авторефераты диссертаций БЕСПЛАТНАЯ БИБЛИОТЕКА РОССИИ

КОНФЕРЕНЦИИ, КНИГИ, ПОСОБИЯ, НАУЧНЫЕ ИЗДАНИЯ

<< ГЛАВНАЯ
АГРОИНЖЕНЕРИЯ
АСТРОНОМИЯ
БЕЗОПАСНОСТЬ
БИОЛОГИЯ
ЗЕМЛЯ
ИНФОРМАТИКА
ИСКУССТВОВЕДЕНИЕ
ИСТОРИЯ
КУЛЬТУРОЛОГИЯ
МАШИНОСТРОЕНИЕ
МЕДИЦИНА
МЕТАЛЛУРГИЯ
МЕХАНИКА
ПЕДАГОГИКА
ПОЛИТИКА
ПРИБОРОСТРОЕНИЕ
ПРОДОВОЛЬСТВИЕ
ПСИХОЛОГИЯ
РАДИОТЕХНИКА
СЕЛЬСКОЕ ХОЗЯЙСТВО
СОЦИОЛОГИЯ
СТРОИТЕЛЬСТВО
ТЕХНИЧЕСКИЕ НАУКИ
ТРАНСПОРТ
ФАРМАЦЕВТИКА
ФИЗИКА
ФИЗИОЛОГИЯ
ФИЛОЛОГИЯ
ФИЛОСОФИЯ
ХИМИЯ
ЭКОНОМИКА
ЭЛЕКТРОТЕХНИКА
ЭНЕРГЕТИКА
ЮРИСПРУДЕНЦИЯ
ЯЗЫКОЗНАНИЕ
РАЗНОЕ
КОНТАКТЫ


Pages:     | 1 || 3 |

«ФЕДЕРАЛЬНОЕ БЮДЖЕТНОЕ УЧРЕЖДЕНИЕ НАУКИ ИНСТИТУТ МОЛЕКУЛЯРНОЙ И КЛЕТОЧНОЙ БИОЛОГИИ СИБИРСКОГО ОТДЕЛЕНИЯ РАН на правах ...»

-- [ Страница 2 ] --

Изучение полиморфизма популяций и межвидовых отличий проводилось путем анализа последовательностей мтДНК (Avise et al., 1987). Одним из наиболее вариабельных некодирующих районов мтДНК является контрольный район (CR – control region) (Moritz et al., 1987). В результате оценки частот замен нуклеотидов в кодирующем регионе мтДНК было сделано предположение, что сибирская и европейская косуля разделились на границе плиоцена/плейстоцена и независимо эволюционируют последние 2-3 млн. лет. В результате секвенирования контрольного района 45 особей сибирской и европейской косули было найдено более 50 замен, на основе которых выделили около 20 различных гаплотипов. Шесть различных гаплотипов было обнаружено среди сибирской косули и гаплотипов среди европейской косули. Гаплотипы кластеризуются в две группы внутри каждого вида. Эти кластеры соответствуют различным географическим популяциям. На основании этого было выделено две популяции сибирской косули в Курганской и в Амурской области. Также для европейской косули выделена популяция на западе Альп и восточноальпийская популяция, в состав которой входит С. с. italicus (Randi et al., 1998a). Однако недавно были получены новые данные, описывающие полиморфизмы внутри популяций сибирской косули. Основываясь на географическом распределении четырех подвидов сибирской косули, авторы гаплотипировали образцы животных, отловленных на Алтае, в Якутии, в горах Тянь-Шаня и Дальнем Востоке России. Было выделено гаплотипов сибирской косули, среди них 5 – в алтайской популяции, 4 – в якутской популяции, 7 гаплотипов в тянь-шанской популяции и 3 – в популяции Дальнего Востока России. Авторы, использовав филогенетический анализ, не выявили гаплогрупп, связанных с определенными подвидами. На основании этого было сделано заключение, что деление на подвиды у сибирской косули не имеет оснований и показано, что данный вид отличается высокой мобильностью и вследствие этого генетической вариабельностью (Vorobieva et al., 2011). Таким образом, последние данные в отличие от полученных ранее, выявили, что сибирская косуля характеризуется значительным генетическим разнообразием, и попытки деления этого вида на подвиды являются весьма условным.

