авторефераты диссертаций БЕСПЛАТНАЯ БИБЛИОТЕКА РОССИИ

КОНФЕРЕНЦИИ, КНИГИ, ПОСОБИЯ, НАУЧНЫЕ ИЗДАНИЯ

<< ГЛАВНАЯ
АГРОИНЖЕНЕРИЯ
АСТРОНОМИЯ
БЕЗОПАСНОСТЬ
БИОЛОГИЯ
ЗЕМЛЯ
ИНФОРМАТИКА
ИСКУССТВОВЕДЕНИЕ
ИСТОРИЯ
КУЛЬТУРОЛОГИЯ
МАШИНОСТРОЕНИЕ
МЕДИЦИНА
МЕТАЛЛУРГИЯ
МЕХАНИКА
ПЕДАГОГИКА
ПОЛИТИКА
ПРИБОРОСТРОЕНИЕ
ПРОДОВОЛЬСТВИЕ
ПСИХОЛОГИЯ
РАДИОТЕХНИКА
СЕЛЬСКОЕ ХОЗЯЙСТВО
СОЦИОЛОГИЯ
СТРОИТЕЛЬСТВО
ТЕХНИЧЕСКИЕ НАУКИ
ТРАНСПОРТ
ФАРМАЦЕВТИКА
ФИЗИКА
ФИЗИОЛОГИЯ
ФИЛОЛОГИЯ
ФИЛОСОФИЯ
ХИМИЯ
ЭКОНОМИКА
ЭЛЕКТРОТЕХНИКА
ЭНЕРГЕТИКА
ЮРИСПРУДЕНЦИЯ
ЯЗЫКОЗНАНИЕ
РАЗНОЕ
КОНТАКТЫ


Pages:     | 1 |   ...   | 2 | 3 || 5 |

«АГРАРНАЯ НАУКА — СЕЛЬСКОМУ ХОЗЯЙСТВУ СЕМИНАР — КРУГЛЫЙ СТОЛ 9. АКТУАЛЬНЫЕ ПРОБЛЕМЫ ВЕТЕРИНАРНОЙ ...»

-- [ Страница 4 ] --

1. Проведенный микроструктурный анализ фаршей полуфабрикатов, приобретенных в тор говой сети городов Чернигова, Киева и Сум, показал, что во всех случаях имело место нару шение технологии изготовления данных продуктов.

2. Исследуемая пищевая продукция не отвечала указанной рецептуре по одному или не скольким показателям, а именно: высокосортное мясо было заменено консервированным, замороженным, субпродуктами. Также были обнаружены пищевые добавки, не указанные в рецептуре, такие как соевая мука, соевый изолированный белок, каррагенан.

Предложения:

- ввести в практику лабораторий ветеринарной медицины микроструктурный метод для ис следования сырья в мясных полуфабрикатах;

- ввести в учебный процесс факультетов ветеринарной медицины высших учебных заведе ний спецкурс «Технологическая гистология».

Библиографический список 1. Бем Р. Микроскопия мяса и сырья животного происхождения / Р. Бём, В. М. Плева // Пищевая промышленность, 1964. — 336 с.

2. Скалинский Е.И. Микроструктура мяса: Пищевая промышленность / Е.И. Скалинский, А.А Белоусов, 1978. — 175 с.

3. Коцюмбас Г.І. Мікроструктурна характеристика фаршу пельменівваспекті контролю якостіхарчовихпродуктів / Г.І. Коцюмбас, П.П. Урбанович, О.В. Мисів // Науковийвісник ЛНАВМ імені С.З. Гжицького. — 2004., Т-6 (№1), Ч.2. — С. 37-43.

4. Хвыля С.И. Структурно-функциональные особенности соевых белковых продуктов / С.И. Хвыля, В.А. Пчелкина // Мясной бизнес. — 2008, №7. — С. 24-28.

5. Хвыля С.И. Микроструктурный анализмяса и мясных продуктов / С.И. Хвыля, Т.М. Гиро. — Саратов, 2008. — 132 с.

УДК 619:636:631. Л.И. Теньковская Пермская государственная сельскохозяйственная академия им. Д.Н. Прянишникова, РФ, Tenkovskaya2010@mail.ru ПРОБЛЕМЫ ЭКОНОМИЧЕСКОЙ ЭФФЕКТИВНОСТИ ВЕТЕРИНАРНОГО ОБСЛУЖИВАНИЯ АПК Актуальность темы исследования. В условиях снижения объемов производства отечествен ной продукции животноводства, увеличения ее импорта повышается роль эффективного вете ринарного обслуживания сельскохозяйственных и перерабатывающих предприятий России.

Методы исследования: анализ, синтез, монографический, статистический.

Описание результатов исследования. За последние двадцать лет поголовьекрупного рога того скота в странеснизилось на 65%,врайонах с развитым скотоводством (Западно Сибирском, Уральском, Поволжском, Северо-Кавказском)- относительно меньшими темпами и составило в 2012 году 2646-3523тыс.

головили 13-18% общего поголовья крупного рогатого скота.В сельскохозяйственных организациях поголовье крупного рогатого скота снизилось на 81%, в хозяйствах населения - на 9%, в крестьянских (фермерских) хозяйствах (за 2009 2011 гг.) —увеличилось на 25%. Поголовье свиней снизилось на 51%, в районах с развитым свиноводством - наименьшими темпами. Большее количество свиней приходится на хозяйства свиноводческих районов, например, -Центрально-Черноземного района - 5734 тыс. голов или 30% общего поголовья. В сельскохозяйственных организациях поголовье свиней более много численно (66%), чем в хозяйствах других категорий, оно сократилось на 56%, в хозяйствах населения - на 36%, в крестьянских (фермерских) хозяйствах - на 11%. Поголовье овец и коз снизилось на 59%, в частности, в сельскохозяйственных организациях - на 89%, в хозяйствах населения - на 30%, в крестьянских (фермерских) хозяйствах - выросло на 15%. Большее ко личество овец и коз сосредоточено в предприятиях малых форм хозяйствования Северо Кавказского и Поволжского экономических районов — 7458 и 4921 тыс. голов или 31 и 20% общего поголовья соответственно. Поголовье птицы выросло на 30%, в сельскохозяйственных организациях - уменьшилось на 15%, в хозяйствах населения - на 64%,в крестьянских (фер мерских) хозяйствах - выросло в 3,1 раза. Наиболее многочисленно поголовье птицы в Цен трально-Черноземном (80658 тыс. голов или 18% поголовья), а также Уральском, Северо АГРАРНАЯ НАУКА — СЕЛЬСКОМУ ХОЗЯЙСТВУ Кавказском, Центральном,экономических районах. Поголовье оленей снизилось на 17% (за 1990-2007 гг.), их выращивают в основном в хозяйствах Северного, Западно-Сибирского, Вос точно-Сибирского и Дальневосточного экономических районов. В итоге, установилась тенден ция снижения поголовьяосновных сельскохозяйственных животных, в сельскохозяйственных организациях это снижение наиболее резкое. Отечественная продукция животноводства про изводится в меньших объемах и становится неконкурентоспособной, нерентабельной. Спрос на услуги ветеринарной медицины, особенно со стороны сельскохозяйственных организа ций,падает, хотя эффективное ветеринарное обслуживание особенно необходимо сельскохо зяйственным и перерабатывающим предприятиям в условиях сокращения поголовья животных ироста импорта мяса. Так, при исследовании продуктов убоя животных, предназначенных для переработки, выявляется в несколько раз большее количество возбудителей заразных болез ней и патологических изменений, связанных с незаразной этиологией, чем у живых живот ных[2, с. 86].

Ветеринарное обслуживание агропромышленного комплекса страныне эффективно, в его системе существуют проблемы:непроработанная нормативно-правовая база;

низкая произво дительность труда;

моральный и технический износ материально-технической базы ветеринар ных учреждений;

устаревшие технологии;

рост цен на оборудование, приборы, препара ты,затрат на материальные, финансовые, трудовые ресурсы [4, с. 351].Как правило, эффек тивность ветеринарного обслуживания измеряется лишь такими показателями, каккоэффици ент рабочего времени;

уровень занятости оперативной работой(позволили установить, что у главных и старших ветеринарных врачей более высокий уровень занятости оперативной рабо той и большая эффективность использования рабочего времени, чем у рядовых);

стоимость валовой продукции отраслей животноводства и продукции, созданной трудом ветеринарных специалистов;

затраты на ветеринарное обслуживание;

годовой экономический эф фект;

эффективность ветеринарного обслуживания в расчете на 1 рубль затрат (их расчет по казал повышение экономической эффективности ветеринарного обслуживания отраслей сви новодства и птицеводства) [1;

3;

5;

6].

Выводы и предложения. Таким образом, направления повышения экономической эффек тивности ветеринарного обслуживания АПК — государственное финансирование научных ис следований в сфере ветеринарной медицины;

соблюдение технологических, санитарных и ве теринарных норм и правил РФ, стандартов ВТО;

осуществление модернизации, реконструк ции, рациональное использование основных средств ветеринарных учреждений;

создание ба зы данных прижизненных диагностических исследований с цельюснижениязатрат на проведе ние исследований продуктов убоя животных;

ростпроизводительности труда ветеринарных специалистов за счет ликвидации нерегламентированных перерывов, сокращениярабочего времени на работу, не предусмотренную должностными обязанностями;

оценка эффектив ности ветеринарного обслуживания с помощью показателей фондоотдачи и прибыли от реа лизации и рентабельности продукции, созданной трудом ветеринаров.

Библиографический список 1. Махиянов А.Р., Пичугина М.В., Акмуллин А.И. Эффективность ветеринарного обслужи вания крупных молочных комплексов// Ученые записки Казанской государственной академии ветеринарной медицины им. Н.Э. Баумана. — 2013. - №215. — С. 228- 2. Мезенцев С.В., Гуславский И.И., Медведева Л.В. Актуальные проблемы и методические подходы к оптимизации ветеринарного обслуживания аграрных предприятий// Вестник Ал тайского государственного аграрного университета. — 2013. - №2. — С. 085- 3. Никитин И.Н., Сабирьянов А.Ф. Экономическая эффективность ветеринарного обслужи вания скотоводства// Ученые записки Казанской государственной академии ветеринарной медицины им. Н.Э. Баумана. — 2013. - №215. — С. 256- 4. Ромашин М.С. Стратегические направления модернизации инновационного развития ве теринарного обслуживания агропромышленного комплекса России// Ученые записки Казан ской государственной академии ветеринарной медицины им. Н.Э. Баумана. — 2013. - №214.

— С. 351- 5. Сабирьянов А.Ф. Экономическая эффективность ветеринарного обслуживания птице водства// Ученые записки Казанской государственной академии ветеринарной медицины им.

Н.Э. Баумана. — 2013. - №215. — С. 294- 6. Сабирьянов А.Ф. Экономическая эффективность ветеринарного обслуживания свино водства// Ученые записки Казанской государственной академии ветеринарной медицины им.

