авторефераты диссертаций БЕСПЛАТНАЯ БИБЛИОТЕКА РОССИИ

КОНФЕРЕНЦИИ, КНИГИ, ПОСОБИЯ, НАУЧНЫЕ ИЗДАНИЯ

<< ГЛАВНАЯ
АГРОИНЖЕНЕРИЯ
АСТРОНОМИЯ
БЕЗОПАСНОСТЬ
БИОЛОГИЯ
ЗЕМЛЯ
ИНФОРМАТИКА
ИСКУССТВОВЕДЕНИЕ
ИСТОРИЯ
КУЛЬТУРОЛОГИЯ
МАШИНОСТРОЕНИЕ
МЕДИЦИНА
МЕТАЛЛУРГИЯ
МЕХАНИКА
ПЕДАГОГИКА
ПОЛИТИКА
ПРИБОРОСТРОЕНИЕ
ПРОДОВОЛЬСТВИЕ
ПСИХОЛОГИЯ
РАДИОТЕХНИКА
СЕЛЬСКОЕ ХОЗЯЙСТВО
СОЦИОЛОГИЯ
СТРОИТЕЛЬСТВО
ТЕХНИЧЕСКИЕ НАУКИ
ТРАНСПОРТ
ФАРМАЦЕВТИКА
ФИЗИКА
ФИЗИОЛОГИЯ
ФИЛОЛОГИЯ
ФИЛОСОФИЯ
ХИМИЯ
ЭКОНОМИКА
ЭЛЕКТРОТЕХНИКА
ЭНЕРГЕТИКА
ЮРИСПРУДЕНЦИЯ
ЯЗЫКОЗНАНИЕ
РАЗНОЕ
КОНТАКТЫ


Pages:     | 1 |   ...   | 12 | 13 ||

«Современные проблемы физиологии и биохимии водных организмов том I ЭКологиЧеСКаЯ физиологиЯ и биохимиЯ водных организмов 0 ...»

-- [ Страница 14 ] --

та и развития рыб, их физической активности. В исследованиях взаимосвязи биохимических па Таблица 1. Линейно-весовые характеристики раметров с размерными характеристиками рыб сигов из озера Каменное (масса и длина) большое внимание уделяется ферментам белых мышц, участвующим в про- 2+ 3+ цессах аэробного и анаэробного синтеза АТФ M±m 18.96±0.27 20.5±0. АС, см min-max 17,6–19,7 19,6–21, (Somero, Childress, 1990;

Burness et al., 1999;

M±m 56.86±2.38 84.71±4. Norton et al., 2000, Tripathi, 1999;

Tripathi, масса, г min-max 50,00–67,00 73– Verma, 2004;

Davies, Moyes, 2007). У рыб, мыш- Количество особей 9 цы составляют большую часть тела (около 60% веса) и, таким образом, играют большую роль в Олиготрофное озеро Каменное относиткся к метаболизме всего организма и отражают темпы бассейну реки Кеми (басс. Белого моря). Пло роста всего тела рыбы. Скелетная мышца вы- щадь водоёма составляет 95,5 км2, максималь полняет не только локомоторную функцию, но ная глубина – 26 м, средняя 8 м. Вода озера ха зы-А определяли в белых мышцах методом по рактеризуется высокой прозрачностью, малой лимеразной цепной реакции в режиме реального минерализацией (9,5 мг/л) и низким содержани времени (ПЦР-РВ). Тотальную РНК обрабаты ем органических соединений (общий азот – 0, вали ДНКазой (10 ед/мл) (Силекс, Россия). Ком мг/л, общий фосфор – 0,005 мг/л). содержание плементарную ДНК (кДНК) синтезировали из кислорода – 6,5 мг/л. Вследствие низкой мине рализации и невысокой интенсивности биологи- препарата тотальной РНК с использованием ческих процессов вода озера отличается низки- MMLV-обратной транскриптазы и случайных ми величинами pH (5.97–6.49) (Поверхностные гексонуклеотидов (набор «Синтез первой цепи воды…, 2001). ДНК», Силекс). Концентрацию кДНК измеряли Сиги из озера Каменное относятся к мелкой спектрофотометрически. Амплификацию прово форме малотычнковых сигов. Особи отличают- дили на приборе i-Cycler с оптической пристав ся смешанным типом питания. По частоте кой IQ5 (BioRad) с использованием реакцион встречаемости из бентосных организмов доми- ной смеси 2.5 х для проведения ПЦР-РВ в при нируют (около 50%) личинки хиромид, подёнок, сутствии интеркалирующего красителя SYBR моллюски. Планктон представлен главным об- Green I (Синтол, Россия). Праймеры подбирали разом ветвистоусыми рачками, веслоногие рач- с помощью программы Beacon Designer 5.0. В ки малочисленны. связи с отсутствием данных по нуклеотидным Сбор рыбы осуществлялся разноячеистыми последовательностям исследуемых генов для сетями в литоральной зона на глубине 2–6 мет- сигов, использовали генетические базы данных ров. Температура воды была 11 °С. для лосося (Salmo Salar L.). Последовательности Определение активности ферментов. Актив- праймеров следующие: тяжелая цепь миозина ность ферментов определяли в белых мышцах и MyHC (GenBank DN164736) прямой 5’ – печени сигов. Ткань гомогенизировали в 0.01 М. TTCAGTGGCGTGCTTCTC – 3’, обратный трис-HCl буферном растворе (рН 7.5). Общую ак- 5’ – AAGAGGCTGGAGGATGAGG – 3’;

лактат тивность ферментов лактатдегидрогеназы (ЛДГ, дегидрогеназа-А4 (LDHA4): прямой 5’ – 1.1.1.27), глюкозо-6-фосфатдегидрогеназы (Г-6- CGTTGACATCCTGACCTAC – 3’, обратный ФДГ, 1.1.1.49), 1-глицерофосфатдегидрогеназы (1- 5’ – TCTCCGTGCTCTCCAATG – 3’ (GenBank ГФДГ, 1.1.1.8), малатдегидрогеназа (МДГ, BT043598);

цитохром с оксидаза субъединица 1.1.1.37) в печени и мышцах определяли по обще- IV (ССOIV): прямой 5’-TACGTGGGGСACAT принятым методикам (Кочетов, 1980). Активность GGTGTT – 3’, обратный 5’ – CCCAGGAG альдолазы (КФ 4.1.2.13) определяли по методике CCCTTCTCCTTC – 3’(GenBank BT043749);

фа Beck в модификации Ананьева и Обуховой (Колб, ктор элонгации EF-1 (GenBank AF321836) пря Камышников, 1976). Активность цитохром с окси- мой 5’ – TGCTGGTGGTGTTGGTGAG – 3’, об дазы (цитохромоксидаза, ЦО, КФ 1.9.З.1.) опреде- ратный 5’ – AAACGCTTCTGGCTGTAGGG – ляли по методу Смита (Smith, 1955), при этом ци- 3’. Протокол ПЦР: денатурация ДНК при 95 °С тохром с восстанавливали двукратным по массе 5 мин;

повторяющиеся циклы (50): денатурация количеством аскорбиновой кислоты в 0.02 М фос- ДНК при 95 °С 20 с, отжиг праймеров при 59 °С фатном буферном растворе (рН 7.0) в течение 2 ч по 30 с, элонгация ДНК при 72 °С по 30 с;

с пос и затем на колонке с сефадексом G-25 выделяли в ледующей процедурой плавления фрагментов восстановленной форме свободным от избытка ДНК. Концентрацию матричной РНК в виде восстановителя. кДНК определяли по стандартной кривой (Gahr Определение концентрации РНК и ДНК. То- et al., 2008). Уровень экспрессии исследуемых тальную РНК выделяли из белых мышц по Хом- генов нормализовали по уровню экспрессии ре чински и Сакхи (Chomczynski, Sacchi, 1987) с ференсного гена EF-1. Данные выражались как помощью набора «для выделения тотальной отношение концентрации мРНК исследуемого РНК Yellow Solve» (Клоноген, С.-Петербург). гена к концентрации мРНК EF-1.

Сравнение выборок по исследуемым показа ДНК белых мышц выделяли методом Альанаби телям оценивали по критерию Вилкоксона-Ман и Мартинеса (Aljanabi, Martinez, 1997). Концен на-Уитни. Различия считали достоверными при трации РНК и ДНК определяли спектрофото р0.05. Cтепень влияния исследуемых факторов метрически (спектрофотометр «SmartSpec Plus», оценивали при помощи многофакторного дис BioRad, США) (Маниатис, 1984).

персионного анализа МANOVA. Взаимосвязь Проведение полимеразной цепной реакции.

