эксперимента, имеющая ярко выраженный максимум, который при длительном измерении смещается с увеличением времени диффузии.

УДК 581. ФИЗИОЛОГО-БИОХИМИЧЕСКИЕ ОТВЕТЫ ЛИСТЬЕВ ТРЁХ СОРТОВ ЯРОВОЙ ПШЕНИЦЫ НА ОБЕЗВОЖИВАНИЕ Бояршинов А. В., Картунова Ю. Е., Боброва З.С., Асафова Е. В.

Казанский государственный университет Исследовали физиологические и биохимические стрессовые ответы листьев трёх сортов яровой пшеницы на обезвоживание. Установлено, что листья 7-суточных проростков различаются по водоудерживающей способности и по количеству накапливаемого в ходе обезвоживания H2O2.

Выявлены сортовые особенности в изменении активности антиоксидантных ферментов аскорбатпероксидазы и каталазы. На основании полученных данных сделано предположение о различии адаптивных стратегий растений изучаемых сортов в условиях обезвоживания.

УДК 544.478. ИММОБИЛИЗАЦИЯ ПЕРОКСИДАЗЫ НА УГЛЕРОДНЫХ НАНОТРУБКАХ Э.Р. Булатов, О.В. Бондарь, И.И. Никитина, Т.И. Абдуллин Казанский государственный университет, г. Казань, emilbulatov@rambler.ru Получены водорастворимые углеродные нанотрубки, содержащие карбоксильные группы. Активация нанотрубок карбодимидом применена для ковалентной иммобилизации пероксидазы на их поверхности. Предложены подходы по выделению конъюгатов нанотрубок с пероксидазой и их характеристике. Разработанный способ можно использовать в биотехнологии для получения стабилизированных препаратов ферментов.

Введение Получение стабилизированных препаратов ферментов – актуальная задача современной биотехнологии, для решения которой биокатализатор обычно иммобилизуют на полимерном носителе. Использование наноматериалов, обладающих необычными структурными свойствами, для иммобилизации ферментов является перспективным подходом в создании эффективных ферментных препаратов нового поколения.

Среди таких наноматериалов особый интерес представляют углеродные нанотрубки (УНТ), обладающие высокоорганизованной наноструктурой, большой площадью поверхности и совместимостью с биомолекулами и клетками [1]. В настоящем исследовании разработан способ ковалентной иммобилизации фермента пероксидазы на поверхности водорастворимых многостенных УНТ, приготовленных посредством химического окисления [2,3].

Экспериментальная часть В работе использовали многостенные углеродные нанотрубки, 1-этил-3 и сульфо-N (3-диметиламинопропил)-карбодиимид (EDC) гидроксисукцинимид (sulfo-NHS), произведенные Sigma-Aldrich, а также пероксидазу корней хрена (Serva Heidelberg). Химическую активацию предварительно окисленных УНТ и их сшивку с пероксидазой проводили в буферном растворе морфолиноэтансульфоновой кислоты (MES-буфере 0. М, рН=6.2), приготовленном на очищенной воде Milli-Q. Концентрацию УНТ оценивали спектрофотометрически на приборе СФ-26 (ЛОМО) по их поглощению при 260 нм и выражали в ед. оптической плотности.

Использовали раствор окисленных УНТ с оптической плотностью 50 опт.ед.

Концентрация активирующих реагентов EDC и sulfo-NHS в реакционном растворе составляла 50 mM, гидрохинона - 25 mM, пероксидазы - 1 мг/мл.

Для уменьшения неспецифической адсорбции фермента на УНТ в раствор добавляли поверхностно-активное вещество Tween-20.

Пероксидазную активность в растворе определяли по накоплению окрашенного продукта ферментативного окисления о-дианизидина (0, мг/мл), регистрируемого спектрофотометрически при 460 нм.

Результаты и обсуждение Окисление УНТ смесью серной и азотной кислот (3:1) приводит к появлению на поверхности УНТ карбоксильных групп, которые далее можно активировать карбодиимидом для последующего связывания с лигандами, содержащими аминогруппы [3]. Механизм соответствующей реакции рассмотрен в [4].

Ниже приведены схемы реакций УНТ и пероксидазы.



Pages:   || 2 | 3 | 4 |
 





 
© 2013 www.libed.ru - «Бесплатная библиотека научно-практических конференций»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.