Н.Э. Баумана. — 2013. - №215. — С. 291- СЕМИНАР — КРУГЛЫЙ СТОЛ 9. АКТУАЛЬНЫЕ ПРОБЛЕМЫ ВЕТЕРИНАРНОЙ МЕДИЦИНЫ УДК 619: А.А. Терликбаев, Д.И. Доманов, К.М. Камсаев, К.А. Науменко Казахский агротехнический университет им. С. Сейфуллина, Республика Казахстан КОМПЛЕКСНЫЙ МЕТОД ЛЕЧЕНИЯ БРОНХОПНЕВМОНИИ ТЕЛЯТ С ПРИМЕНЕНИЕМ ТРАНСКРАНИАЛЬНОЙ ЭЛЕКТРОСТИМУЛЯЦИИ На современном этапе развития животноводства в Республике Казахстан заболеваемость бронхопневмонией составляет в пределах 30-35% от всех болезней незаразной этиологии.

Основной причиной проявления болезни у молодняка животных является нарушение пара метров микроклимата (сквозняки, высокая влажность, содержание вредных газов, условно патогенная микрофлора и т.д.).

В нашей стране и за рубежом интенсивно проводится изыскание новых методов профилак тики и лечения бронхопневмоний молодняка крупного рогатого скота.

В связи с вышеуказанным нами было апробировано применение транскраниальной элек тростимуляции для лечения бронхопневмонии телят в комплексе с традиционными методами.

Целью наших исследований явилось изучение терапевтической эффективности ТКЭС при лечении бронхопневмонии молодняка крупного рогатого скота.

В связи с этим перед нами были поставлены следующие задачи:

1. Провести транскраниальную электростимуляцию при лечении бронхопневмонии телят.

2. Изучить динамику иммунологических и гематологических показателей крови телят до и после лечения.

Экспериментальная работа проводилась в условиях ТОО Агрофирма «Родина» Акмолин ской области. Всего было подобрано 10 телят, больных бронхопневмонией, которых раздели ли на 2 группы контрольную и опытную. В каждой группе по 5 телят. Подбор животных в двух группах проводили по принципу парных — аналогов (возраст, порода, степень проявления болезни и т. д.) Телятам опытной группы проводили лечение с применением ТКЭС совместно с лекарственным препаратом, а в контрольной группе терапия проводилась традиционным способом.

Обоснованием для постановки диагноза служили характерные клинические симптомы: се розно—катаральные или катаральные истечения из носовых отверстий;

взъерошенность шер сти, потеря ее эластичности, незначительное повышение температуры на 0,5 — 10С, апатия, потеря аппетита, кашель, исхудание. При аускультации в легких обнаружили жесткое везику лярное дыхание, мелкопузырчатые влажные хрипы. Гематологические и иммунологические исследования крови проводились двукратно, до и после лечения в обеих группах телят.

Результаты гематологических исследований крови до лечения отражены в таблице 1.

Таблица 1 — Результаты гематологических исследований до лечения Название показателя Опытная группа (n=5) Контрольная группа (n=5) Гемоглобин (г/л) 92±3,67 90±1, Эритроциты (1012 /л) 4,64±0,25 3,87 ±0, Лимфоциты(%) 39,17±1,68 40,52±0, СОЭ (мм/час) 7±0,32 6±0, Тромбоциты (109 /л) 491,67±24 412± 0,77±0,02 * Цветной показатель: 0,81±0, Гематокрит,(%) 20,53±0,43 19,63±0, Лейкоциты:(109 /л) 15,56±0,73 16,49±0, Сегментоядерные,(%) 36,93±2,55 30,37±1, Эозинофилы,(%) 2,47±0,11 2,27±0, Базофилы,(%) 2,17±0,16 1,90±0, Моноциты,(%) 11,40±0,25 8,46±0, *Р0. При анализе вышеизложенной таблицы 1 необходимо отметить следующие отклонения ге матологических показателей. Наблюдается эритроцитопения (олигоцитемия), лимфоцитопе ния, эозинопения, моноцитоз, СОЭ повышено, гемоглобин понижен, цветной показатель по нижен (гипохромия), что свидетельствует о наличии воспалительных процессов в организме.

Количество эритроцитов уменьшается в обеих группах, так как в организме наблюдаются воспалительные процессы, нарушение дыхания вследствие болезни. Лейкоцитоз в контроль ной и опытной группах также возникает вследствие воспалительных процессов в организме АГРАРНАЯ НАУКА — СЕЛЬСКОМУ ХОЗЯЙСТВУ телят. Наличие лимфоцитоза в обеих группах также подтверждает наличие воспалительного процесса. Также заметно и понижение гемоглобина как в контрольной так и в опытной груп пе.

В таблице 2 показаны результаты иммунологических исследований крови до начала лече ния.

Таблица 2 — Результаты иммунологических исследований до лечения Показатели Контрольная группа (n=5) Опытная группа(n=5) Норма мг/мл 0,25±0,01* 0,27±0,03* Иммуноглобулин А, мг/мл 0, Иммуноглобулин M, мг/мл 0,90±0,20 1,20±0,07 1, Иммуноглобулин G, мг/мл 4,2±0,70 4,5±0,30 11, *Р0. По результатам иммунологических исследований до лечения телят больных бронхопневмо нией можно сделать вывод, что иммунная система организма животных ослаблена, это гово рит о понижении резистентности организма, что способствует возникновению заболевания.

Для лечения телят опытной группы использовали препарат «Ресфлор» и ежедневно прово дили по 10 минут транскраниальную электростимуляцию, где использовали генератор им пульсный ГИ-1. Для лечения контрольной группы использовали препарат «Ресфлор» и витамин «Элеовит». Схема лечения обеих групп указана в таблице 3.

Таблица 3 — Схема проведения лечения телят больных бронхопневмонией Опытная группа (n=5) Контрольная группа (n=5) Препарат «Ресфлор» однократно в дозе 2мл на Препарат «Ресфлор» однократно в дозе 2мл на 15кг живой массы, подкожно. 15 кг живой массы, подкожно.

Транскраниальная электростимуляция 1 раз в Витамин «Элеовит» 5мл, 2 раза за курс лечения.

день по 10 минут, ежедневно до выздоровления.

После соответстствующего лечения показатели температуры, пульса и дыхания на четвер тый день приблизились к физиологическим параметрам. Выздоровление первого теленка на ступило на шестой день после начала лечения. Окончательное выздоровление всей группы наступило на 9 день, на что указывают клинические показатели и лабораторные результаты исследования.

Клинически у телят наблюдались улучшение общего состояния, хороший аппетит, при ау скультации легких хрипы отсутствовали, кашель и патологические истечения из носовых отвер стий не наблюдались.

Результаты гематологических и иммунологических исследований крови после лечения от ражены в таблице 4,5.

Таблица 4 — Результаты гематологических исследований после ТКЭС Показатели Опытная группа(n=5) Контрольная группа (n=5) Гемоглобин (г/л) 110,67±3,67 93,52±1, Эритроциты (1012 /л) 5,64±0,25 4,87 ±0, Лимфоциты (%) 50,17±1,68 45,52±0, СОЭ (мм/час) 1,5±0,32 3±0, Тромбоциты (109 /л) 513,67±243 495± 0,99±0,04* 0,80±0,02* Цветной показатель Гематокрит,(%) 30,53±0,43 21, Лейкоциты:(109 /л) 10,56±0,73 13,49±0, Сегментоядерные,(%) 25,93±2,55 30,37±1, Эозинофилы,(%) 3,1±0,11 2,95±0, Базофилы,(%) 1,17±0,16 2,90±0, Моноциты,(%) 6,40±0,25 7,46±0, *Р 0. Согласно данных таблицы 4 необходимо отметить, что увеличивается количество эритроци тов на 12,5%, гемоглобина на 13%, лимфоцитов на 15,8% и т.д. Количества лейкоцитов дос тигает физиологической нормы, что свидетельствует о нормализации резистентности орга низма телят. Цветной показатель приблизился к норме. Количественное содержание гемато логических показателей крови опытной группы телят заметно отличаются от контрольной группы животных, что доказывает положительное влияние ТКЭС на организм животного.

СЕМИНАР — КРУГЛЫЙ СТОЛ 9. АКТУАЛЬНЫЕ ПРОБЛЕМЫ ВЕТЕРИНАРНОЙ МЕДИЦИНЫ Исходя из данных таблицы 5, можно сделать выводы, что транскраниальная электростиму ляция оказывает стимулирующее действие на иммунную систему телят. По ниже представ ленным показателям иммунной системы в опытной группе заметно отмечается повышение иммуноглобулинов: Ig A на 12%, Ig М на 24,5% и Ig G на 26%, тогда как в контрольной груп пе отмечается не значительное повышение иммуноглобулинов Ig A на 7%, Ig М на 10% и Ig G на 12%.

Таблица 5 — Результаты иммунологических исследований после применения ТКЭС Название показателя Контрольная группа (n=5) Опытная группа(n=5) Норма мг/мл 0,29±0,05* Иммуноглобулин А, мг/мл 0,31±0,12 0, Иммуноглобулин M, мг/мл 1,0±0,10 1,68±0,07 1, Иммуноглобулин G, мг/мл 5,1±0,23 7,5±0,40 11, *Р 0. Выводы.

1. Транскраниальная электростимуляция телят больных бронхопневмонией в течение 10 ми нут является безопасным методом стимуляции организма и способствует сокращению сроков выздоровления.

2. После проведения ТКЭС общее состояние животного улучшается, повышается аппетит, в крови отмечается повышение эритроцитов на 12,5%, гемоглобина на 13%, лимфоцитов на 15,8%, Ig A на 12%, Ig М на 24,5%, Ig G на 26%.

3. Предлагаемый метод лечения телят больных бронхопневмонией является экологически чистым, легко выполнимым и управляемым, обладает стимулирующим и десенсибилизирую щим последействием, повышает факторы неспецифической защиты. Практическое отсутствие осложнений и противопоказаний делают целесообразным его широкое применение в клини ческой практике.

УДK 638. О.С. Тураев, М.М. Сафаров Узбекский НИИ животноводства, Ташкентский государственный аграрный университет, Республика Узбекистан РАСПРОСТРАНЕННОСТЬ ПАРАЗИТОВ ПЧЕЛ, ЖУКОВ РОДА MELOE В УСЛОВИЯХ УЗБЕКИСТАНА Актуальность темы. Жуки — относятся к классу насекомых (Insecta), отряду жёстокрылых или жуков (Coleoptera), подотряду ядовитые жуки (Polyphaga). Так как в теле и в крови этих жуков содержится ядовитая жидкость (в виде гнойных капель) — контаридин, токсически воз действующая на нервные волокна, их называют гнойными жуками В последние годы во многих регионах республики Узбекистан с момента начала сбора мё да появляются случаи массового заболевания пчелиных семей и молодых пчёл. В целях изуче ния причин заболевания в пчеловодческих хозяйствах Шафирканского и Рамитанского районов Бухарской области Республики Узбекистан были, проведены исследования заболевших пчели ных семей. Результаты исследований говорят о том что возбудителями болезни являются жу ки рода майек.

Методы проведения эксперимента. Для исследований были отобраны образцы заболевших пчёл и подсчитано количество жуков на теле медоносных пчёл. В целях определения степени заражённости пчёл личинками жуков рода майек, было подсчитано количество личинок в теле 100 медоносных пчёл.