исследуемых показателей с размерами особей и Уровень экспрессии генов тяжелой цепи миози между собой оценивали при помощи линейной на, цитохром с оксидазы и лактатдегидрогена регрессии и корреляционного анализа по Спир- Цитохром с оксидаза, ключевой фермент ды мену (Юнкеров, Григорьев, 2002). хательной цепи, и малатдегидрогеназа, фермент цикла трикарбоновых кислот, в исследованиях Результаты и обсуждение используются как показатели аэробного обмена (Goolish, Adelman, 1987;

Merrit, Quattro, 2003;

Корреляция активностей ферментов в белых Gauthier et al., 2008, Koedijk et al., 2010). Основ мышцах с линейно-весовыми характеристиками ным источником энергии служит аэробный об сигов. Согласно результатам исследования наблю- мен, высокий уровень которого отражается на далась положительная взаимосвязь активности проявлении активной жизнедеятельности орга ферментов ЛДГ, ЦО, МДГ, альдолазы с длиной и низма, особенно в период роста и развития мо массой сигов обеих возрастных групп (табл. 2). лоди рыб (Озернюк 2000).

Таблица 2. Регрессионные уравнения зависимости исследуемых показателей в белых мышцах от длины и массы тела сигов двух возрастных групп ФЕРМЕНТ (Y) вОЗРАСТ Х уРАВНЕНИЕ R2 R Р длина y = -13.797 + 0.815x 0.73 0.85 0. 2+ масса y = -3.243 + 0.086x 0.59 0.77 0. ЦО длина y = -2.549 + 0.184x 0.51 0.71 0. 3+ масса y = -0.061 + 0.015x 0.85 0.92 0. длина y = -3935.24 + 238.38x 0.64 0.80 0. 2+ масса y = -1022.19 + 28.162x 0.66 0.81 0. ЛДГ длина y = -1197.29 + 73.165x 0.58 0.76 0. 3+ масса y = -3.571 + 3.734x 0.39 0.62 0. длина y = -4.055 + 0.237x 0.50 0.71 0. 2+ масса y = -0.792 + 0.022x 0.30 0.55 НД Г-6-ФДГ длина y = 4.801–0.218x 0.42 –0.65 0. 3+ масса y = 1.154–0.01x 0.30 -0.49 НД длина y = -27.822 + 1.965x 0.63 0.79 0. 2+ масса y = -1.522 + 0.192x 0.44 0.66 0. 1-ГФДГ длина y = -43.815 + 2.457x 0.75 0.87 0. 3+ масса y = -1.577 + 0.1x 0.31 0.56 НД длина y = -5.538 + 0.470x 0.55 0.74 0. 2+ масса y = 0.625 + 0.048x 0.42 0.65 0. МДГ длина y = -15.332 + 0.889x 0.71 0.84 0. 3+ масса y = -0.254 + 0.038x 0.34 0.58 0. длина y = -651.468 + 41.386x 0.61 0.78 0. 2+ масса y = -96.485 + 4.022x 0.42 0.79 0. Альдолаза длина y = -83.958 + 8.926x 0.47 0.69 0. 3+ масса y = 45.446 + 0.647x 0.63 0.79 0. Ранее было показано, что активность фер- рый является главным процессом энергообес ментов аэробного обмена (Цитратсинтаза и ци- печения при интенсивных сокращениях тохромоксидаза) коррелирует с темпами роста мышц. Согласно данным литературы, актив рыб (Mathers et al., 1992, Couture et al., 1998, ность ферментов гликолиза лактатдегидроге Lemeux et al., 2003). Продуцируемая в аэробном наза и пируваткиназа в мышцах увеличивается процессе энергия АТФ может быть затрачена на с массой тела разных видов рыб: клариевого компенсацию повышенных энергетических за- сома (Tripathi. 1999a, 1999b), радужной форе трат на синтез структурных белков, ферментов. ли (Somero, Childress, 1990;

Burness et al., Так как белые мышцы составляют большую 1999) некоторых видов морских окуней часть веса рыб, где главным образом происхо- (Norton et al. 2000, Davies, Moyes, 2007), пят дит синтез белков для растущей рыбы, то высо- нистой зубатки (Imsland et al., 2006), ювениль кий уровень аэробного метаболизма необходим ных особей Атлантической трески (Koedijk et для поддержания высокого темпа роста (Couture al., 2010). Повышение активности ферментов et al., 1998, Gauthier et al., 2008). гликолиза в белых мышцах у более крупных Активность фермента лактатдегидрогеназы особей, видимо, связано с необходимостью в белых мышцах рыб связана преимуществен- поддержания необходимого уровня энергии но с участием в анаэробном гликолизе, кото- для совершения интенсивных рывковых дви размерами особей. Такая же взаимосвязь ак жений. Кроме того, в обеих возрастных груп тивности ферментов ЛДГ и ЦО в белых мыш пах наблюдалась корреляция между активно цах с массой и длиной рыб была показана на стью ферментов ЦО и ЛДГ (табл. 3), что так же указывает на взаимосвязанное усиление ми раньше на ряпушке и форели (Мещерякова процессов аэробного и анаэробного обмена с и др., 2008, Чурова и др., 2010).

Таблица 3. Значения коэффициентов корреляции между активностью исследуемых ферментов мышц сигов двух возрастных групп ЛДГ Г6ФДГ 1-ГФДГ МДГ альдолаза 2+ 3+ 2+ 3+ 2+ 3+ 2+ 3+ 2+ 3+ ЦО 0.86* 0.82* 0.79* -0.2 0.94* 0.90* 0.83* 0.4 0.86* 0.88* ЛДГ 0.09 -0.8 0.43 0.8 0,93* 0.4 0.90* 0. Г-6-ФДГ 0.90* -0.5 0.95* -0.3 0.26 -0. 1-ГФДГ 0,97* 0.68* 0.61 0.79* МДГ 0.94* 0,81* * Достоверные значения коэффициентов корреляции при p 0,05.

Алльдолаза, фермент гликолиза и глюконеоге- ступление восстановительных эквивалентов в ды неза. Значение активности изофермента альдолазы хательную цепь.

А, определяемого в нашем исследовании, характе- Нами была проведена возрастная динамика ак ризует уровень использования углеводов в процес- тивности этих ферментов. В возрасте 3+ по срав сах аэробного и анаэробного синтеза АТФ. Поло- нению с возрастом 2+ происходило снижение ак жительная взаимосвязь активности альдолазы с тивности ЦО, МДГ, 1-ГФДГ, альдолазы, актив массой и весом особей (табл.

2), а также с фермен- ность ЛДГ достоверно не изменялась (рис. 1). Это тами ЦО, ЛДГ и МДГ (табл. 3) свидетельствует о указывает на снижение уровня аэробного обмена связанном с размерами увеличении использования с возрастом. Ранее на сиговых было также показа углеводов в энергообеспечении мышц. но снижение активности аэробных ферментов 1-Глицерофосфатдегидрогеназа фермент чел- (ЦО и цитратсинтазы) у взрослых особей по срав ночного механизма, играет важную роль в поддер- нению с сеголетками (Hinterleitner et al., 1987). На жании баланса НАД/НАДН. По нашим данным в блюдаемые различия в активности ферментов бе обеих возрастных группах сигов наблюдалась по- лых мышц с возрастом являются результатом из ложительная взаимосвязь 1-ГФДГ с массой и дли- менения двигательного режима и типа метаболиз ной особей (табл. 2), а также с активностью ЦО и ма в онтогенезе. В ходе развития рыб с увеличе МДГ (табл. 3). Таким образом, с увеличением нием массы происходит снижение интенсивности энергозатрат у более крупных особей также уси- потребления кислорода, снижение тканевого ды ливается функционирование глицерол-фосфатно- хания и, в целом, уровня стандартного обмена го челночного механизма, обеспечивающего по- (Озернюк, 1985, Goolish, 1995).

ед. 50, 45, 40, 35, 30, 25, * 20, Рис. 1. Активность ферментов в 15, * белых мышцах сигов 2+ * и 3+ (M±m) (мкмоль/мин/мг бел 10, ка, для ЛДГ и альдолазы:

* * 5, мкмоль*10-1/мин/мг белка, для ЦО- k/мг белка) 0, ЦО ЛДГ 1-ГФДГ Г-6-ФДГ МДГ альдолаза * Достоверность различий при p 0.05.

2+ 3+ Глюкозо-6-фосфатдегидрогеназа (Г-6-ФДГ), Согласно нашему исследованию наблюда индикатор пентозо-фосфатного пути. В резуль- лась положительная корреляция уровня экс тате цикла происходит образование пентоз, уча- прессии генов LDH-A и ССO с размерами тела ствующих в дальнейшем синтезе нуклеиновых (табл. 4). У сигов в возрасте 3+ значения коэф кислот, а также восстановительных эквивален- фициентов корреляции были достоверны только тов НАДФН, необходимых для биосинтеза жир- с массой. Кроме того в обеих возрастных груп ных кислот, холестерина, стероидных гормонов, пах взаимосвязь активности этих ферментов с сфинголипидов. В различных органах и тканях уровнем экспрессии генов была положительной пентозо-фосфатный путь имеет разную интен- (табл. 4). Данные результаты свидетельствует о сивность (Tian et al., 1998). В нашем исследова- регуляции активностей ферментов на уровне нии достоверных значений зависимости актив- транскрипции, связанной с размерно-весовой ности Г-6-ФДГ в мышцах с массой не наблюда- дифференциацией рыб. Уровень экспрессии ге лось, а значение коэффициента корреляции с на LDH-А с возрастом усиливался, а гена ССО с длиной в возрасте 3+ менялись с положительно- возрастом достоверно не изменялся (рис. 2).