1.4.1 Филогенетические связи семейства Cervidae Для выяснения филогенетических связей рода Capreolus было проведено сравнение полных последовательностей митохондриального гена цитохрома b у 11 видов, принадлежащих к подсемействам: настоящие олени - Cervinae (благородный олень (Cervus elaphus), пятнистый олень (C.

nippon), европейская лань (Dama dama)), мунтжаковые - Muntiacinae (китайский мунтжак (Muntiacus косули reevesi)), - Capreolinae (чернохвостый олень (Odocoileus hemionus), род Мазама (Mazama sp.), европейская косуля (Capreolus capreolus), сибирская косуля (C. pygargus), северный олень (Rangifer tarandus), лось (Alces alces)) и водяные олени Hydropotinae (водяной олень (Hydropotes inermis)). По имеющимся данным подсемейство настоящие олени и род Muntiacus были объединены в группу евразийских видов. Вторую группу составили Capreolus, Hydropotes и Alces.

Mazama, Odocoileus и Rangifer представляют третью группу (Randi et al., 1998b) (схема 1).

Схема 1. Филогения оленьих на основании сравнения полных последовательностей митохондриального гена цитохрома b (Randi et al., 1998b).

На сегодняшний день существуют и другие модели филогенетических связей внутри семейства оленьих. В 2004 году Питра с соавторами предложили схему филогенетических связей, а также определили время возникновения и расхождения группы оленьих Старого Света (Pitra et al., 2004). Исследователи проводили построения на основании сравнения полных последовательностей митохондриального гена цитохрома b.

Хронограмма оленьих была сконструированна на основе датированных ископаемых и филогенетичких отношений внутри семейства оленьих. В исследовании было задействовано 49 таксонов из семейства оленьих.

Авторы построили неукорененное филогенетическое дерево, на основании этого построения была выделена группа видов, называемая telemetacarpalian, в которую входили подсемейства: американские олени, косули, водяные олени и лоси. В другую группу видов, называемую plesiometacarpalian, входили подсемейство мунтжаковые, выделенные в подгруппу IV и подсемейство настоящие олени, выделенные в подгруппу III (схема. 2).

На основании предложенной филогении подсемейство мунтжаковые представляет собой сестринскую группу оленей, входящих в подсемейства настоящие олени и американские олени. Характеризуя подсемейство настоящие олени, мы наблюдаем разделение между аксисом (Axis axis), барасингой (Rucervus duvaucelii), оленем шомбургка (Rucervus schomburgki), с одной стороны, и остальными Cervinae, с другой стороны.

Схема 2. Филогения оленьих на основании сравнения полных последовательностей митохондриального гена цитохрома b (Pitra et al., 2004). I – таксон telemetacarpalian. II – таксон plesiometacarpalian. III – группа оленьих Старого Света. IV – сестринская группа оленьих Старого Света – мунтжаковые.

Внутри этой группы барасинга и олень шомбургка являются сестринскими видами, тогда как близкородственные взаимоотношения между аксисом и свиным оленем (Axis porcinus) не подтверждаются, указывая на то, что род аксис является парафилетическим. Характеристика рода лани (Dama), представленного в этом исследовании двумя видами, европейской ланью (Dama dama) и иранской ланью (Dama mesopotamica), указывает на то, что эти два вида являются сестринскими. Неожиданным было обнаружение близких филогенетических связей между оленем давида (Elaphurus davidianus) и оленем-лира или таменгом (Cervus eldii).

Следующую обширную группу составляет подсемейство настоящие олени Cervus, содержащее роды: Rusa, Sika и Przewalskium. В группе Rusa были обнаружены неожиданно близкие филогенетические взаимоотношения между свиным оленем и гривистым замбаром (Rusa timorensis). Индийский замбар (Rusa unicolor) оказался сестринским видом свиного оленя и гривистого замбара.