По литературным данным известно что жуки рода майек наносят большой экономический ущерб пчеловодству Туниса, Германии, Румынии и других зарубежных государств. (Orosi Pal zaltam, 1939;

Zras A., 1941;

Koller F., 1955).

В странах СНГ жуки рода майек, также хорошо изучены. (Тарбинский С.П., Плавильщи ков Н.Н., 1948;

Полтев В.И., 1964;

Даниелян С.Г., Налбандян К.М., 1967;

Крижановский О.Л., 1965).

Жуков рода майек в странах СНГ встречается боллее 200 видов, однако в Северных ре гионах зарегистрировано только 14 видов, остальная часть жуков рода майек распространены в регионах с жарким климатом Средней Азии (Крижановский О.Л., 1965).

АГРАРНАЯ НАУКА — СЕЛЬСКОМУ ХОЗЯЙСТВУ В Республике Узбекистан до настоящего времени в литературных данных не встречается сведений о наносимом вреде жуков рода майек. Поэтому были взяты образцы от пчёл зара жённых жуками и подсчитано их количество находившихся на теле больных пчёл. Было выяс нено что собранные 182 образца в массивах Жилван, Варахша, Мохонкуль, Тудакуль Бухар ской области, относятся к 4 видам жуков рода майек. Эти жуки оказались представителями семейство майки (melodai) — коричневий майка (Meloe. Variegatus D.), чёрная майка (M. hungrus Sch), обыкновенная майка (M. Proscarabalus Z.) и пестрый четырёх точечная май ка (Mylobris guadripunctata).

В условиях Узбекистана в годы с низкой температурой и влажностью, количество жуков рода майек значительно снижается. Низкая температура окружающей среды и обилие дож дей отрицательно сказывается на развитие жуков. Эту мысль подтверждают научные иссле дования Orosi Pal Z., (1939).

О размерах тела жуков рода майек в литературе даются противоречивые данные. Напри мер, по данным С.П. Тарбинского и Н.Н. Плавильщикова (1948), длина тела жуков составляет 11-38 мм, В.И. Полтева (1964) 19-33 мм, а по данным О.А. Крижановского (1965) 11-42 мм.

В наших исследованиях в условиях Бухарской области были обнаружены экземпляры жуков длина тела которых составляла даже 54 мм.

Результаты исследований. В условиях Бухарской области жуки рода майек в основном встречаются в степных и пустынных зонах, там где в разнообразии произрастают — верблю жья колючка, абаш, парнолистники и другие представители дикой флоры. Однако в освоен ных в мелиоративном отношении земельных участках жуки почти не встречаются, так как проводимые каждый год агротехнические мероприятия в некоторой степени снижают количе ство жуков, а оставшаяся часть вынуждена мигрировать в пустынные зоны.

Cтепень заражаемости личинок жуков рода майек, значительно снижается в результате повышения температуры окружающей среды. В некоторых пчелосемьях и даже на теле пчёл было обнаружено до 7 экземпляров жуков, но это количество было только на теле одной пчелы, тогда как по два или три экземпляра встречались повсеместно. В этот период наблю далось увеличение количества молодых пчёл. В период с июля по август месяц не выявлена встречаемость жуков на цветках растений. Это говорит о том, что в данный промежуток времени личинки жуков уже прошли фазу своего периода развития.

В условиях Узбекистана личинка рода коричневого майка (M.Variegatus) относящаяся к се мейству гнойных жуков, имеет чёрный цвет и вооружена хорошо развитым зрительным ап паратом. Вылупившиеся из яиц активно двигающиеся личинки, поднимаются на цветки расте ний, и переходят на тело различных насекомых, в том числе и медоносных пчёл. Они быстро проникают в пространство между кольцами брюшка насекомых, питаются его гемолимфой и приводят к массовой гибели пчёл.

Личинки обыкновенного жука рода майек (M. Praseorabacus) имеют жёлтую окраску, их можно увидеть невооружённым глазом. Они в отличие от других личинок, не проникают ме жду кольцами брюшка, а нападают на пчёл с внешней стороны и питаются их пищей.

Личинка вида чёрного жука рода майек (M. hangar’s Sch.) чёрного цвета, активно передви гаются, но по сравнению с другими жуками имеют крупное телосложение. Отличительной чертой личинок является наличие хорошего аппетита, одна личинка способна пожирать гемо лимфу 2-3 медоносных пчёл, вызывая их массовую гибель.

В Узбекистане четырёхточечный гнойный вид жуков (M guadripumctata) имеет также ши рокое распространение. Длина тела соcтавляет 8-25 мм. Имеют чёрную окраску, иногда приобретают перламутровый цвет с оттенками зелёно-синего цвета. Крылья жуков красно жёлтого цвета с чёрными пятнами. Жуки, живут колониями, нанося сельскохозяйственным посевам, в том числе и пчеловодству, ощутимый ущерб. Некоторые виды жуков питаются перепончатокрылыми насекомыми и ведут в основном хищнический образ жизни. Гусеницы, попадая в пчелиные улья, питаются мёдом и личинками пчёл.

Гнойные жуки, обладая способностью выделять отравляющую жидкость неприятного запа ха, предохраняют себя от нападения насекомоядных птиц. При попадании этого вещества на кожу человека, развивается сильный зуд и в дальнейшем образуются пузыри заполненные гнойной жидкостью. Одним из основных очагов распространения жуков рода майек в приро де являются гнёзда перепончатокрылых насекомых, в частности улья медоносных пчёл, в ко торых жуки рода майек проходят полный цикл своего развития. Полноцено развитые жуки, прошедшие полный путь своего развития в пчелиных ульях, начинают откладывать яйца в рас щелинах различных слоёв земли.

Гусеницы жуков ведут полупаразитический образ жизни в гнёздах насекомых. Гусеницы крупные, без крыльев, обычно тёмного или синевато - бурого цвета, проживают в больших количествах в основном в степях, лугах, а также вблизи ульев пчёл и других видов насекомых.

СЕМИНАР — КРУГЛЫЙ СТОЛ 9. АКТУАЛЬНЫЕ ПРОБЛЕМЫ ВЕТЕРИНАРНОЙ МЕДИЦИНЫ Самки жуков откладывают яйца, из которых вылупляются свободно передвигающиеся ли чинки размером около 1 мм Личинки заражая тело насекомых в основном питаются кровью медоносных пчёл — гемолимфой, высасывая его из межсегментного пространства груди и брюшка. На теле пчёл можно обнаружить от 2 до 7 экземпляров личинок ведущих паразити ческий образ жизни.

Личинки жуков обычно размещаются на цветках растений, поджидая своих жертв. Нападая на насекомых, которые садятся на цветки для снятия пыльцы они прочно удерживаются на те ле медоносных пчёл своими конечностями. Некоторые из них выпадают уже при полёте пчел, но большинство из них вместе с пчёлами достигают пчелиные улья, в которых свободно живут и питаются их гемолимфой, вызывая заболевание мелеоз.

Выводы и предложения. Для успешной борьбы против жуков рода майек необходимо в срочном порядке переселять пасеки. В противном случае развитие болезни приведёт к силь ному обессиливанию пчелиных семей, что будет выражаться довольно заметным снижением продуктивности пчёл.

При возникновении мелеоза, целесообразным считается проведение профилактических мер борьбы. Для этого необходимо учитывать следующие моменты. Для борьбы с мелеозом требуется в постоянном порядке уничтожать личинок и жуков рода майек. Эффективные ре зультаты получены при применении нафталина, фенотиазина, фольбекса, дымов табака и гармолы обыкновенной.

Библиографический список 1. Даниелян С.Г, Налбандян К.М. 1967. Изучение мелеоза пчел в Армянской ССР. Мате риалы XXV-международной конгресс по пчеловодству. Из-во Апимондия, Бухарест, 1967, стр. 206- 2. Крижановский О.Л. Определитель насекомых Европейской части СССР. I-II М-Л, 1965.

3. Полтев В.И. Болезни пчел. Из-во “Колос” Масква, 1964.

4. Тарбинский С.П, Плавильщиков Н.Н. Определитель насекомых Европейской части СССР.

М, 1948.

5. Zras A. Le meloe variaegatus Donvon, sa presence dans le Nord de l. Atrigne sa biology, 1941.

6. Kaller F. Die Meloiden als Parasiten der Wildbinen, Naturkundliches Jahrbuch der stadt Lians, 1955.

УДК 636.52/58:575. Е.С. Усенбеков, Ж.Ж. Бименова Казахский национальный аграрный университет, г. Алматы, Республика Казахстан, usen03@mail.ru ОПТИМИЗАЦИЯ УСЛОВИЙ ПРОВЕДЕНИЯ ПОЛИМЕРАЗНОЙ ЦЕПНОЙ РЕАКЦИИ ДЛЯ ДЕТЕКЦИИ АЛЛЕЛЕЙ ГЕНА GDF-9 У КОРОВ Исследованиями установлены влияния полиморфизма генов ВМР 15 и GDF9 у овец на коли чество овулируемых фолликулов и уровень овуляции. Так, аллели гена, Bone morphogenetic protein -ВМР 15 у овец, оказывают влияние на процесс фолликулогенеза и гетерозиготные овцы по данному локусу овулируют с двумя-тремя ооцитами. Авторы данного исследования реакомендуют использовать полиморфизм гена ВМР 15 у овец в качестве ДНК маркера для повышения плодовитости животных в овцеводстве[1].

В 2013 году появилось первое сообщение о полиморфизме гена GDF9 (Growth differentiation factor 9) у крупного рогатого скота и о связи аллелей данного гена с выходом пригодных для трансплантации эмбрионов у коров-доноров, с общим количеством эмбрио нов. Ген GDF9 у крупного рогатого скота имеет длину 3824 пар нуклеотидов, экзонная часть гена оказалась консервативной и не имеет мутации, а в интронной части обнаруженыдве то чечные мутации. Известно, что продукты гена GDF9 контролируют процесс роста и развития фолликулов у коров. Полиморфизм данного гена хорошо исследован в медицине, уженщин, имеющих мутацию в кодирующей части гена GDF9 встречаются признаки преждевременного угасания функции яичников [2,3].

Китайскими учеными установлено, что высокий выход качественных эмбрионов для тарнс плантации был у коров-доноров с генотипом A485TТ, также была выявлена положительная корреляция с общим количеством эмбрионов и генотипом коров-доноров А625AA. Таким АГРАРНАЯ НАУКА — СЕЛЬСКОМУ ХОЗЯЙСТВУ образом, авторы работы предлагают использовать полиморфизм гена GDF9 у коров в каче стве ДНК маркера для прогнозирования репродуктивной функции у коров. В связи с вышеиз ложенным была поставлена задача изучить полиморфизм гена GDF9 у коров черно-пестрой породы в условиях племенного хозяйства ТОО «Байсерке-Агро» и поставить технологию ПЦР диагностики мутации гена по локусу GDF9.

Материалы и методы исследования. Кровь для экспериментов брали от коров черно пестрой породы из яремной вены в ваккумную пробирку с ЭДТА. Доставленные в лаборато рию образцы крови хранили в морозильнике при температуре -20 °С. Выделение ДНК из кро ви проводили согласно инструкции набора «ДНК сорб В» производства Россия.