го на отрицательное (табл. 2). С возрастом ак- Уровень экспрессии тяжелой цепи мио тивность фермента также снижалась (рис. 1). зина. Миозин является одним из основных Взаимосвязь активности Г-6-ФДГ с ферментами белков в мышце и составляет 25% от общего аэробного обмена наблюдалась только в мыш- содержания белка всего организма (Weiss et цах сигов в возрасте 2+, у четырехлеток корре- al., 1999;

Baldwin and Haddad, 2001) и 50% от ляции не обнаружено (табл. 3). Таким образом, количества всех мышечных белков (Watabe данные по активности Г-6-ФДГ указывают на and Ikeda, 2006). Выбранная для исследования то, что в более старшем возрасте происходит пе- изоформа тяжелой цепи миозина относится рераспределение расходования углеводов в сто- ко второму классу миозинов. Белки второго рону энергообеспечения, а не восстановитель- класса, которые считаются собственно миози ных процессов. нами, экспрессируются в поперечно-полоса тых мышцах и непосредственно участвуют в Взаимосвязь экспрессии генов LDH-A и сокращении (Regiani and Bottinelli., 2008). Рас ССO с размерами рыб и активностью этих ферментов. Одним из важных вопросов биоло- положение и обильность этих протеинов в бе гии является исследование механизмов регуля- лой мышце, делает их идеальными кандидата ции концентрации ферментов во взаимосвязи с ми для оценки роста рыб. У рыб ген тяжелой размерами тела. Регуляция синтеза ферментов цепи миозина экспрессируетя в течение всей de novo осуществляется на уровне транскрип- жизни (Hevroy et al., 2006;

Regiani and ции или на посттранскрипционном уровне Bottinelli., 2008). Было показано, что экспрес (Burness et al., 1999). В последнее время появля- сия гена MyHC коррелирует с темпами роста ется всё больше исследований по изучению экс- некоторых видов рыб и может быть использо прессии генов аэробных и анаэробных фермен- ван как показатель, отражающий закономер тов и их взаимосвязи с активностью ферментов ности прироста мышечной массы (Overturf and и размерами тела (Yang, Somero, 1996, Burness Hardy., 2001, Hevroy et al., 2006, Imsland et al., et al., 1999, Davies, Moyes, 2007). 2006, Dhillon R. et al., 2008).

Таблица 4. Регрессионные уравнения зависимости содержания мРНК ССО и мРНК LDH-A в белых мышцах от длины и массы тела сигов двух возрастных групп ПОКАЗАТЕЛЬ ВОЗРАСТ Х УРАВНЕНИЕ R2 R Р (Y) ДЛИНА Y = -5.967 + 0.377X 0.53 0.73 0. 2+ МАССА Y = -1.109 + 0.040X 0.44 0.66 0. МРНК ССО ДЛИНА Y = -1.817 + 0.129X 0.20 0.44 НД 3+ МАССА Y = -0.127 + 0.012X 0.44 0.67 0. ДЛИНА Y =-14.303 + 0.808X 0.62 0,79 0. 2+ МАССА Y =-5.098 + 0.107X 0.80 0,89 0. МРНК LDH-A ДЛИНА Y = -14.0034 + 0.806X 0.26 0.51 НД 3+ МАССА Y = -4.956 + 0.089Ч 0.81 0.90 0. 2+ Y = 0.369 + 0.493X 0.82 0.91 0. МРНК ССО АКТИВНОСТЬ ЦО 3+ Y= 0.193 + 0.569X 0.67 0.84 0. 2+ Y= -0.605 + 0.003X 0.65 0.81 0. МРНК LDH-A4 АКТИВНОСТЬ ЛДГ 3+ Y = -1.145 + 0.012X 0.34 0.58 0. ед. 4, * 3, 3, 2, 2, 1, Рис. 2. Уровень экспрессии генов (мРНК исследуемого 1, гена / мРНК EF-1) в белых * мышцах сигов двух возрас 0, тных групп (M±m).

0,00 * Достоверность различий при p 0. MyHC ЛДГ-A CCO 2+ 3+ Согласно результатам нашего исследова- происходят более интенсивно, чем у трёх ния уровень экспрессии гена MyHC положи- леток.

тельно коррелировал с массой и длиной тела Отмеченная положительная корреляция актив сигов из озера Каменное не зависимо от их ности цитохром с оксидазы и ЛДГ, а также уровня возраста (табл. 5). При этом значение коэффи- экспрессии генов этих ферментов с уровнем циентов корреляции, а также уровень экспрес- мРНК MyHC (табл. 6), указывают на увеличение сии гена миозина с возрастом увеличивались энергетических потребностей по мере увеличение (рис. 2). Данные результаты указывают, на то, процессов прироста мышечной массы. Ранее так что более большие особи отличаются боль- же было показано, что для рыб существует поло шим темпом прироста мышечной массы. жительная корреляция между общей активностью Вероятно, что у четырёхлеток сигов прирост ЛДГ и приростом мышечной массы (Ahmad, скелетной мускулатуры и массонакопление Hasnain, 2005;

Guderley, 2004).

Таблица 5. Регрессионные уравнения зависимости уровня экспрессии гена MyHC, показателя РНК/ДНК в белых мышцах от длины и массы тела сигов двух возрастных групп ПОКАЗАТЕЛЬ (Y) вОЗРАСТ Х уРАВНЕНИЕ R2 R Р ДЛИНА Y = -0.349 + 0.030X 0.34 0.58 0. 2+ МАССА Y = -0.091 + 0.005X 0.68 0.82 0. МРНК MYHC ДЛИНА Y = -3.876 + 0.216X 0.81 0.90 0. 3+ МАССА Y = -0.701 + 0.015X 0.84 0.92 0. ДЛИНА Y = 4.481–0.195X -0.49 -0,70 НД 2+ МАССА Y = 1.870–0.019X -0.55 -0,74 НД РНК/ДНК ДЛИНА Y = -2.160 + 0.158X 0.66 0.82 0. 3+ МАССА Y = 0.526 + 0.007X 0.35 0.58 0. Таблица 6. Корреляция некоторых исследуемых Показатель РНК/ДНК. Многочисленными ис показателей с уровнем экспрессии гена MyHC следованиями показано, что концентрация РНК в в мышцах сигов двух возрастных групп тканях прямо связана с уровнем синтеза белка (Houlihan, 1991, Houlihan, 1993, Vinagre еt al., 2008).

мРНК MyHC Количество рибонуклеиновой кислоты, выражае 2+ 3+ мой как мг РНК мг-1 ДНК (отношение РНК/ДНК) ЦО 0.12 0.92* ЛДГ 0,33 0.79* используется как биохимический показатель роста мРНК LDH-A4 0.66* 0.94* в разных контекстах как для пресноводных, так и мРНК ССО 0.36 0.80* для морских видов рыб (Grant, 1996, Chcharo, РНК/ДНК -0.57 0.64* Chcharo, 2008). Индекс РНК/ДНК отражает уро * Достоверные значения коэффициентов корреляции при вень синтеза протеинов на клетку, тогда как уро p 0,05. вень клеточной РНК варьирует в зависимости от уровня синтеза протеинов, в то время как содержа- возраста, условий обитания исследуемых рыб, ние ДНК остается постоянным (Buckley, 1984). сезона (Grant G.C., 1996).

Было показано, что РНК/ДНК и РНК/протеин положительно коррелирует с темпами роста ло- Заключение сосёвых (Wang et al., 1993, Widler, Stanley, 1982, Таким образом, проведенное нами исследо Crant, 1996) и других видов рыб (Rooker, Holt, вание позволяет выявить некоторые закономер 1996, Mathers et al., 1992;

Houlihan et al., 1993;

ности энергетических и пластических процессов Peragon et al., 2001). В нашем исследовании зна в мышцах при формировании размерно-весовой чение коэффициента корреляции индекса разнокачественности у сигов в разных возрас РНК/ДНК с размерами особей варьировало меж тных группах (у сигов в возрасте 2+ и 3+). У бо ду возрастными группами. Положительная кор лее больших рыб усиливаются аэробный и анаэ реляция показателя с массой тела наблюдалась робный обмен, что связано с увеличением энер только в возрасте 3+, в возрасте 2+ значение ко гетических затрат как на обеспечение локомо эффициента корреляции было отрицательное торной активности, так и на процессы роста (табл. 5). Значение показателя увеличивалось с особей, прирост мышечной массы. С возрастом возрастом (с 0,61±0,06 до 1,04±0,14, p 0.05), при и размерами происходит увеличение экспрессии этом концентрация белка в мышцах ткани также тяжелой цепи миозина, что свидетельствует о повышалось (24,78±4,83 до 30,65±2,35 мг/г так том, что у четырёхлеток прирост скелетной мус ни, p 0.05). Таким образом можно заключить, кулатуры и массонакопление происходят более что уровень синтеза белка у рыб в возрасте 3+ интенсивно, чем у трёхлеток. Наши результаты выше, чем в возрасте 2+. Кроме того была отме показывают, что значение уровня экспрессии ге чена положительная корреляция показателя на миозина, в отличие от показателя РНК/ДНК, РНК/ДНК с уровнем экспрессии гена MyHC у че более чётко отражает процессы роста сигов и тырёхлеток (табл. 6). Это ещё раз подтверждает взаимосвязь их с размерами.