Вид благородный олень (Cervus elaphus) делится на четыре отдельных подвида. Первая группа включает четыре европейских подвида (C. e.

hippelaphus, C. e. corsicanus, C. e. atlanticus, C. e. hispnicus), один подвид из северной Африки (C. e. barbarus) и один подвид, обитающий на Кавказе, в Турции и северном Иране (C. e. maral). Вторая группа включает два подвида из средней Азии (C. e. bactrianus и C. e. yarkandensis). Третья группа включает два подвида из Сибири (C. e. songaricus и C. e. sibiricus) и один подвид из северной Америки (C. e. canadensis). Четвертая группа включает четыре подвида, населяющих Китай и Тибет (C. e. wallichi, C. e.

macneilli, C. e. kansuensis, C. e. xanthopygus). Последние две группы формируют клад подвидов вида пятнистый олень (Cervus nippon). Вид беломордый олень (Przewalskium albirostris) представляет собой часть группы подвидов вида Cervus nippon.

Отдельная группа семейства оленьих, называемая telemetacarpalian, делится на пять подсемейств: американские олени, лоси, косули и водяные олени. Вид водный олень (Hydropotes inermis) составляет одну группу с подсемейством Capreolinae. Отдельно выделяется подсемейства Alcinae и Odocoileinae. Однако нужно отметить, что вид северный олень (Rangifer tarandus) в данной филогении занимает неопределенную позицию, поэтому построение филогенетического дерева оленьих должно быть основано на большем числе молекулярных данных (схема 2).

Для того чтобы оценить точное время расхождения видов семейства оленьих на основе датированных ископаемых и имеющегося филогенетического дерева семейства оленьих, была создана хронограмма.

Ключевыми точками в этой хронограмме являются узел А (схема 3), соответствующий разделению подсемейств мунтжаковые и настоящие олени (7 млн. лет до н.э.) и узел В, соответствующий возникновению подсемейства американские олени (5 млн. лет до н.э.).

Наиболее примитивным предком подсемейства настоящие олени Cervinae считается Cervocervus novorossiae, ископаемые отстанки которого датируют поздним миоценом (Stefano, Petronio, 2002) (на схеме обозначено цифрой 1). Азиатский род Procapreolus является предковым для рода Capreolus и датируется поздним миоценом - ранним плиоценом (2), однако не ясно, является ли он предковым также и для Hydropotes. Вид Axis shansius, датированный примерно 5 млн. лет до н.э., является наиболее ранним предполагаемым предком вида Axis axis (Stefano, Petronio, 2002) (3).

Вид Cervus magnus, датированный ранним плиоценом, является предковым подсемейству настоящие олени (Stefano, Petronio, 2002) (4). Вид Rusa elegans является предковым виду индийский замбар (Stefano, Petronio, 2002) (5). Наиболее поздней находкой из среднего плиоцена по сравнению с видом Axis shansius является вид Axis lyra, также являющийся предковым современному аксису (Stefano, Petronio, 2002) (6). Ископаемый вид Rucervus датируемый поздним плиоценом, является предковым hilzheimeri, современному виду Przewalskium albirostris (Stefano, Petronio, 2002) (7).

Также был обнаружен ископаемый вид, датируемый поздним плиоценом, который является предковым современному виду Elaphurus davidianus (Taru, Hasegawa, 2002) (8). Ископаемые останки пятнистого оленя были впервые найдены в позднеплиоценовых отложениях Европы (Geist et al., 1998) (9). Ископаемый вид Axis lydekkeri, обнаруженный в отложениях на острове Ява, датируемый 1,5 млн. лет до н.э., может быть предковым виду аксис Axis axis (Stefano, Petronio, 2002) (10), однако, эти данные не нашли подтверждение в работе Питры с соавторами (Pitra et al., 2004). Ископаемый вид Cervus grayi является наиболее поздним общим предком видов Cervus elaphus и Cervus nippon (Stefano, Petronio, 2002) (11). Ископаемый вид Cervus bactrianus, живший в Европе в раннем плейстоцене, является общим предком для подвидов C. e. bactrianus и C. e. yarkandensis (Stefano, Petronio, 2002) (12). Первые ископаемые находки вида Cervus elaphus датированы 0, млн. лет до н.э. (13) (схема 3).