Проведение полимеразной цепной реакции для выявления точечной мутации в интронной части гена GDF9 включает выбор праймеров.В первую очередь необходимо определить по следовательности прямого и обратного праймеров для амплификации нужного фрагмента ДНК. Сначала с сайта NCBI вывели из базы данных полную последовательность гена GDF9 в формате Pasta, вид животного - Bostaurus.На следующем этапе с помощью известных после довательностей праймеров определили место локализации точечной мутации в интронной час ти гена GDF9.

Работа по генотипированию коров по локусу гена GDF9 проводилась в 2013 году в учебно научно-диагностической лаборатории Казахстанско-Японского инновационного центра Казах ского национального аграрного университета. Использованные приборы: центрифуга фирмы Эппендорф, вортекс, термостат, горизонтальный аппарат для электрофореза, амплификато ры «Терцик» и «Эппендорф», гель документирующая система. Для амплификации нужного фрагмента гена GDF9A485T были использованы праймеры, разработанные авторами TangK.Q. и др. (2013), которые имеют следующие последовательности: прямые F 5-AGGGAAGAAGAAAGATCTTTTGC-3 и обратные R: 5- TCTACCCAGGCTTTAGTCCC - 3.

Использование данной пары праймеров позволяет амплифицировать участок гена GDF9 дли ной 208 пар нуклеотидов. В данном случае для генотипирования животных применяется рест риктаза NsiI, которая имеет сайт рестрикции ATGCA/T:

Для детекции второй точечной мутации в интронной части изучаемого гена A625T нами бы ли использованы праймеры: прямые F: 5-ATGCCCTCATGGGTTGATGTAGGCTA-3 и обратные R: 5- CTCCCATCTCTCTCATACACACAAG—3. Комплементарность последовательностей выше указанных праймеров нами были проверены с помощью компьютерной программы, обе па ры праймеров оказались комплементарными исследуемому участку гена GDF9. Рестрикцию продукта ПЦР во втором опыте проводили с помощью рестриктазы DraI, которая имеет сайт рестрикции TTT/AAA:

Успех при проведении полимеразной цепной реакции зависит от двух факторов: концен трация MgCl2в реакционной смеси и температура отжига праймеров. Оптимальную концен трацию MgCl2определили экспериментальным путем, а температуру отжига праймеров вы числили с помощью компьютерной программы «Калкулятор расчета температуры плавления праймеров».

Оптимальной температурой отжига для прямого праймера F 5-AGGGAAGAAGAAAGATCTTTTGC-3 оказалась 58.08°С и для обратного праймера R:

5- TCTACCCAGGCTTTAGTCCC - 3 температура 56.80 °С.

Другим немаловажным фактором является, это концентрация MgCl2, в реакционной сме си. В настоящее время установлено, что при повышении концентрации MgCl2 повышается син тез молекулы ДНК, но отмечается неспецифическая амплификация. Успешная амплификация прошла при концентрации 1,5мМ MgCl2 и оптимальной температурой отжига праймеров была 58,0 С.Объем реакционной смеси 50 мкл, имеющий состав: 5 мкл 10 Х ПЦР буфера, 1,5 мМ MgCl2, 2,5 мкл 25 мкМ прямого и обратного праймеров, 5 мкл0,2 мМ концентрации каждого dNTP, 0,5 мкл фермента TaqPolymerase с активностью 5u/µl, 5 мкл ДНК и 26,5 мкл дистилли рованной воды.

Использование метода полимеразной цепной реакции совместно с ПДРФ позволяет в тече ние 5-6 часов провести генотипирование животных по локусам A485T и A625T гена диффе ренциации фактора роста 9(GDF9).

Библиографический список 1. BarzegariA, AtashpazS, GhabiliK, NematiZ, etal. (2010). PolymorphismsinGDF9 andBMP associated with fertility and ovulation rate in Moghani and Ghezel sheep in Iran. Reprod. Domest.

Anim. 45: 666-669.

2. Tang K.Q., Yang W.C., Li S.J. and Yang L.G. (2013)Polymorphisms of the bovine growth differentiation factor 9 gene associated with superovulation performance in Chinese Holstein cows.

Genetics and Molecular Research 12 (1): 390- СЕМИНАР — КРУГЛЫЙ СТОЛ 9. АКТУАЛЬНЫЕ ПРОБЛЕМЫ ВЕТЕРИНАРНОЙ МЕДИЦИНЫ 3. Wang TT, Wu YT, Dong MY, Sheng JZ, et al. (2010). G546A polymorphism of growth differentiation factor-9 contributes to the poor outcome of ovarian stimulation in women with diminished ovarian reserve. Fertil. Steril. 94: 2490-2492.

УДК 636.034:575.174:575. Е.С. Усенбеков1, О.О. Жансеркенова1, Ш.Н. Касымбекова1, В.П. Терлецкий Казахский национальный аграрный университет, Республика Казахстан, Всероссийский НИИ генетики и разведения с.-х. животных РАСХН, РФ, usen03@mail.ru РЕЗУЛЬТАТЫ АТТЕСТАЦИИ БЫКОВ-ПРОИЗВОДИТЕЛЕЙ НА НАЛИЧИЕ ГЕНЕТИЧЕСКИХ ДЕФЕКТОВ В настоящее время проблема контроля генетических дефектов у крупного рогатого скота в условиях глобализации и коммерциализации племенного дела стала важной частью отечест венной профилактической работы, своевременная диагностика носителей мутации позволит избежать скрещивания двух гетерозиготных особей. Чтобы не допустить дальнейшего бескон трольного распространения мутации, необходимо проводить тестирование быков производителей на носительство наследственных заболеваний. Выявление в популяциях скры тых генетических дефектов, снижающих племенные качества животных, приведет к решению проблемы повышения резистентности племенного поголовья и сохранения молодняка [1].

Датскими учеными у крупного рогатого скота голштинской породы была выявлена новая мутация, обусловливающая CVM—комплексное уродство позвоночника. По данным авторов, среди 6342 обследованных быков доля гетерозиготных носителей CV-гена в США, Канаде, Голландии, Франции, Германии и Италии составляла соответственно 20,07%, 6,42%, 38,80%, 42,85%, 7,15% и 15,40%. В Словении количество носителей среди быков производителей цен тра по искусственному осеменению голштинской породы составило 10% CVM, 5,4% носите лей мутации красного фактора, носителей аутосомальной рецессивной мутации гена CD 18 у данной популяции не выявлены[2].

В Турции в 2005 году проведен мониторинг на наличие генетического дефекта BLAD синдрома у крупного рогатого скота голштинской породы. По результатам этих исследований одна корова и один бык-производитель оказались гетерозиготными носителями мутации BLAD и частота вредной мутации составила 0,0084.Частота гетерозиготных носителей CVM среди элитных коров голштинской породы в Республике Чехия составила 18,9%, из 111 обследован ных коров 20 оказались гетерозиготными носителями мутации гена SLC35A3[3].

Иранскими учеными установлена частота летальной аллели гена CD 18у быков производителей голштинской породы и из протестированных 37 животных один оказался гете розиготным носителем и одно животное гомозиготным носителем. У исследуемых животных носителей DUMPS не выявлены [4].

В литературе есть сведения, что некоторые породы крупного рогатого скота свободны от вредных летальных мутации. Так, учеными установлено отсутствие вредных аллелей по локусу DUMPSу скота голштинской породы Польши. Однако, авторы утверждают, что в любом слу чае необходимо провести тестирование племенных быков на наличие нежелательных рецес сивных мутации. Всего протестированы 1171 животное из них проверенных по качеству по томства 781 животные.В мае 2010 года ученые впервые сообщили о распространенности у голштинского скота новой аутосомальной рецессивной мутации Brachyspina, и сейчас во мно гих странах проводятся мониторинг племенных животных методами молекуляной генетики на носительство этого дефекта [5,6].

Таким образом, для племенных хозяйств Республики Казахстан актуальным является выяв ление и своевременная выбраковка животных-носителей генетических дефектов - BLAD, CVM, BC и DUMPS.

Материалы и методы исследования. Нами были всего протестированы 110 животных, в том числе 67голов АО «Асыл-Тулик» и 43 головы ТОО «Асыл». По результатам ПЦР диагностики выявлен один бык-производитель гетерозиготный носитель BLAD синдрома, Winston индивиду альный номер 03.53079619 породы герефорд. Частота вредной мутации BLAD среди иссле дуемой популяции быков-производителей была 0,90%. Быки-производители отечественной се АГРАРНАЯ НАУКА — СЕЛЬСКОМУ ХОЗЯЙСТВУ лекции, в основном быки местной породы,Алатауская, Аулиекольская, Аулиеатинская, Казах ская белоголовая оказались свободными от вредных муатации по локусу BLAD.

По результатам ПЦР-ПДРФ анализа два быка оказались гетерозиготными носителями CVM, так бык-производитель CM-R-Run-Morty-Jacson-Et, индивидуальный номер 1HO08415, голштинской черно-пестрой породы, второй бык-производитель - Schu-Lar-3T индивидуальный номер 42791092 породы герефорд. Низкую частоту мутации генетичеких дефектов по локусу BLAD и CVM и отсутствие носителей точечной мутации генов ASS и UMP у племенных быков производителей можно объяснить тем, что основная часть исследуемых животных, были ме стной Алатауской, Аулиекольской, Казахской белоголовой, Аулиеатинской пород, которые в своей родословной не имеют предков, носителей мутации.

Большинство исследователей стран Европы, США, Канады, Японии, Индии и Китая считают о необходимости регулярного мониторинга племенного поголовья для исключения возможно сти распространения генетических мутации. В настоящее время известны более 43 наследст венных заболеваний крупного рогатого скота, при которых учеными разработаны молекуляр но-генетические методы диагностики.В связи с вышеизложенным считаем необходимым про водить тестирование племенного поголовья методом ПЦР-ПДРФанализа на наличие нежела тельных аутосомальных рецессивных мутации в племенных хозяйствах Республики Казахстан.

Библиографический список 1. Никифорова Е. Г. Генетические дефекты и полиморфизм гена каппа-казеина у племен ного молочного скота // Автореф.дисс. канд. биол. наук. Санкт-Петербург-Пушкин.-2013.

2. Logar B, Kavar T, Megli V. (2008). Detection of recessive mutations (CVM, BLAD and RED Factor.

3. Akyьz B &Erturul O (2006). Detection of bovine leukocyte adhesion deficiency (BLAD) in Turkish native and Holstein cattle. ActaVeterinariaHungarica54(2): 173- 4. Alaie H., Mirhoseini S.Z., Mehdizadeh M. and Dalirsefat S.B. (2012). Identification of Complex Vertebral Malformation Carriers in Holstein and Guilan Native Cow Breeds in Iran Using SSCP Markers. Iranian Journal of Applied Animal Science. 2(4), 319- 5. Rusc A & Kaminski S (2007). Prevalence of complex vertebral malformation carriers among Polish Holstein-Friesian bulls. Journal of Applied Genetics 48: 247- 6. Agerholm, J. S., Delay, J., Hicks, B., Fredholm, M., 2010. First confirmed case of the bovine brachyspina syndrome in Canada. Can. Vet. J. 51: 1349-1350.