наше предположение об усилении роста (глав ным образом прироста мышечной ткани) с уве Работа выполнена при финансовой поддержке личением размеров рыб в более старшем возрас гранта Президента РФ «Ведущие научные школы те. Согласно данным литературы взаимосвязь по казателя РНК/ДНК с размерами рыб может быть России» НШ-3731.2010.4;

гранта РФФИ 08-04 как положительной (Azuma et al., 1998, Rooker, 01140, программы ОБН РАН «Биологические ре Holt, 1996, Tripathi, Verma, 2004b), так и отрица- сурсы России на 2009–2011 гг.» и ФЦП «Научные и научно-педагогические кадры инновационной тельной (Backley and Lough, 1987, Houlihan et al., России на 2009–2013 гг.» проект НК-28(12).

1993), что, вероятно, зависит от стадии развития, Литература Маниатис Т., Фрич Э., Сэмбрук Дж., 1984. Методы Baldwin K.M., Haddad F., 2001. Plasticity in skeletal, генетической инженерии. Молекулярное клонирова- cardiac, and smooth muscle: Invited review: Effects of ние. – М.: Мир. – 480 с. different activity and inactivity paradigms on myosin heavy Озернюк Н. Д., 2000. Биоэнергетика онтогенеза. М.: chain gene expression in striated muscle // J. Appl. Physiol.

Изд-во МГУ. 259 с. V. 90. P. 345–357.

Чурова М. В., Мещерякова О. В., Немова Н. Н., Ша- Burness G.P., Leary S.C., Hochachka P.W., Moyes, C. D., туновский М. И., 2010. Соотношение роста и некото- 1999. Allometric scaling of RNA, DNA, and enzyme levels in рых биохимических показателей рыб на примере мики- fish muscle // Am. J. Physiol. V. 277. P. R1164-R1170.

жи Parasalmo mykiss Walb. // Известия РАН. Сер. Биол. Chcharo M.A., Chcharo L., 2008. RNA:DNA ratio 2010. № 3. с. 289–299. and other nucleic acid derived indices in marine ecology // Ahmad R, Hasnain A.U., 2005. Ontogenetic changes Int J Mol Sci. V. 9. P. 1453–1471.

and developmental adjustments in lactate dehydrogenase Davies R., Moys C.D., 2007. Allometric scaling in isozymes of an obligate air-breathing fish Channa punctatus centrarchid fish: origins of intra- and inter-specific variation during deprivation of air access // Comp Biochem Physiol in oxidative and glycolytic enzyme levels in muscle // The B Biochem Mol Biol. V. 140. P. 271–8. Journal of Experimental Biology. V. 210. P. 3798– Azuma T., Yada T., Ueno Y., Iwata M., 1998. Dhillon R.S., Wang Y., Tufts B.L., 2008. Using Biochemical approach to assessing growth characteristics in molecular tools to assess muscle growth in fish:

salmonids // NPAFC Bull. No. 1. – P. 103–111. Applications for aquaculture and fisheries management // Buckley L.G., 1984. RNA-DNA ratio: an index of Comparative Biochemistry and Physiology Part C:

larval fish growth in the sea // Mar.Biol. V. 80. P. 291–298. Toxicology & Pharmacology. V. 148. P. 452.

Gauthier C, Campbell P, Couture P., 2008. monitoring growth rates // Can J. Fish Aquat. Sci.V. 63.

Physiological correlates of growth and condition in the P. 1959–1967.

yellow perch (Perca flavescens) // Comparative Koedijk R.M., Le Franois N.R., Blier P.U., Foss A., Biochemistry and Physiology, Part A V. 151. P. 526–532. Folkvord A., Ditlecadet., Lamarre S.G., Stefansson S.O., Gahr S.A., Vallejo R.L., Weber G.M., Shepherd B.S., Imsland A.K., 2010. Ontogenetic effects of diet during early Silverstein J.T., Rexroad C.E.3rd., 2008. Effects of short- development on growth performance, myosin mRNA term growth hormone treatment on liver and muscle expression and metabolic enzyme activity in Atlantic cod transcriptomes in rainbow trout (Oncorhynchus mykiss) // juveniles reared at different salinities // Comp Biochem Physiol Genomics. V. 32. P. 380–392. Physiol A Mol Integr Physiol. V. 156. P. 102–9.

Goolish, E.M., Adelman, I.R., 1987. Tissue specific Overturf K., Hardy R., 2001. Myosin expression levels in cytochrome c oxidase activity in largemouth bass: the trout muscle: a new method of monitoring specific growth metabolic cost of feeding and growth // Physiological rates for rainbow trout Oncorhynchus mykiss (Walbaum) on Zoology. V. 60. P. 454–464. varied planes of nutrition // Aquat. Res. V. 32. P. 315–322.

Grant G.C., 1996. RNA-DNA ratios in white muscle Reggiani C., Bottinelli R., 2008. Myosin II: Sarcomeric tissue biopsies reflect recent growth rates of adult brown myosins, the motors of contraction in cardiac and skeletal trout // Journal of Fish Biology. N48. P. 1223–1230. muscles / (Ed.) L.M. Coluccio. Myosins. Netherlands:

Guderley H., 2004. Locomotor performance and muscle Springer. P. 125–169.

metabolic capacities: impact of temperature and energetic Somero G.N., Childress J.J., 1990. Scaling of ATP status // Comp. Biochem. Physiol. B Biochem. Mol. Biol. supplying enzymes, myofibrillar proteins and buffering V. 139. P. 371–382. capacity in fish muscle: relationship to locomotory habit // Hevroy E.M., Jordal A-E.O., Hordvik I., Espe M., J.exp. Biol. V. 149. P. 319–333.

Hemre G-I., Olsvik P.A., 2006. Myosin heavy chain Tripathi G., 1999 (а). Scaling of some metabolic mRNA expression correlates higher with muscle protein enzymes in liver of freshwater teleost: an adaptive accretion than growth in Atlantic salmon, Salmo salar // mechanism // Z. Naturforsch. V. 54 c, P. 1103–1106.

Aquaculture. V. 252. P. 453–461. Tripathi G., 1999 (b). Scaling of cytoplasmic and Houlihan D.F., Mathers E.M., Foster A., 1993. mitochondrial enzymes and proteins in skeletal muscle of a Biochemical correlates of growth rate in fish. In: Fish catfish // J.Annim.Physiol. a. Anim.Nutr. 83, p. 50– Ecophysiology / J.C. Rankin, F.B. Jensen. London UK: Tripathi G., Verma P., 2004. Scaling effects on Chapman and Hall. P. 45–71. metabolism of a teleost // Experimentall Zoology Part A:

Huss M., Bystrom P., Persson L., 2008. Resource Comparative Experimental Biology. V. 301A. P. 718– heterogeneity, diet shifts and intra-cohort competition: Watabe S., Ikeda D., 2006. Diversity of the pufferfish effects on size divergence in YOY fish // Oecologia. Takifugu rubripes fast skeletal myosin heavy chain genes // V. 158. P. 249–257. Comp. Biochem. Physiol. V. 1D. P. 28–34.

Imsland A.K., Le Francois N.R., Lammare S.G., Yang T., Somero G.N., 1996. Activity of lactate Ditlecadet D., Sigurosson S., Foss A. 2006. Myosin dehydrogenase but not its concentration of messenger RNA expression levels and enzyme activity in juvenile spotted Increases with body Size barred sand bass, Paralabrax wolfish (Anarhichas minor) muscle: a method for nebulifer (Teleostei) // Biol. Bull. V. 191. P. 155–158.