УДК 636.034:575.174:575. Е.С. Усенбеков, К.Ж. Жуманов, А.А. Иманбаев Казахский национальный аграрный университет, г. Алматы, Республика Казахстан,usen03@mail.ru РОЛЬ ТОЧЕЧНОЙ МУТАЦИИ ГЕНА CD В ЭТИОЛОГИИ ЭМБРИОНАЛЬНОЙ СМЕРТНОСТИ У КОРОВ Интродукция вредных мутаций как следствие миграции генов из одной популяции в другие при импорте и использовании племенного материала в товарных и племенных хозяйствах один из главных факторов появления так называемых «новых» форм патологии. Исследова ниями ученых установлено, что в результате использования спермы быков-производителей гетерозиготных по генетическим дефектам отмечается тенденция повышения эмбриональной смертности у коров [1,2].

Учеными проведена ПЦР диагностика эмбрионов коров на выявление DUMPS. Ооциты ко ров с известным генотипом, т.е. носителей мутации гена UMP оплодотворяли в условиях in vitro спермой быка гетерозиготного носителя. Дальнейшее изучение развития эмбрионов, по казывает, что большинство эмбрионов подвергались дегенерации и не дошли стадии морулы и бластоцисты, так как они являются гомозиготными и гетерозиготными носителями генетиче ского дефекта DUMPS.Таким образом, экспериментальным путем доказана роль мутации ге на UMP в этиологии эмбриональной смертности у коров [3].

Зарубежные ученые эмбриональную смертность рассматривают в качестве одной из ос новных причин репродуктивных проблем у крупного рогатого скота, приводящих в результате к снижению показателей стельности.Известно, что показатели оплодотворяемости обычно со СЕМИНАР — КРУГЛЫЙ СТОЛ 9. АКТУАЛЬНЫЕ ПРОБЛЕМЫ ВЕТЕРИНАРНОЙ МЕДИЦИНЫ ставляют 90%, а эмбриональная смертность является причиной 29-39% потерь после оплодо творения, большинство из которых (приблизительно 70-80%) происходит между 8 и 16-м днем после оплодотворения[4].

Материалы и методы исследования. Опыты из изучению влияния точечной мутации гена CD 18 на воспроизводительные функции коров проводили в хозяйстве ТОО «KazBeefLtd» Енбек шилдерского района Акмолинской области. Нами в течение 2012-2013 гг проведена аттеста ция быков-производителей АО «Асыл-Тулик» и ТОО «Асыл» в количестве 110 голов, выявлен один бык-производитель — гетерозиготный носитель BLAD (BL), инвентарный номер 03.53079619, кличка Winston. Замороженная сперма данного быка-производителя была ис пользована в хозяйстве ТОО «KazBeefLtd»для осеменения коров. Анализ результатов искусст венного осеменения коров спермой гетерозиготного быка-производителя по локусу BLAD по казывает, что из 90 коров 39 голов имели более двухкратное осеменение, индекс осемене ния составил 3,78. Интересные результаты получены у подопытной группы коров по продол жительности полового цикла при многократном осеменений. Так, в 16 случаях коровы имели нормальную продолжительность полового цикла, т.е. 18-22 дня (таблица 1).

Таблица 1 — Показатели воспроизводительной функции у исследуемых коров Кол-во коров, осемененных спермой Показатели репродуктивной функции Быка BLn= 90 голов Быка TLn= 47 голов Коровы с однократным осеменением 14 Количество коров (осеменение два и более раз) 39 Интервал между осеменением 1-17 дней 8 Интервал между осеменением 18-22 дней 16 Интервал между осеменением 23-42 дней 38 Интервал между осеменением более 43 дней 11 Стельные 23 Индекс осеменения 3,78 1, У коров с большим количеством перегулов (38 случаев) продолжительность периода меж ду двумя осеменениями составила 23-42 дня и это косвенно подтверждает роль гетерозигот ного носительства в этиологии ранней эмбриональной смертности у коров.

Известно, что ранняя эмбриональная смертность часто сопровождается удлинением про должительности полового цикла. В норме предимплантационный эмбрион на стадии морулы и бластоцисты попадает в матку на 5-6-й день после оплодотворения и на 14-17-й день проис ходит имплантация эмбрионов. Видимо, в данном случае после гибели предимплантационных эмбрионов, некоторое время продолжает функционировать желтое тело, вырабатывается желтым телом гормон прогестерон. Потом, прекращается функция желтого тела, так как погибает эмбрион в результате наследственного фактора, точечной мутации. С точки зрения эмбриональной смертности наиболее критическим периодом по данным литературы является период времени с 8 по 16 дни после оплодотворения.

Нами, также с целью выявления коров, носителей генетических дефектов были протести рованы 27 коров породы герефорд и среди исследуемых животных носителей мутации генов CD 18 и UMPне выявлены.

В настоящее время существующие методы диагностики не позволяет с большой точностью диагносцировать эмбриональную смертность у коров. Однако, полученные нами результаты исследования позволяет предположить о роли наследственного фактора в этиологии эмбрио нальной смертности. Коров контрольной группы в количестве 47 голов осеменяли спермой другого быка-производителя, который не является носителем мутации. Индекс осеменения в контрольной группе был 1,88 и 38,3 процента животных оказались стельными.

Полученные результаты свидетельствуют, что использование для репродукции животных сперму гетерозиготного носителя мутации BLAD отрицательно влияет на воспроизводитель ную функцию коров, увеличивается количество коров с безрезультатными осеменениями и повышается индекс осеменения. Для выявления быков-производителей, носителей скрытых генетических дефектов рекомендуем использовать метод полимеразной цепной реакции в сочетании с ПДРФ.

Библиографический список 1 ЖигачевА.И., ЭрнстЛ.К., БогачевА.С. О накоплении груза мутаций в породах крупного рогатого скота при интенсивных технологиях воспроизводства и улучшения по целевым при знакам// Сельскохозяйственная биология, 2008, № 6, C. 25-32.

2 Марзанов Н.С., Ескин Г.В., Турбина И.С., Девришев Д.А., Тохов М.Х., Марзанова С.Н.

Генодиагностика и распространение аллеля иммунодефицита, или BLAD синдрома, у черно пестрой породы крупного рогатого скота. —Москва, 2013.-С. 12- АГРАРНАЯ НАУКА — СЕЛЬСКОМУ ХОЗЯЙСТВУ 3 Patel R K. (2010). Autosomal resseive genetic disorders of cattle breedsWourdwide — a Review. Journal of Livestock Biodiverity. Vol.2 n 1. pp 35- 4 Dunne LD., Diskin MG., Sreenan JM. Embryo and foetal loss in beef heifersbetween day gestation and full term. AnimReprodSci 2000;

58: 39- УДК 636.22/.28.612. Е.С. Усенбеков, О.Т. Туребеков, А.К. Имангалиев, М.Д. Кенешбаев Казахский национальный аграрный университет, г. Алматы, Республика Казахстан, usen03@mail.ru ПРИМЕНЕНИЕ ПРЕПАРАТА CIDR ДЛЯ СТИМУЛЯЦИИ ПОЛОВОЙ ФУНКЦИИ КОРОВ ПРИ ГИПОФУНКЦИИ ЯИЧНИКОВ Гипофункция яичников проявляется не только у первотелок, но и у коров вплоть до 3-5 лактации. В дальнейшем отмечается значительный спад гипофункциональных расстройств.

Если коровы не возвращаются в эструс в течение 60-ти днейпосле отела, такое состояние на зывается «послеотельныйанэструс».В последнее время зарубежные специалисты используют в ветеринарной гинекологии следующую терминологию: анэструс- у коровы не наблюдается эструс, (отсутствие полового цикла) или эструс остался незамеченным (корова с устоявшимся половым циклом), истинныйанэструс- корова не возвращается в половую охоту, потомучто ее яичники не функционируют и подэструс- у коровы нормальная половая активность, но эструс ненаблюдается ввиду слабого проявления признаков охоты или их отсутствия.

В США для стимуляции воспроизводительной функции коров используются программы «Овсинх» и «Ко-Синх», где предусмотрено применение прогестагенов/прогестерона и инъ екция гормона GnRH.Предварительная синхронизация и другиемодификации программы «Ов синх» направлены на повышение вероятностииндуцирования овуляции после первой инъекции GnRH и обеспечение лютеолиза и синхронизированной овуляции после введения простаглан дина и GnRH.Одной из простейших модификаций классической программы «Овсинх» является так называемая программа «Ко-Синх» (Co-Synch). Разница заключается в том, что вторая инъекция GnRH и искусственное осеменениеосуществляются в одно и то же время, т. е. че рез 48 часов после введенияпростагландина.

CIDR(Controlledinternaldrugreleasingdevice) —это лекарственное средство в форме капсулы, предназначенное для синхронизации охоты у коров, содержащее в качестве действующего вещества 1,38 грамм прогестерона, а в качестве вспомогательных веществ силиконовыйэла стомер. При введении лекарственного средства CIDR во влагалище, прогестерон с постоянной скоростью проникает черезслизистую влагалища в кровяное русло. Прогестерон ингибирует гипоталамо-гипофизарную систему, вследствие этого прекращается выделение гонадотроп ных гормонов: ФСГ и ЛГ, в результате чего не происходит созревание фолликулов и их ову ляция. После извлечения CIDR из влагалища, уровень прогестерона в крови снижается в тече ние 4—6 часов, это в свою очередь обеспечивает созревание фолликулов и их овуляцию.

Анализ воспроизводительной функции коров молочных хозяйств Алматинской области по казывает, что в зимний период увеличивается количество коров с синдромом анэструс, т.е. у этих животных не проявляются признаки половой охоты длительное время. В связи с вышеиз ложенным перед нами была поставлена задача разработать оптимальную схему стимуляции половой функции у коров с помощью препарата EAZI-BREEDCIDR производства компании Pfiser.

Материалы и методы исследования. Работу по разработке оптимальной схемы регуляции воспроизводительной функции у коров с диагнозом гипофункция яичника и анэструс проводи ли в племенном хозяйстве СХПК «Алматы» Талгарского района Алматинской области. По ре зультатам акушерско-гинекологической диспансеризации 48 коров с патологией половых ор ганов нами были выявлены следующие нарушения репродуктивной функции у коров Алатау ской породы: 17 голов с диагнозом острый эндометрит и субинволюция матки, 15 голов с ди агнозом хронический эндометрит и 16 голов с патологией яичников. На первом этапе работы нами проводилось лечение коров, больныхэндометритом, субинволюцией матки по следую щей схеме: паравагинально — ихглюковит в дозе 20 мл, интравагинально — тампоны (АСД фракция и рыбий жир) в соотношении 1:10, лечение коров с диагнозом микоплазмоз — внут римышечно тилозин 200 по 20 мл, интравагинально тампоны (АСД и рыбий жир), массаж СЕМИНАР — КРУГЛЫЙ СТОЛ 9. АКТУАЛЬНЫЕ ПРОБЛЕМЫ ВЕТЕРИНАРНОЙ МЕДИЦИНЫ матки, внутриаортально 5-% раствор глюкозы, 0,5% раствор новокаина, 0,1-%этакридина лактата (риванола), 40 ЕД окситоцина в количестве 100 мл, коровам с желтым телом вводили препарат — эстрофан в дозе 2 мл внутримышечно.