RELATIONSHIP BETWEEN GROWTH CHARACTERISTICS, ACTIVITIES OF SEVERAL ENZYMES AND GENETIC-MOLECULAR PARAMETERS IN WHITE MUSCLE OF WHITEFISH OF DIFFERENT AGES FROM LAKE KAMENNOE (REPUBLIC OF KARELIA) M.V. Churova, O.V. Meshcheryakova, N.N. Nemova Institute of Biology, Karelian Research Centre, Russian Academy of Sciences, Petrozavodsk, Russia, e-mail: mchurova@yandex.ru The present study was designed to elucidate the Karelia). Relationships between studied parameters relationship between the several biochemical were also estimated.

parameters with weight and length of fish. We According to the results of research activities of studied, activities of cytochrome c oxidase (CCO), LDH, CCO, MDH, 1GPDH, expression levels of lactate dehydrogenase (LDH), glucose-6-phosphate LDH-A and CCO genes in muscle were well correlated dehydrogenase (G6PDH) and 1-glycerophosphate with length and weight of fishes within each age dehydrogenase (GPDH), expression levels of cohort. There were differences in relationship of several genes (LDH-A, CCO-IV, Myosin heavy RNA/DNA with weight and length between fish chain (MyHC), RNA/DNA ratio in white muscles groups. Relationship between MyHC expression level of whitefish (Coregonus lavaretus L.) of two age in white muscle and growth characteristics of fish was group (2+, 3+) from Lake Kamennoe (Republic of positive for whitefish of both ages.

ОТВЕТНЫЕ РЕАКЦИИ АРТЕМИИ НА ДЕЙСТВИЕ УЛЬТРАФИОЛЕТОВОГО ИЗЛУЧЕНИЯ В. Г. Шайда, Е. Н. Скуратовская, И. И. Руднева Институт биологии южных морей НАН Украины, Севастополь, Украина, e-mail: svg-41@mail.ru Изучали действие УФ-облучения (источник дозы УФ-радиации являются губительными облучения – бактерицидная лампа КВАРЦ-24) на (Zagarese, Williamson, 2001;

Wrona et al., 2006).

артемию Artemia sp. Показатели выклева личинок Так как УФ-излучение приводит к деструкции из облученных цист превышали таковые у интакт- биологических молекул и тем самым нарушает ных яиц. Параметры теплопродукции рачков, под- состояние обменных процессов, то для выяснения вергнутых действию УФ-радиации, были в 2 раза механизмов его действия наиболее адекватную ниже по сравнению с таковыми у контрольных информацию можно получить при анализе особей (7.36+0.34 против 15.40+2.37 соответст- биохимических параметров. Однако, их венно), что свидетельствует о существенном нару- изменения не всегда четко выражены и имеют шении энергетического баланса у облученных ар- одинаковую направленность, вектор откликов во темий. Обсуждается вопрос о возможных послед- многом зависит от концентрации действующего ствиях усиления интенсивности ультрафиолето- фактора и физиологического состояния организ вой радиации для водных организмов. ма. Следует учитывать также, что все биохимиче ские измерения возможны только после гибели животных, что вносит дополнительный стрессо Введение вый фактор. В связи с этим особую значимость Ультрафиолет обладает большей энергией приобретают такие тест-системы, которые позво фотона, чем остальное излучение, достигающее ляют оценить биологические эффекты неблаго поверхности Земли. Биологические эффекты приятных факторов, включая УФ-радиацию, при УФ-радиации проявляются на всех уровнях ор- жизненно в течение достаточно короткого време ганизации живой материи – от молекулярного ни, не травмируя тест-объект. Для этих целей су до биосферного. УФ-излучение повреждает био- ществует ряд подходов, в частности, анализ пове молекулы, прежде всего нуклеиновые кислоты и денческих реакций, выживаемости и т.д. Одним белки, инициирует окислительные процессы, в из наиболее чувствительных методов является ми результате которых образуются свободные ра- крокалориметрия, позволяющая с высокой точно дикалы, поражающие клеточные мембраны и стью измерить общий метаболизм организма и его другие структурные компоненты клеток и тка- изменения прижизненно.

ней, что в ряде случаев приводит к их гибели Известно, что жизнедеятельность организма или канцерогенезу (Diffey, 1991) связана с переходом одних видов энергии в дру УФ-излучение влияет не только на наземные гие, что сопряжено с выделением и поглощени экосистемы, но и проникает в воду. Его эффекты ем тепла. Исследование тепловых процессов при этом зависят от физико-химических свойств живых систем позволяет проанализировать та воды и глубины. Известно, что ультрафиолет А кие важнейшие свойства объекта как теплоем (320–400 нм) в океанических экосистемах может кость, теплопроводность, внутренняя энергия, проникать на глубину до 23 м, а наиболее опас- энтальпия, энтропия, а также их изменения под ный ультрафиолет В (290–320 нм) – на глубину до действием различных, в том числе неблагопри 7–12 м, где в основном происходит размножение ятных факторов. В связи с этим теплопродукция и развитие рыб, морских беспозвоночных и интен- организма является интегральным параметром, сивный фотосинтез. Для многих гидробионтов, реагирующим даже на незначительные измене особенно на ранних стадиях развития, даже малые ния окружающей среды.

Водные организмы очень чувствительны к м от поверхности воды. После воздействия рач флуктуациям условий обитания. Вариации био- ков помещали в микрокалориметр для анализа тических и абиотических факторов вызывают теплопродукции.

сдвиги обмена веществ, влияют на рост, разви- Определение теплопродукции проводили на тие, поведение, плодовитость и воспроизводст- Мониторе биологической активности ТАМ во гидробионтов. Проблема приобретает особое (Thermometric 2277 Thermal Activity Monitor, LKB, Швеция) при +200 С в течение 50 часов.

значение в настоящее время в связи с глобаль ными изменениями на планете, что приводит к Артемию помещали в ампулу, содержащую существенным, порой необратимым нарушени- мл стерильной морской воды. В качестве холо ям жизнедеятельности обитателей водных сис- стой пробы использовали стерильную морскую тем. В связи с этим своевременная и адекватная воду, против которой проводили измерение теп оценка их состояния и разработка соответству- лового потока. Обе ампулы устанавливали в ющих методов для этого приобретает все боль- Монитор для измерения теплопродукции. Одно шую значимость и актуальность. временно в таких же условиях содержали рач Метод микрокалориметрии позволяет изу- ков для контроля их состояния. В опытной и чать процессы ранних сдвигов обменных реак- контрольной группе исследовали по 5 особей, ций гидробионтов в прижизненном состоянии. величину теплопродукции выражали в В изменяющихся условиях среды и адаптаций к мкВт/особь. Результаты обрабатывали статисти ним происходит интенсивное поглощение кис- чески по (Лакин, 1990).

лорода, усиление энергетического обмена, сме на энергетических субстратов, изменение степе- Результаты и обсуждение ни проницаемости клеточных мембран. Все эти Результаты исследований показали, что УФ реакции оказывают существенное влияние на облучение цист артемии в малых дозах вызывало проявление метаболической активности, кото увеличение выклева науплиусов почти в 2 раза по рую можно определить с помощью метода мик сравнению с контролем (рис. 1). Максимальный рокалориметрии на Мониторе биологической выклев происходил при облучении цист в течение активности ТАМ 2277 (Швеция, LKB). Получае 120 секунд на расстоянии 100 см от источника.

мые при этом термограммы фиксируют с высо Вместе с тем наблюдаемые эффекты носили нели кой степенью точности теплопродукцию орга нейный характер. Выклев личинок возрастал че низма в течение определенного заданного вре рез 30 секунд после воздействия на цисты, нахо мени.

дящиеся на всех трех расстояниях от источника На этом основании целью настоящей работы облучения, затем несколько снижался после 60 явилось исследование биологических эффектов минутного воздействия. Вылупление науплиусов УФ-радиации у артемии Artemia sp. как тради из яиц, облученных в течение 120 сек на расстоя ционными методами, так и с помощью метода нии 10 и 50 см от лампы, имел сходные значения с микрокалориметрии.

предыдущим вариантом, тогда как число личинок, выклюнувшихся из цист, облученных на расстоя Материалы и методы исследований нии 100 см от лампы, достоверно увеличивалось.

Cухие цисты артемии, собранные в январе Таким образом, кратковременное УФ-облучение 2010 г. в Сакском озере (Крым, Украина), облу- цист артемии в малых дозах стимулировало вы чали бактерицидной лампой Кварц-240 с диапа- клев науплиусов, но отклики при этом носили не зоном излучения 280–400 нм на расстоянии 10, линейный характер.

50 и 100 см от источника излучения. Время об- Типичные термограммы взрослых рачков лучения составило 30, 60 и 120 секунд. Контро- приведены на рисунке 2. Интенсивное движение лем служили необлученные цисты. Все экспери- артемии в ампуле продолжалось в течение 20– менты проводили в трех повторностях. Опреде- 30 часов (в отдельных случаях до 40 час), после ляли процент выклева науплиусов из цист, кото- чего активность снижалась, теплопродукция ре рый рассчитывали как отношение выклюнув- зко падала, и рачок погибал. Как видно на ри шихся личинок к общему числу цист через 48 сунке, уровень теплового потока у облученных часов инкубации в воде (соленость 18‰) в каме- артемий значительно ниже по сравнению с кон ре Богорова. трольными особями, также как и их двигатель Проводили также облучение взрослых осо- ная активность. Результаты статистического бей артемии в течение 10 минут на расстоянии 1 анализа теплопродукции приведены в таблице.

35 % 10 Рис. 1. Вылупление науплиусов артемии (M + m) после УФ-облу чения цист (источник облучения – бактерицидная лампа Кварц-240) 30 60 Из приведенных данных можно заключить, что теплопродукция рачков, подвергнутых действию УФ-облучения, в 2 раза ниже по сравнению с соответствующими параметрами интактных особей. Достоверное уменьшение теплового потока отмечено также у облучен ных артемий в расчете на мг массы. Макси мальная теплопродукция была снижена у опытных рачков по сравнению с контроль ными.

Таким образом, увеличение выклева личинок из облученных цист свидетельствует о стимули рующем эффекте малых доз УФ-облучения, что было отмечено и для других видов воздействия на организмы (Бурлакова и др., 2004). Значи тельное снижение теплопродукции у облучен ных рачков связано с разбалансированием про цессов генерации и утилизации энергии, что мо жет быть обусловлено повреждением митохонд рий и нарушением протекающих в них метабо лических реакций (Wu et al., 2007). В то же вре мя нельзя исключать и изменения уровня сво боднорадикальных процессов, инициируемых УФ-излучением, что также может существенно повлиять на состояние энергетического обмена ракообразных. Известно, что ультрафиолетовое облучение рыб в экспериментальных условиях значительно сокращает содержание глутатиона в коже и в мышцах, увеличивает концентрацию супероксидрадикала и перекиси водорода, ТБК реактивных продуктов, что сопряжено с разви Рис. 2. Типичные термограммы взрослых особей тием окислительного стресса (Charron et al., артемии, полученные на Мониторе биологичес 2007).

кой активности ТАМ- Показатели теплопродукции артемии (M+m, n=5), подвергнутой действию УФ-облучения (источник облучения – бактерицидная лампа Кварц-240, время 10 мин, расстояние 1 м) Показатели теплопродукции Контроль Опыт Достоверность различий, р Средняя теплопродукция, мкВт/ особь 15.40+2.37 7.36+0.34 0. Средняя теплопродукция, мкВт/ мг массы 3.08+0.15 1.47+0.06 0. Максимальная теплопродукция, мкВт/ особь 36.3+2.3 15.1+3.4 0. Таким образом, снижение теплопродукции Выводы является неспецифическим комплексным отве 1. Кратковременное УФ-облучение цист арте том гидробионтов на действие УФ-облучения, а мии в малых дозах стимулировало выклев наупли параметры теплопродукции – чувствительным усов, но отклики при этом носили нелинейный ха индикатором состояния организма, подвергну рактер.


того действию ультрафиолета. Уменьшение теп 2. Теплопродукция рачков, подвергнутых дей лового потока было отмечено нами ранее у ли чинок артемии, вылупившихся из облученных ствию УФ-облучения, в 2 раза ниже по сравнению с соответствующими параметрами интактных осо яиц (Шайда, Руднева 2004). Полученные данные бей, что связано с разбалансированием процессов могут быть использованы в мониторинге состо генерации и утилизации энергии.

яния гидробионтов, обитающих в акваториях, 3. Показатели теплопродукции гидробионтов, подверженных высокой инсоляции, а также для контроля дозы УФ-облучения, применяемой для подвергнутых действию УФ-радиации, отражают комплексный ответ и могут служить эффективным обеззараживания воды в условиях аквакульту биоиндикатором для оценки состояния организма в ры. В этом случае реакция является универсаль неблагоприятных условиях и использоваться в мо ной и неспецифической, однако весьма чувстви ниторинговых программах и исследованиях состо тельной, так как отклики фиксировали при дос яния окружающей среды и ее обитателей.

таточно низких дозах УФ-радиации.

Литература Бурлакова Е. Б., Конрадов А. А., Мальцева Е. Л. Diffey B.L. Solar ultraviolet radiation effects on Сверхслабые воздействия химических соединений и biological systems // «Physics in Medicine and физических факторов на биологические системы.// Biology», 1991, V. 36(3), P. 299–328.

Биофизика, 2004, Т. 49 (3), С. 551–564. Wrona F.J., Prowse T.D., Reist J.D., Hobbie J.E., Лакин Г. Ф. Биометрия. М.: Высшая школа. 1990. Levesque L.M.J., Macdonald R.W., Vincent W.F.

250 с. Effevts of Ultraviolet radiation and contaminant-related Шайда В. Г., Руднева И. И. Влияние ультрафио- stressors on Arctic freshwater ecosystems // «Ambio», летового облучения на артемию (Artemia salina L) // 2006, V. 35, N 7, P. 388– «Вісник Одеського національного університету», Wu Y., Xing D., Liu L., Chen T., Chen W.R.

2004. Т. 9, вип.5. С. 133–139. Fluorescence response energy transfer analysis of bid Charron R.A., Fenwick J. C., Lean D.R.S., Moon activation in living cells during ultraviolet-induced apoptosis.

W. Ultraviolet-B radiation effects on antioxidant // Biochem. Biophys. Acta., 2007, V. 39(2), P. 37–45.

status and survival in the zebrafish Brachydanio rerio. Zagarese, H.E., Williamson C.E. The implications of // Photochem. and Photobiol. 2007, V. 72. P. 327– solar UV radiation exposure for fish and fisheries // 333. «Fish and Fisheries», 2001, V. 2, P. 250–260.

RESPONSES OF ARTEMIA ON UV-RADIATION V.G. Shaida, E.N. Skuratovskaya, I.I. Rudneva Institute of the Biology of the Southern Seas National Ukrainian Academy of Sciences,Sevastopol, e-mail: svg-41@mail.ru The effects of UV-irradiation (source was lower than in control (7.36+0.34 vs 15.8+2. bactericide lamp KWARTZ-240) on Artemia sp. respectively), that caused of the significant damage were studied. The hatching value of treatment cysts of energetic balance in irradiated crustacea. The were higher as compared with the intact specimen. consequences of UV-radiation increase for marine Heat production of irradiated adults was in 2-fold organisms is discussed.

АКТИВНОСТЬ ЭТОКСИРЕЗОРУФИН-О-ДИЭТИЛАЗЫ (ЭРОД) РЫБ КАК БИОМАРКЕР ЗАГРЯЗНЕНИЯ ВОДНОЙ СРЕДЫ СТОЙКИМИ ОРГАНИЧЕСКИМИ ЗАГРЯЗНЯЮЩИМИ ВЕЩЕСТВАМИ В. В. Юрченко, Г. М. Чуйко Учреждение Российской академии наук Институт биологии внутренних вод им. И. Д. Папанина РАН, п. Борок, Ярославская обл., Россия e-mail: viksapiksa@mail.ru Органические загрязнители водных объектов Возможно, никаким другим монооксигеназам в большинстве своём представлены липофиль- не было уделено такого большого внимания как ными ксенобиотиками. В связи с этим они спо- подсемейству CYP1A-содержащих оксигеназ собны легко проникать через клеточные мемб- (cytochrome P450 family 1 subfamily A), так как раны жабр, кожи, органов пищеварительной си- оно играет ключевую роль в биотрансформации стемы, что обуславливает их высокую биодос- планарных галогенированных и полицикличес тупность для рыб. Последующая судьба и био- ких ароматических углеводородов, а также стру логические эффекты чужеродных соединений в ктурно сходных соединений. Попадая в организм значительной степени зависят от возможности рыб, эти ксенобитики вызывают индукцию CYP1A, которая проявляется в повышении ак их включения в процесс биотрансформации.

тивности этоксирезоруфин-О-диэтилазы (ЭРОД) Биотрансформация липофильных соединений (Sarasquete, Segner, 2000).

состоит из двух фаз. В первой фазе (phase I), ок ЭРОД, как и остальные Р450-содержащие сидативной, главная роль принадлежит оксиге назным системам, которые, окисляя гидрофоб- ферменты, является мембраноассоциированным ные молекулы ксенобиотика, увеличивают его белком эндоплазматического ретикулума. Мо водорастворимость. Во второй фазе (phase II) нооксигеназная система ЭПР, вероятно, состоит продукты оксигеназных реакций коньюгируют с из трёх компонентов: НАДФН-специфичный различными водорастворимыми эндогенными протеид, цитохром b5 и цитохром Р450 (Арча соединениями посредством трансфераз (и неко- ков, 1983).