На втором этапе провели повторное исследование всех 48 коров, которые получили лече ние по вышеукзанной схеме и сформировали группу животных в количестве 20 голов, кото рые по результатам ректального исследования и УЗИ сканирования имели признаков гипо функции яичников: уменьшение размера яичника, отсутствие созревающих фолликулов, на эхограмме структура яичника однородная, отсутствуют растущие фолликулы и желтые тела, у отдельных коров были выявлены одностороннее увеличение яйцепровода. У всех коров дли тельное время не было выявлено признаков половой охоты - анэструс.

Стимуляцию половой функции проводили по следующей схеме: 0 день — введение во влагалище коров препарата EAZI-BREEDCIDR с помощью апликатора, 0 день — сурфагон в до зе 10 мл внутримышечно, 7 день — извлечение из влагалища коров устройства CIDR и введе ние эстрофана в дозе 2 мл внутримышечно.


Через 72 часа после инъекции эстрофана, осе менение коров с признаками половой охоты ректоцервикальным способом. На 10 день из обработанных животных у 8 голов были выявлены признаки половой охоты и они подвергнуты искусственному осеменению, а у 12 коров не было признаков половой охоты. Согласно схе ме этим 12 коровам, у которых не было половой охоты повтроно вводили препарат сурфагон в дозе 10 мл внутримышечно и произвели искусственное осеменение через 72 часа без учета проявления признаков половой охоты. Всех коров через 2 месяца исследовали ректальным методом на стельность и 12 голов из 20 оказались стельными.

Заключение. На 7-й день лечения при извлечении устройства CIDR из влагалище у 5 коров были выявлены обильное гнойное выделение из половых органов, которые в последующем остались бесплодными. Это свидетельствует, что гормон прогестерон, который равномерно выделяется из устройства CIDR в течение 7 дней обостряет хронический процесс и обеспечи вает эвакуацию гнойного экссудата из полости матки. Конечная терапевтическая эффектив ность препарата CIDR была у коров с признакми гипофункции яичников 60% и данный способ рекомендуем в качестве симптоматического лечения коров с диагнозом анэструс.

Библиографический список 1. Cordoba MC., and Fricke PM.Initiation of the breeding season in a grazingbased dairy by synchronisation of ovulation. J Dairy Sci 2002;

85:1752- 2. Shephard R.Investigation of a whole herd controlled breeding program usingGnRH and prostaglandin in commercial seasonally-calving dairy herds. AustCattleVet 2002;

23 :24- УДК 636.034:575.174:575. Е.С. Усенбеков, Е.Б. Шакибаев, С.Т. Сиябеков Казахский национальный аграрный университет, г. Алматы, Республика Казахстан, usen03@mail.ru ИССЛЕДОВАНИЕ ПОЛИМОРФИЗМА ГЕНА LTF (ЛАКТОФЕРРИНА) КРУПНОГО РОГАТОГО СКОТА МЕТОДОМ ПОЛИМЕРАЗНОЙ ЦЕПНОЙ РЕАКЦИИ В настоящее время установлена тесная взаимосвязь между полиморфизмом гена лакто феррина (LTF) с заболеваемостью маститом, содержанием соматических клеток в моло ке.Продукты гена лактоферрина связаны сустойчивостью к заболеваниям, прежде всего, к маститам. Лактоферрин крупного рогатого скота (LTF) - многофункциональный малый глико протеин молока, основная функция которого - защита молочной железы.[1].

Ген LTF локализован на хромосоме 22q24, состоит из 17 экзонов и полная последователь ность гена 34,5 тыс п.н. Исследованиями ученых установлена частота генетических вариантов АА, ВВ и АВ лактоферрина у коров голштинской породы, 32,5%, 10% и 57,5% соответствен но. Авторырекомендуют использоватьгенетические варианты лактоферрина в качестве ДНК маркера для прогнозирования содержания соматических клеток в молоке и заболеваемости маститом, аллель А гена LTFсвязана с заболеваемостью маститом у коров [2].

Соматические клетки в молоке (SomaticCellCounts, SCC) - это повышенное содержание в молоке эпителиальных клеток (до 75%) и лейкоцитов (до 25%) в результате воспалительного процесса в молочной железе. Установлено, что содержание соматических клеток (SCC) в АГРАРНАЯ НАУКА — СЕЛЬСКОМУ ХОЗЯЙСТВУ молоке у коров колеблется в зависимости от клинического состояния молочной железы, в зависимости от периода лактации, минимальное содержание в молоке соматичских клеток в период лактации с 3 по 6 месяцы[3,4].

Изучение полиморфизма гена лактоферрина имеет теоретическое и прикладное значение, так как существует положительная корреляция содержанием в молоке соматических клеток и с генетическими вариантами лактоферрина.

Цель работы - изучение полиморфизма ДНК гена лактоферрина и выявление животных с желательным генотипом, которые более устойчивы к маститам.

Материалы и методы исследования. Исследования проводили на 17 коровах черно-пестрой породы племенного хозяйства ТОО «Байсерке-Агро» Талгарского района Алматинской облас ти. Кровь для анализа брали из яремной вены в ваккумную пробирку с антикогулянтом ЭДТА. Работу проводили в учебно-научно-диагностической лаборатории Казахстанско Японского инновационного центра КазНАУ. ДНК изкрови выделяли с помощью набора «ДНК сорб В». Качество и количество выделенной ДНК проверяли на 0,8% агарозном геле (рис. 1).

Лунки № с 1 по 10 образцы ДНК, выделенные из крови коров для ПЦР анализа.

Рисунок 1 — Электрофореграмма - проверка качества ДНК Полимеразную цепную реакцию проводили на термоциклере «Терцик» производства Рос сии. Для детекции полиморфизма гена LTF использовали следующую пару праймеров:

F - 5*-GCCTCATGACAACTCCCACAC-3* и R 5*-CAGGTTGACACATCGGTTGAC-3*.

Фрагмент гена лактоферрина и сайт рестрикцииэндонуклеазы EcoRI:

GCCTCATGACAACTCCCACACCAAAACAGTACTTTATTTTGTAAATTTTGACCCATTATTACTCCCAT GTTATGGTCTTTTCAGCTGTCAAGCAAACAAGGTGAAGAAAAAATTTAGTTAGATGGGGGTTGCA CCTGGAAAATAAATTTCTTAAACTCCATATACATGTTTCAAATCTGCTGGGTCCCAAGTCCATCTAT GAACTCCCAGGCTGCCAGTATCATATGCAGCATACTAAAGCTACGCTATCTGAATAGCTTATT AATTCTGCATATATCAGGTCAACCGATGTGTCAACCTG.

Для генотипирования по локусу лактоферрина используется эндонуклеаза EcoRI, которая имеет сайт рестрикции GAATT/C и продукт амплификации длиной 301 п.н. после рестрикции амплификата рестриктазой EcoRI образуются два фрагмента длиной 201 п.н. и 100 п.н.

Условия проведения ПЦР:денатурация при 94 °С — 45 сек, отжиг праймеров — 62 °С 45 сек и элонгация при температуре 72 °С 45 сек и количество циклов 35-40. Объем реакционной сме си: 50 мкл, имеющий следующий состав: 5 мкл 10 Х ПЦРбуфера, 1,5 мМ MgCl2, 2,5 мкл 25 мкМ прямого и обратного праймеров, 5 мкл 0,2 мМ концентрации каждого dNTP, 0,5 мкл фермента TaqPolymerase с активностью 5u/µl, 5 мкл ДНК и 26,5 мкл дистиллированной воды[5].

Таким образом, предварительные результаты наших исследовании полморфизма гена лак тоферрина у коров показывают, что существует положительная корреляционная связь между генетическими вариантами лактоферрина и заболеваемостью субклиническим маститом у ко ров.

Библиографический список 1. Sharifzaden А., Doosti A. Study of Lactoferrin Gene Polymorphism in Iranian Holstein Cattle Using PCR-RFLP Technique (2011). Global Veterinaria. 6 (6): 530-536.

2. Schwerin M., Toldo S.S., Eggen A., Brunner R.M., SeyfertH.M., Fries R. (1994): The bovine lactoferrin gene(LTF) maps to chromosome 22 and syntenic groupU12. Mammalin Genome, 5, 486—489.

3. SharmaN., SinghN. K., BhadwalM. S. (2011). Relationship of Somatic Cell Count and Mastitis:

An Overview. Asian-Aust. J. Anim. Sci.Vol. 24, No. 3 : 429 — 4. Malinowski, E., H. Lassa, A. Kossowska, H. Markiewicz, M.Kaczmarowski and S. Smulski.

(2006). Relationship betweenmastitis agents and somatic cell count in foremilk samples.Bull. Vet.

Inst. Pulawy. 50:349-352.

5. Терлецкий В.П., Усенбеков Е.С. Методическиерекомендации поприменению современ ных молекулярно-генетических методов в селекции и ветеринарии. —Алматы;

Издательство «Айтмар», 2012. - СЕМИНАР — КРУГЛЫЙ СТОЛ 9. АКТУАЛЬНЫЕ ПРОБЛЕМЫ ВЕТЕРИНАРНОЙ МЕДИЦИНЫ УДК 611.451:598.252. Д.Н. Федотов Витебская государственная академия ветеринарной медицины, Республика Беларусь СТРУКТУРНО-ФУНКЦИОНАЛЬНАЯ ХАРАКТЕРИСТИКА НАДПОЧЕЧНИКОВ У ПТЕНЦОВ КРЯКВЫ (ANAS PLATYRHYNCHOS) Введение. В этой статье предлагается фрагмент гистологического исследования надпочеч ника класса птиц (Aves), посвященный одному из его отрядов — гусеобразных (Anseriformes) и семейства утиных (Anatidae) — крякве или кряквенной утке (Anas platyrhynchos), наиболее известной и распространенной дикой утке. Она является одним из основных объектов спор тивной, а местами — промысловой охоты. Рост организма, его половое и физиологическое созревание, обмен веществ, линька, яйцекладка во многом определяются функциональным состоянием эндокринной системы, в том числе и исполнительно периферического звена — надпочечников.

Цель наших исследований — определить видовые и возрастные особенности морфологиче ского строения надпочечника птенцов кряквы (Anas platyrhynchos).

Материалы и методы исследований. Работа выполнялась на кафедре патологической ана томии и гистологии УО «Витебская ордена «Знак Почета» государственная академия ветери нарной медицины». От пойманных в природе крякв, было получено потомство, выращивае мое в условиях частного приусадебного подворья на территории РУКПСХП «Синицы» Бешен ковичского района Витебской области, и материал дополнительно отбирался от 5-и суточных (n=4) и 1 — 2-х месячных (n=5) селезней. От птенцов отбирали надпочечники и фиксировали в смеси Ружа. Затем морфологический материал подвергали уплотнению путем заливки в па рафин по общепринятым методикам. Изготавливали гистологические срезы толщиной 3 — 5 — 7 мкм на санном микротоме, с последующей окраской гематоксилин-эозином.