торых других групп ферментов) и удаляются На субклеточном уровне наибольшая ЭРОД экскреторными органами (Di Giulio et al., 1995). активность отмечается в микросомальной фрак Биотрансформация ксенобиотиков является ции. На клеточно-тканевом – максимальную ин функциональным звеном более общего процесса в дукцию CYP1A демонстрирует эндотелий живой системе – увеличения полярности окисляе- (Smolowitz et al., 1991;

Stegeman et al., 1991). На мых молекул, по этому пути происходит превра- уровне органов и их систем в организме рыб щение гидрофобных эндогенных соединений (сте- CYP1A-содержащие ферменты концентрируют роидов, длинноцепочечных жирных кислот и др.). ся главным образом в печени, но они обнаруже Поэтому оксигеназы также получили название ны также в почках, селезёнке, жабрах, коже, пи «оксидазы смешанных функций». Универсальной щеварительном тракте, коре надпочечников, оксидазой, обнаруженной у представителей жи- сердце, гонадах, обонятельной системе, мозге, вотного, растительного и бактериального миров, красной мускулатуре (Di Giulio et al., 1995;

является цитохром Р450 (Арчаков, 1983). К насто- Sarasquete, Segner, 2000).

ящему времени выделено множество его форм Ксенобиотики вызывают индукцию фермен (Kadlubar, Kadlubar, 2010). Известно, что Р450-со- тов-трансформаторов, активируя транскрипцию держащие ферментные системы обладают выра- генов. Обычно ксенобиотик считают индукто женной субстратной специфичностью, хотя неко- ром, если он активирует ядерный рецептор, тем торые из них трансформируют относительно ши- самым вызывая увеличение экспрессии генов рокий спектр субстратов (Katagi, 2010). мишеней этого рецептора. В неактивированном состоянии арил-углеводородный рецептор (AhR) (3,3,4,4,5-пентахлоробифенил), ПХБ находится в цитоплазме, в комплексе с димером (3,3,4,4,5,5-гексахлоробифенил). Полибромиро БТШ 90, кошапероном р23, иммунофилин-по- ванные бифенилы (ПББ) являются структурными добным белком, называемым белком, взаимодей- гомологами ПХБ и представлены тем же числом ствующим с AhR (AIP, известный также как конгенеров. Этот класс соединений исследован ARA9 или XAP2). Во время активации этого значительно меньше в контексте индукции комплекса лигандом Ah-рецептор отделяется и CYP1A. То же самое можно сказать и о полихло перемещается к ядру, где образует гетеромер с рированных терфенилах. Хорошо изученными AhR-ядерным переносчиком (ARNT). AhR- индукторами ЭРОД-активности являются поли ARNT гетеродимеры связываются с ДНК-после- ароматические углеводороды. Несмотря на то, довательностями в 5-регуляторных областях ге- что существуют естественные источники поступ нов-мишеней и взаимодействуют с различными ления ПАУ в среду, загрязнение водных экоси коактиваторами, корепрессорами, и (или) основ- стем происходит в основном по вине человека.


ными факторами транскрипции, определяя таким Индукция ЭРОД химическими соединениями образом скорость транскрипции генов. Последо- этого класса характеризуется очень сильными вательности ДНК, которые связываются с AhR- межвидовыми различиями. AhR-лигандами явля ARNT, называют элементами, способными реа- ются и хлорорганические пестициды. Рыбы, от гировать с ксенобиотиками (xenobiotic-responsive ловленные в водоёмах, имеющих связь с сельско elements, XRE) (Ripp, 2008). хозяйственными землями, демонстрируют повы Немало усилий было затрачено для опреде- шенные уровни ЭРОД. Такой класс загрязните ления потенциальных индукторов CYP1A. В ча- лей как тяжёлые металлы не обладает характери стности QSAR-модели (quantitative structure- стиками потенциальных индукторов CYP1A, од activity relationship models), или модели количе- нако установлено, что некоторые металлы могут ственного отношения «структуры – активно- изменять степень активности ЭРОД, индуциро сти», основанные на понимании того, что хими- ванной AhR-лигандами. Кадмий может повы ческая структура соединения коррелирует с оп- шать активность, индуцированную ПАУ, а медь ределённым процессом, таким как биологичес- – понижать. Биотоксины, такие как бревитоксин, кая активность (или химическая активность), а имеют некоторую способность вызывать индук также анализы конкурентного связывания цию CYP1A-ферментных систем у рыб.

(competitive binding assays) с использованием Pytochodiscus brevis, относящийся к динофлаге меченых лигандов. В результате этих исследо- лятам, продуцирует этот липофильный нейроток ваний, например, были установлены молекуляр- син в больших количествах во время «цветения»

ные размеры потенциальных лигандов: 12 (Whyte et al., 2000).

14 5 (Whyte et al., 2000). Одним из основных достоинств ЭРОД-анали Индукторами CYP1A являются несколько за в целях биомониторинга является его способ классов химических соединений. Полихлориро- ность указывать на воздействие многокомпо ванные дибензо-п-диоксины (ПХДД) и полихло- нентных химических смесей, как, например, рированные дибензофураны (ПХДФ) – планар- стоки целлюлозно-бумажного производства.

ные хлорированные углеводороды, которые ши- Индуцированная ЭРОД-активность отловлен роко распространены в окружающей среде. Эти ной «в природе» рыбы может быть использова два класса представлены 75 и 135 конгенерами, на для индикации присутствия AhR-лигандов, соответственно. Наиболее хорошо изученный в что позволит исключить дорогостоящие анали этой группе 2,3,7,8-ТХДД – одно из наиболее то- зы тканей, воды и донных отложений. Понима ксичных соединений, когда-либо произведённых ние существующих ограничений используемого человеком, и наиболее сильный индуктор. Ещё в мониторинге инструмента даст возможность одна группа хлорированных углеводородов, вы- надлежащим образом трактовать результаты зывающая индукцию CYP1A – это полихлориро- (Whyte et al., 2000).

ванные бифенилы (ПХБ), представленные 209 Многие индукторы могут быть и ингибито конгенерами. Снятые с производства во многих рами CYP1A-индукции (при очень высоких кон странах, они и по сей день циркулируют в при- центрациях). В случаях, когда есть подозрение родной среде благодаря своей устойчивости и на ингибирование ЭРОД-активности уместно способности к биоаккумуляции. Сильными инду- использовать в качестве метода оценки воздей кторами среди конгенеров являются ПХБ 77 ствия контаминантов измерение CYP1A-белка (3,3,4,4-тетрахлоробифенил), ПХБ 126 или м-РНК (Sarasquete, Segner, 2000) акции. В основе анализа ферментативной актив В целом, к преимуществам ЭРОД-анализа от ности лежит реакция диэтилирования 7-этокси носят то, что он служит своеобразным «детекто резоруфина. В качестве кофактора используется ром» присутствия AhR-активирующих соедине НАДФ восстановленный. Продукт реакции, ре ний. В результате «быстрого» метаболизма мно гих полиароматических и некоторых полигало- зоруфин, является флуоресцентным и имеет ма генированных углеводородов методы аналити- ксимумы возбуждения и испускания при длинах ческой химии не в состоянии выявить эти со- волн 530 и 580 нм, соответственно (Burke, единения в тканях рыб, тогда как ЭРОД-актив- Mayer, 1974;

Whyte et al., 2000). ЭРОД-актив ность обеспечивает чёткое свидетельство при- ность измеряется как количество резоруфина, сутствия планарных контаминантов в организ- приходящегося на мг белка в образце микросо ме. Уровень индукции ЭРОД может служить ос- мальной фракции печени рыбы в минуту време нованием для определения биологического по- ни реакции (моль/мг/мин) (Pohl, Fouts, 1980).

тенциала ксенобиотика, быть индикатором био- Прежде чем делать выводы о качестве среды химических и физиологических изменений. на основании данных ЭРОД-анализа и исполь ЭРОД-активность отражает и кумулятивное воз- зовать активность фермента в целях биомонито действие AhR-агонистов, безотносительно к то- ринга, необходимо установить, в каких преде му приводят они к токсическому процессу, или лах она изменяется у массовых видов рыб и от нет (Whyte et al., 2000). каких факторов зависит в нормальных условиях.