Результаты исследований и их обсуждение. Результаты проведенных исследований указы вают, что у птенцов кряквы надпочечник покрыт тонкой соединительнотканной капсулой обра зованной двумя слоями: толстым наружным — более плотным и тонким внутренним — рых лым, с множеством клеточных элементов. Наличие адипоцитов в составе капсулы не было выявлено. Синусоидные капилляры присутствуют на всей территории надпочечника и, как пра вило, в железистой ткани.

Для кряквы характерно четкое районирование интерреналовой ткани на субкапсулярную и внутреннюю зоны. Интерреналовая часть надпочечника кряквы представлена системой много численных эпителиальных тяжей, тесно прилегающих друг другу, между которыми распола гаются синусоиды. Каждый тяж состоит из двух рядов эндокринноцитов. Клеточный состав интерреналовой железы надпочечника у кряквы подразделен на интерреналоциты I, II, III и IV типов. Интерреналоциты преимущественно столбчатой формы. Ядра клеток первого ряда располагаются преимущественно в центре, а второго ряда — ближе к апикальному полюсу клетки. Часть ядер шаровидной формы с одним ядрышком, реже с двумя-тремя ядрышками, а часть ядер овальной формы в стадии деления. Для интерреналоцитов характерна пенистая цитоплазма.


Высота интерреналоциты I типа у 5-и суточных утят составляет 9,00±0,16 мкм, до 2-х ме сяцев показатель не значительно возрастает в 1,08 раза. Интерреналоциты II типа столбчатые, со сферическими ядрами и пенистой цитоплазмой, расположены на границе субкапсулярной и внутренней зон надпочечника кряквы. Митотическая активность настоящих клеток очень высо кая на протяжении всех исследуемых возрастных периодов. Ядра содержат до 3-х ядрышек и эухроматин. Так, к 1 — 2 месяцам высота клеток снижается в 1,12 раза по сравнению с 5-и суточными.

Интерреналоциты III типа кубической формы, с вакуолизированной цитоплазмой, у птенцов располагаются на границе двух зон, образуя прямые тяжи, местами переплетавшиеся с хро маффинноцитами. В надпочечнике утят в этих клетках между вакуолями располагается мел кая ацидофильная зернистость. Наименьший размер клетки составляет в 5-и суточном возрас те и равен 9,45±0,19 мкм. К 2-м месяцам показатель плавно увеличивается в 1,24 раза.

Диаметр ядер интерреналоцитов III типа так же, как и клетки имеют прямой рост. У 5-и су точных диаметр составляет 3,58±0,15 мкм, у 1 — 2-х месячных крякв показатель увеличивает ся в 1,34 раза (р0,05). Клетки IV типа кубической формы, с не гранулированной цитоплаз мой и ядром, содержащим гетерохроматин. Размер интерреналоцитов IV типа незначительно увеличивается и находится в пределах 4,60±0,12 мкм — 5,60±0,65 мкм.

АГРАРНАЯ НАУКА — СЕЛЬСКОМУ ХОЗЯЙСТВУ Рисунок 1 — Гистологическая композиция Рисунок 2 — Уменьшение количества надпочечника 5-суточного утенка медуллярных островков в надпочечнике (окраска гематоксилин-эозином, х100) 2-месячной кряквы Хромаффинная ткань в надпочечнике кряквы представлена в виде небольших клеточных островков. Преобладающая форма островков округлая, но встречаются вытянутые, а места ми шнуровидные островки. Каждый медуллярный островок состоит из 16 — 22 клеток. В каж дом островке от 2-х до 4-х клеток составляют норадреналиноциты. Хромаффиноциты по сво им размерам преобладают на интерреналоцитами всех четырех типов. У 1 — 2-х месячных птиц размер хромаффиноцитов увеличивается в 1,51 раза (р0,01) по сравнению с 5-и су точными птенцами.

Заключение. Поскольку в этих исследованиях представлен лишь фрагмент работы, относя щийся к одному из отрядов птиц, сравнения и обобщения будут сделаны в последующих ра ботах, посвященных строению надпочечника у других видов орнитофауны.

УДК 619:616.981. Т.И. Фотина, А.В. Березовский, Л.Г. Улько Сумский национальный аграрный университет, Украина, larisau@ukr.net ЭФФЕКТИВНОСТЬ ПРОФИЛАКТИЧЕСКИХ МЕРОПРИЯТИЙ ПРИ АССОЦИИРОВАННЫХ БАКТЕРИОЗАХ КОНЕЧНОСТЕЙ КРУПНОГО РОГАТОГО СКОТА За последние годы по частоте случаев болезни конечностей занимают одно из ведущих мест в структуре инфекционной патологии. Болезни конечностей в хозяйствах чаще регистри руются как ассоциированная инфекция, которая проявляется на фоне сниженной резистентно сти организма [1-4]. Поэтому важным является поиск методов применения вакцинных препа ратов против нескольких патогенных возбудителей и создание ассоциированных вакцин. Пре имущество ассоциированных вакцинных препаратов заключается в создании в короткие сроки невосприимчивости организма животных одновременно к нескольким возбудителям в зависи мости от эпизоотической ситуации в хозяйстве, районе или регионе [5, 6].

Целью нашей работы было изучить возможность использования специфических средств в системе мероприятий при ассоциированных бактериозах конечностей у крупного рогатого скота.

Материалы и методы исследований. В качестве препарата специфического действия была разработана вакцина из эпизоотических штаммов против ассоциированных бактериозов ко нечностей крупного рогатого скота. Вакцина представляла собой суспензию инактивированных формалином антигенов F. necrophorum, S. aureus, S. pyogenes, P. aeruginosa и P. vulgaris.

Для разработки ассоциированной вакцины были использованы эпизоотические штаммы возбу дителей, выделенных от больных коров. Эффективность вакцины изучали в условиях научно учебной клиники факультета ветеринарной медицины Сумского НАУ на кроликах массой 2,5 ± 0,1 кг, которых разделили на две группы по 5 голов в каждой. Животным первой СЕМИНАР — КРУГЛЫЙ СТОЛ 9. АКТУАЛЬНЫЕ ПРОБЛЕМЫ ВЕТЕРИНАРНОЙ МЕДИЦИНЫ (опытной) группы вводили ассоциированную вакцину подкожно в области шеи в дозе 1 см3.

Животные второй (контрольной) группы не подлежали вакцинации. От животных отбирали пробы крови на 15-е, 30-е и 60-е сутки после вакцинации для изучения динамики показателей иммунной системы. При этом определяли количество эритроцитов, лейкоцитов, Т-, В-лимфоцитов, бактерицидную, лизоцимную активность сыворотки крови, фагоцитарную ак тивность нейтрофилов.

Результаты исследований. В крови кроликов опытной группы, однократно вакцинированных ассоциированной вакциной из эпизоотических штаммов. F. necrophorum, S. aureus, S. pyogenes, P. aeruginosa и P. vulgaris увеличилось количество лейкоцитов на 23,1%, Т- и В- лимфоцитов на 15,8% и 42,4%, бактерицидная и лизоцимная активность сыворотки крови повысилась на 33,3% и 10,8% соответственно. Отмечали, также, повышение фагоцитарной активности нейтрофилов на 17,9%.

На следующем этапе нами была проведена оценка эффективности ассоциированной вакци ны из эпизоотических штаммов F. necrophorum, S. aureus, S. pyogenes, P. aeruginosa и P. vulgaris в комплексе с неспецифическими средствами. Для опыта были подобраны по принципу аналогов четыре группы здоровых коров по 50 голов в каждой. Коров первой груп пы вакцинировали ассоциированной вакциной из эпизоотических штаммов F. necrophorum, S. aureus, S. pyogenes, P. aeruginosa и P. vulgaris в дозе 5 см3 подкожно. Во второй группе животных для профилактики ассоциированных бактериозов конечностей применяли копытные ванны один раз в неделю в течение всего периода исследований. Животных третьей группы прививали ассоциированной вакциной из эпизоотических штаммов F. necrophorum, S. aureus, S. pyogenes, P. aeruginosa и P. vulgaris в дозе 5 см3 подкожно и применяли копытные ванны один раз в неделю в течение всего периода исследований. Контролем в опыте были коровы четвертой группы, которые не подлежали профилактическим обработкам.

В результате проведенных нами исследований установлено, что в течение четырех месяцев в первой группе животных привитых вакциной против ассоциированных бактериозов случаев заболевания выявлено не было. Одно животное заболело на пятом месяце опыта и еще одно животное через пять месяцев после вакцинации. Заболеваемость животных в конце опыта составляла 4%. Во второй группе коров заболеваемость составляла 2%. У животных третьей группы в течение периода наблюдений случаев заболевания выявлено не было. Заболевае мость в контроле составляла 8%.

Таким образом, в крови кроликов привитых ассоциированной вакциной эпизоотических штаммов F. necrophorum, S. aureus, S. pyogenes, P. aeruginosa и P. vulgaris на 15-е сутки увеличивается количество лейкоцитов, Т и Влимфоцитов, повышается бактерицидная и ли зоцимная активность сыворотки крови и фагоцитарная активность нейтрофилов. Применение ассоциированной вакцины в комплексе с неспецифическими средствами надежно профилак тирует ассоциированные бактериозы конечностей у крупного рогатого скота.

Библиографический список 1. Риженко В.П. Теоретичне і експериментальне обґрунтування розробки нових вакцин / В.П. Риженко, Г.Ф. Риженко, О.І. Горбатюк та ін. // Ветеринарна біотехнологія. – 2008. – № 13 (1). – С. 51—62.

2. Риженко В.П. Особливості імуногенезу при застосуванні асоційованих вакцин / В.П. Риженко, Г.Ф. Риженко, В.В. Риженко // Проблемы и перспективы паразитоценологии.

– Харьков-Луганск, 2007. – С. 149—150.

3. Улько Л.Г. Поширення бактеріальних захворювань кінцівок серед поголів’я великої рогатої худоби в господарствах Північно-Східного регіону України / Л.Г. Улько // Наук.

праці Півд. філіалу Нац. ун-ту біоресурсів і природокористування України «Крим. агротехнол.

ун-т». Сер. «Вет. науки». – Сімферополь, 2012. – Вип. 144. – С. 179—183.

4. Улько Л.Г. Основні бактеріальні асоціації за гнійно-некротичних уражень дистального відділу кінцівок у великої рогатої худоби / Л.Г. Улько // Наук. вісн. Львів. нац. ун-ту вет.

медицини та біотехнологій ім. С. З. Ґжицького. – 2012. – Т. 14. – № 2 (52). – Ч. 1. – С. 359—365.

5. Риженко В.П. Актуальні питання профілактики некробактеріозу / В.П. Риженко // Вет. мед. України. – 1998. – № 1. – С. 13—15.

6. Риженко В.П. Імунопрофілактика некробактеріозу / В.П. Риженко // Ветеринарна медицина України. – 1999. – № 5. – С. 18—20.