Индуцированная ЭРОД-активность может Для решения этой проблемы необходимы ла многократно возрастать по сравнению с базо- бораторные исследования, направленные на вым уровнем. В целях сравнения результатов оценку конститутивной (базовой) активности исследований сложилась условная градация фермента, а также уровней его индукции ксено ЭРОД-индукции на «слабую» (ЭРОД-актив- биотиками. Например, было показано (Frlin, ность возрастает до 10 раз по сравнению с конт- Celander, 1993), что у окуня при базовой ЭРОД ролем), «умеренную» (от десяти- до стократно- активности 440 пмоль/мг/мин внутрибрюшные го повышения уровней ЭРОД) и «сильную» (ак- инъекции в дозе 500 мг/кг Clophen 50 (ПХБ) и тивность фермента увеличивается более чем в мг/кг -нафтофлавона (ПАУ) вызвали индукцию 100 раз) (Whyte et al., 2000). до уровня 1100 пмоль/мг/мин и Говоря об определении ЭРОД-активности у пмоль/мг/мин, соответственно. У щуки после рыб, важно подчеркнуть, что этот показатель инъекции -нафтофлавона в такой же дозе уро является очень нестабильным и чувствительным вень ЭРОД возрос с 480 пмоль/мг/мин до к манипуляционным процедурам. Существует пмоль/мг/мин. Абсолютные показатели ЭРОД ряд приёмов для минимизации потерь активно- активности, без сомнения, в некоторой степени сти фермента. Важно быстро обрабатывать пой- будут отличаться от исследования к исследова манную рыбу, так как стресс запускает выброс нию. Основными факторами, определяющими глюкокортикоидов (например, кортизола), что флуктуацию ЭРОД-активности, являются репро повышает уровни ЭРОД (Devaux et al., 1992). дуктивная стадия особи (Stegeman, Hahn, 1994), а Печень от живой рыбы следует помещать в также сезонные изменения температуры воды и жидкий азот (–196 °С) для хранения проб до мо- доступность пищи. Замечено, что поступление мента анализа. Приготовление гомогената ткани индукторов в организм рыб зависит от темпера необходимо осуществлять в ледяном буфере и туры и характеризуется следующими особенно на льду. Далее процедура представляет из себя стями: в большей степени ксенобиотики аккуму получение постмитохондриального супернатан- лируются при высокой температуре воды и в та (гомогенат центрифугируют при 9000–13500 меньшей степени выводятся из организма при g от 20 до 25 минут), а затем – выделение мик- низкой температуре (Collier et al., 1978).

росомального осадка (супернатант центрифуги- Ключевым аспектом в выборе вида для мо руют при 100000–200000 g от 50 до 60 минут). ниторинговых исследований является не сама Полученный микросомальный осадок ресуспен- по себе индуцированная ЭРОД-активность, а в дируют в буфере. Таким образом, проведения большей степени – устойчивая конститутивная ЭРОД-анализа подразумевает наличие следую- ЭРОД-активность и значительная амплитуда ме щего лабораторного оборудования: гомогениза- жду конститутивной и индуцированной ЭРОД тор, центрифуга и ультрацентрифуга – для полу- активностью, что позволяет однозначно интер чения микросомальной фракции, спектрофлуо- претировать результаты (Flamarion, Garric, риметр – для измерения конечного продукта ре- 1997).

Литература Арчаков А. И. Оксигеназы биологических мембран. Norrgren L., Andersson T., Bjrk M. Liver morphology М.: Наука, 1983. 56 с. and cytochrome P450 activity in fry of rainbow trout after Bock K. W., Lipp H. P., Bock-Hennig B. S. Induction microinjection of lipid-soluble xenobiotics in the yolk-sac of drug-metabolising enzymes by xenobiotics // embryos // Aquatic Toxicology. 1993. Vol. 26. P. 307–316.

Xenobiotica. 1990. Vol. 20. No 11. P. 1101–1111. Pohl R.J., Fouts J.R. A rapid method for assaying the Burke M.D., Mayer R.T. Ethoxyresorufin: direct metabolism of 7-ethoxyresorufin by microsomal subcellular fluorimetric assay of a microsomal O-dealkylation fractions // Analytical Biochemistry. 1980. Vol. 107. P.

which is preferentially inducible by 3-methylcholanthrene 150–155.

// Drug Metabolism and Disposition. 1974. Vol. 2. P. 583– Ripp S. L. Induction of Drug-Metabolizing Enzymes:

588. Contrasting Roles in Detoxification and Bioactivation of Collier T.K., Thomas L.C., Malins D.C. Influence of Drugs and Xenobiotics // Elfarra A. A. (ed.) Advances in environmental temperature or disposition of dietary Bioactivation Research. 2008. P. 69–102.

naphthalene in coho salmon (Oncorhynchus kitsutch): Sarasquete C., Segner H. Cytochrome P4501A isolation and identification of individual metabolites // (CYP1A) in teleostean fishes. A review of Comp. Biochem. Physiol. 1978. Vol. 61. P. 23–28. immunohistochemical studies // The Science of the Total Devaux A., Pesonen M., Monod G., Andersson T. Environment. 2000. Vol. 247. No 2–3. P. 313–332.

Glucocorticoid-mediated potentiation of P450 induction in Smolowitz R. M., Hahn M. E., Stegeman J. J.

primary culture of rainbow trout hepatocytes // Biochemistry Immunohistochemical localization of cytochrome P-450IA and Pharmacology. 1992. Vol. 43. P. 898–901. induced by 3,3',4,4'-tetrachlorobiphenyl and by 2,3,7,8 Di Giulio R.T., Benson W.H., Sanders B.M., Van Veld tetrachlorodibenzoafuran in liver and extrahepatic tissues of P.A. Biochemical mechanisms: metabolism, adaptation, and the teleost Stenotomus chrysops (scup) // Drug Metabolism toxicity // Rand G.M. (ed.) Fundamentals of aquatic and Disposition. 1991. Vol. 19. No 1. P. 113–123.

toxicology. Effects, environmental fate, and risk Stegeman J. J., Smolowitz R. M., Hahn M. E.

assessment. Washington: Taylor & Francis, 1995. Ch. 17. Immunohistochemical localization of environmentally P. 523–561. induced cytochrome P450IA1 in multiple organs of the Flammarion P., Garric J. Cyprinids EROD activities in marine teleost Stenotomus chrysops (Scup) // Toxicology and low contaminated rivers: a relevant statistical approach to Applied Pharmacology. 1991. Vol. 110. No 3. P. 486–504.

estimate reference levels for EROD biomarker? // Stegeman J.J., Hahn M.E. Biochemistry and molecular Chemosphere. 1997. Vol. 35. No. 10. P. 2375–2388. biology of monooxygenases: current perspectives on forms, Frlin L., Celander M. Induction of cytochrome functions, and regulation of cytochrome P450 in aquatic P4501A in teleosts: environmental monitoring in Sweden species // Malins D.C. and Ostrander G.K. (eds.). Aquatic fresh, brackish and marine waters // Aquatic Toxicology. Toxicology: Molecular, Biochemical and Cellular 1993. Vol. 26. P. 41–56. Perspectives. Boca Raton: Lewis Publishers, 1994. P. 87–206.

Kadlubar S., Kadlubar F. F. Enzymatic Basis of Phase I Whyte J.J., Jung R.E., Schmitt C.J., Tillitt D.E.

and Phase II Drug Metabolism // Pang K. S. et al. (eds.) Ethoxyresorufin-O-deethylase (EROD) Activity in Fish as a Enzyme- and Transporter-Based Drug-Drug Interactions. Biomarker of Chemical Exposure // Critical Reviews in 2010. P. 3–25. Toxicology. 2000. Vol. 30. Is. 4. P. 347–570.

Katagi T. Bioconcentration, Bioaccumulation, and Williams D.E., Lech J.J., Buhler D.R. Xenobiotics and Metabolizm of Pesticides of Aquatic Organisms // Reviews xenoestrogens in fish: modulation of cytochrome P450 and of Environmental Contamination and Toxicology. 2010. carcinogenesis // Mutation Research. 1998. Vol. 399. P.

Vol. 204. P. 1–132. 179–192.

ETHOXYRESORUFIN-O-DEETHYLASE (EROD) ACTIVITY IN FISH AS A BIOMARKER OF WATER POLLUTION WITH PERSISTENT ORGANIC CONTAMINANTS V.V. Yurchenko, G.M. Chuiko Papanin Institute of Biology of Inland Waters, Russian Academy of Science, Borok, Yaroslavl region, RussiaIBIW RAS, Borok, Russia, viksapiksa@mail.ru environmental pollution. EROD activity approach CYP1A-dependent monooxygenases are known is based on the measurement of ethoxyresorufin to be metabolizing enzymes of many xenobiotics, deethylation product, resorufin, in liver microsomal such as PCDDs, PCDFs, PCBs, PAHs and fraction.

structurally related compounds. EROD activity in fish being an indicator of CYP1A-induction is a well-established in vivo biomarker for Научное издание СОВРЕМЕННЫЕ ПРОБЛЕМЫ ФИЗИОЛОГИИ И БИОХИМИИ ВОДНЫХ ОРГАНИЗМОВ ТОМ I ЭКОЛОГИЧЕСКАЯ ФИЗИОЛОГИЯ И БИОХИМИЯ ВОДНЫХ ОРГАНИЗМОВ сборник научных статей Печатается по решению Ученого совета Учреждения Российской академии наук Института биологии Карельского научного центра РАН Сдано в печать 01.12.2010. Формат 60х841/8. Гарнитура Times.

Печать офсетная. Уч.-изд. л. 33,5. Усл. печ. л. 37,2.

Тираж 150 экз. Изд. № 153. Заказ № 917.

Карельский научный центр РАН Редакционно-издательский отдел Петрозаводск, пр. А. Невского,

Pages:     | 1 |   ...   | 12 | 13 ||
 





 
© 2013 www.libed.ru - «Бесплатная библиотека научно-практических конференций»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.