АГРАРНАЯ НАУКА — СЕЛЬСКОМУ ХОЗЯЙСТВУ УДК 619:616.9-036.2:981. А.В. Щербинин Алтайский государственный аграрный университет, РФ, tuv_barnaul@bk.ru К ПРОФИЛАКТИКЕ НАЛИЧИЯ LISTERIA MONOCYTOGENES В ПРОДУКЦИИ МЯСОПЕРЕРАБАТЫВАЮЩИХ ПРЕДПРИЯТИЙ Современные требования к качеству и безопасности продуктов питания предполагают все стороннюю комплексную оценку факторов, воздействующих не только на состояние защит ных функций животного, но и на здоровье человека. Наиболее значимой опасностью для бла гополучия населения является микробное загрязнение продуктов возбудителями инфекций с пищевым путем передачи. Предупреждение пищевых зоонозов требует разработки новых подходов и критериев в системе ветеринарно-санитарного контроля.( Нечаев А.Ю.,2011) Участившиеся случаи вспышек листериоза среди людей, связаны в основном с употребле нием в пищу различных продуктов питания как растительного, так и животного происхожде ния. С конца 20 века листериоз рассматривается как пищевая инфекция. (Бакулов И.А., 1967;

Бакулов И.А. с соавторами 1980;

Ralovich B., Audurier A. 1986.) В настоящее время Listeria monocytogenes относят к возбудителям эмерджентных инфек ций. Термины «эмерджентные патогены» и «эмерджентные пищевые инфекции» сегодня ши роко используются в научных публикациях и официальных документах международного со общества и ВОЗ. «По определению ВОЗ, эмерджентные инфекции — это болезни (и возбуди тели), возникающие или появляющиеся внезапно и этим обусловливающие чрезвычайные эпи демиологические ситуации, как правило напряженные. Заболевания являются наиболее эпи демиологически значимыми, наносящими большой социально-экономический ущерб». (Ефи мочкина Н.Р.,2007) В продукции, выработанной на мясоперерабатывающих предприятиях Алтайского края, не однократно выделяли Listeria monocytogene (табл.1).

Таблица 1 — Выявление Listeria monocytogenes в продукции перерабатывающих предприятий 2010 год 2011 год 2012 год 10 мес. 2013 год Проведён- Проведён- Проведён- Проведён- Случа Вид Случаев Случаев Случаев ных ных ных ных ев вы продукции выявле- выявле- выявле исследова- исследова- исследова- исследова- явле ния ния ния ний ний ний ний ния говядина 537 5 482 3 518 2 422 свинина 94 0 112 3 78 0 89 конина 6 0 11 0 12 0 6 баранина 1 0 2 1 17 0 11 мясные по 309 0 288 0 260 2 250 луфабрикаты мясная про дукция гото 342 0 297 2 316 2 331 вая к упот реблению Всего 1289 5 1192 9 1201 6 1109 При анализе данных, полученных при проведении исследований на наличии листерий в пе риод 2010-2013гг в КГБУ «Алтайская краевая ветеринарная лаборатория», выяснено, что соот ношение количества проведенных исследований на наличие листерий к количеству случаев вы деления листерий составило 0,39% в 2010г. и 0,76% в 2011г., т.е. регистрируется увеличение случаев выявлении листерий в продукции мясоперерабатывающих предприятий за период 2011 года почти в два раза. За период 2012 и 2013годы зарегистрировано 6 и 7 случаев выяв ления Listeria monocytogenes в продукции перерабатывающих предприятий, что сопоставимо с результатами полученными в 2011году.

Стоит отметить, что показатель соотношения выявления листерий в 2013 году в мясных по луфабрикатах к показателю 2012 года так же увеличился в два раза и составил 0,87% и 1,6% соответственно. Вызывает особую настороженность тот факт, что листерию выдели в 2012 и 2013 годах в продукции готовой к употреблению.

В Российской Федерации в 2010г. утверждены санитарно-эпидемиологические правила СП 3.7.2817-10 «Профилактика листериоза у людей» в которых предусмотрен ряд профилактиче ских мероприятий.

СЕМИНАР — КРУГЛЫЙ СТОЛ 9. АКТУАЛЬНЫЕ ПРОБЛЕМЫ ВЕТЕРИНАРНОЙ МЕДИЦИНЫ Профилактика листериоза, передаваемого алиментарным путем, осуществляется путем комплекса мероприятий по обеспечению населения доброкачественными, безопасными в микробиологическом отношении пищевыми продуктами, по проведению дератизации и мер по защите пищевых и сельскохозяйственных объектов от грызунов, по гигиеническому обуче нию работников, занимающихся производством, хранением, транспортировкой и реализацией пищевых продуктов (с занесением в личные медицинские книжки), и по информированию и образованию потребителей.

Меры по профилактике загрязнения листериями пищевых продуктов при их производстве и предотвращению размножения в них возбудителя при последующем хранении являются ча стью общих мер, направленных на предупреждение контаминации пищи возбудителями пище вых отравлений и инфекций.

При обнаружении листерий в продукции мясоперерабатывающего предприятия ветеринар ным специалистам и техническому персоналу необходимо принять неотложные меры по вы явлению возможных причин и условий попадания патогенных микроорганизмов в продукцию.

Требуется обратить внимание на выявление «слабых» мест производственного цикла, которые в первую очередь должны подвергаться усиленному контролю, с последующей мойкой, де зинфекцией и обязательным контролем качества проведенной дезинфекции.

При выборе объектов контроля на присутствие листерий первостепенное значение следует отдавать поверхностям, контактирующим с сырьем. Остальные поверхности могут быть ис точником вторичного заражения листериями (Мухина Л.Б., Дмитриева Е.Ю.,2003).

К наиболее вероятным местам скопления листерий на мясоперерабатывающем предпри ятии можно отнести:

- стены, потолки, полы и особенно дренажные стоки;

- холодильники и охлаждаемые помещения;

- инвентарь, предназначенный для мойки и дезинфекции;

- оборудование по производству или упаковке продукции;

- технологические поверхности, контактирующие с сырьем;

- конденсирующаяся влага (конденсат) любого происхождения;

- сжатый воздух, используемый для процедур мойки под давлением;

- любые места производственной зоны, где затруднена регулярная мойка и дезинфекция (труднодоступные места), в том числе:

- ролики конвейеров, особенно подшипникового типа;

- выключатели типа «вкл/выкл»;

- резиновые прокладки по периметру дверей;

- ремни и ленты конвейеров из тканого и пористого материалов;

- открытые подшипники технологического оборудования;

- полые части оборудования, включая емкости для сбора нарезанной продукции;

- гидравлическая смазка, изоляционные материалы;

- сочленения деталей в узлах оборудования (например, металл-металл, пластик-металл).

Выводы:

1) Выделение Listeria monocytogenes в продукции мясоперерабатывающих предприятий по казывает циркуляцию патогенного агента, что может явиться причиной увеличения возникно вения вспышек листериоза среди людей и осложнить эпидемиологическую ситуацию по лис териозу на территории Алтайского края.

2) На мясоперерабатывающих предприятиях, где выявляется продукция не соответствую щая требованиям безопасности, необходимо проводить мероприятия по установлению причи ны попадания листерий в продукцию.

Библиографический список 1. Бакулов И.А. Листериоз сельскохозяйственных животных. — М.: Изд-во « Колос», 1967.

296 с.

2. Бакулов И.А., Васильев Д.А. Листериоз как пищевая инфекция. — Ульяновск: Изд-во УСХИ, 1991. 78 с.

3. Ефимочкина Н.Р. Методы определения эмерджентных патогенных бактерий Listeria monocytogenes. // Молочная промышленность. 2007. №3. С.38-42.

АГРАРНАЯ НАУКА — СЕЛЬСКОМУ ХОЗЯЙСТВУ 4. Мухина Л.Б., Дмитриева Е.Ю. Организация контроля за распространением возбудителя листериоза Listeria monocytogenes на рыбоперерабатывающих предприятиях Российской Фе дерации. — Санкт-Петербург: Изд-во ООО «НИЦ «Моринтех», 2003. 19с.

5. Нечаев А.Ю. Обоснование методов функциональной диагностики животных на преду бойном этапе и оценки безопасности мяса при пищевых зоонозах : автореф. дис. …д-ра ве тер. наук: 06.02.05 / Нечаев Андрей Юрьевич.- СПб., 2010.- 41с.

6. Санитарно-эпидемиологические правила СП 3.1.7.2817-10 Профилактика листериоза у людей. (утв. постановлением Главного государственного санитарного врача РФ от 29 декабря 2010г. № 186).

7. Ralovich B., Audurier A. Сравнительная характеристика серотипов листерий и фаготипов, выделенных от овец, других видов животных и людей. // Ветеринария (реферативный жур нал). 1986. № 1. С. 37.

УДК 619:636.2:616.71:616.7-07:616.7- А.А. Эленшлегер Алтайский государственный аграрный университет, РФ ДИАГНОСТИКА ОСТЕОДИСТРОФИИ У КРУПНОГО РОГАТОГО СКОТА Проблема нарушений обмена веществ у животных – одна из острейших в современном животноводстве многих стран (И.П. Кондрахин 1989;

Н.А.Уразаев, В.Я. Никитин, А.Я. Кабыш и др., 1990, А.А. Эленшлегер, 1998).

Среди заболеваний, характеризующихся нарушениями обмена веществ в организме, осо бое место занимают эндемические болезни, (геохимические энзоотии). Эти болезни носят, как правило массовый характер и обычно связаны с неблагоприятными изменениями биохими ческой обстановки в природных (естественных) и антропогенных (искусственных) биогеоцено зах (БГЦ), преобразованных деятельностью человека.

В настоящее время известно более 30 болезней, связанных с нарушением минерального (макро- и микроэлементного) обмена. Одним из представителей является остеодистрофия.

I. Классификация остеодистрофии. Термин «остеодистрофия» в процессе изучения болез ни претерпел ряд трансформаций в нозологическом названии: остеомаляция, остеофиброз, остеоартроз, остеопатия, Уровская болезнь, сухотка, «хутили», алиментарная остеодистро фия, алиментарный афосфороз,, эндемический гипокальциноз, эндемический микроэлемен тоз, энзоотическая остеодистрофия, эндемическая остеодистрофия, вторичная остеодистро фия (F.Eridberger, E. Frenner, 1906;

К.М. Гольцман, 1930;

Ф. Гутира, И. Марек, 1934;

С.А. Хрусталев, 1950;

И.Г. Шарабрин, 1953;

А.Р. Евграфов, 1956;

В.И. Зайцев, 1961;

Н.З. Обжорин, 1962;

А.А. Кабыш, 1967;

С.А. Ивановский, 1967;

И.П. Кондрахин, 1979;

Н.Г. Зухрабов, К.Х. Папуниди, 1996 и др.).

Заболевание, описываемое в разное время под различным названием, не представляет со бой этиологически, патогенетически, патоморфологически однородным. Объединяющим кри терием является системное поражение всего организма с преобладанием клинически выра женных изменений в костной ткани, вызванное различными причинами, действующими чаще всего в комплексе и являющимися результатом антропогенных или антропических изменений в биоценозах, биогеоценозах, ландшафтах (почве, воде, растениях). Поэтому остеодистрофию следует рассматривать как одну из форм биогеоценотической патологии (биогеоценотический диагноз).

На основании аналитического материала и собственных научных исследований нами пред ложена классификация остеодистрофии крупного рогатого скота с учетом экологической оценки по семи принципам (Таблица 1).



Pages:     | 1 |   ...   | 2 | 3 || 5 |
 





 
© 2013 www.libed.ru - «Бесплатная библиотека научно-практических конференций»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.