Схема 3. Хронограмма оленьих, сконструированная на основе датированных ископаемых и филогенетичких отношений внутри семейства оленьих. А – узел, соответствующий разделению подсемейств мунтжаковые и настоящие олени. В – узел, соответствующий возникновению подсемейства американские олени. Номера в данной схеме, отражают возраст найденных ископаемых (Pitra et al., 2004).

Построение филогенетических отношений на основе молекулярных данных и датированных ископаемых является наиболее точным и наводит на мысль о том, что некоторые современные виды семейсва Cervidae представляют собой гибридные таксоны различных видов оленьих, но это предположение требует дополнительных исследований (Pitra et al., 2004).

1.5 Хромосомная эволюция семейства оленьих (Cervidae) На основе сравнительного хромосомного бэндинга оленьих было предположено, что предок семейства Cervidae мог иметь кариотип 2n = 70, включающий 68 акроцентрических аутосом, акроцентрическую Х хромосому и небольшой субметацентрический Y (Neitzel et al., 1987). К группе видов, сохранивших предковый кариотип, относятся водяной олень (Hydropotes inermis) (Hsu et al., 1974), серый мазама (Mazama gouazoubira) (Neitzel et al., 1987), европейская косуля (С. сapreolus) (Gustavsson et al., 1968), сибирская косуля (C. pygargus) (Sokolov et al., 1978), северный олень (Rangifer tarandus) (Nes et al., 1965) и чернохвостый олень (Odocoileus hemionus) (Wurster et al., 1967).

Эволюция хромосом оленьих характеризуется неравномерными темпами в разных группах. Подсемейство мунтжаковые Muntiacinae включает виды с минимальным числом хромосом среди млекопитающих:

индийский мунтжак (Muntiacus muntjak vaginalis, 2n=6, 7) (Wurster et al., 1970), мунтжак Рузвельта (M. rooseveltorum, 2n=6) (Wurster-Hill et al., 1985) и черный мунтжак (M. crinifrons, 2n=8f, 9m) (Shi et al., 1988b). Данное явление было объяснено Янгом с соавторами. На основе проведенных детальных исследований хромосом оленьих был предложен сценарий кариотипической эволюции Cervidae. Кариотип китайского мунтжака (M.

reevesi, 2n = 46) ведет свое происхождение от предкового кариотипа семейства Cervidae. Хромосомы 1-5 и 11 китайского мунтжака образовались в результате 12 слияний 18 хромосом предкового кариотипа (Yang et al., 1997c). Также путем слияний предкового кариотипа сформировались малохромосомные кариотипы индийского мунтжака (M. muntjak vaginalis, 2n=6f, 7m) (Yang et al., 1995;

Yang et al., 1997b) и черного мунтжака (M.

crinifrons, 2n=8f, 9m) (Yang et al., 1997a).

Можно заключить, что одним из путей уменьшения числа хромосом в подсемействе Cervinae являлись тандемные слияния. Но большинство видов обладают кариотипами, произошедшими от предкового кариотипа путем робертсоновских транслокаций. Так произошли кариотипы таких видов, как аксис (Axis axis, 2n=66), пятнистый олень (Cervus nippon, 2n = 66), белогубый олень (Cervus albirostris, 2n=66), благородный олень (Cervus elaphus, 2n=62), гривистый замбар (Cervus timorensis, 2n=60) и индийский замбар (Cervus unicolor, 2n=58/56) (Huang et al., 2006).

1.6 Заключение Интерес к В-хромосомам возник еще в начале ХХ века. По мере совершенствования молекулярно-биологических подходов удалось выявить механизмы наследования данных элементов и новые черты их молекулярной организации. Буквально за последние несколько лет в связи с использованием методов секвенирования, FISH и ПЦР в реальном времени было показано, что В-хромосомы содержат целые участки аутосом, которые могут функционировать по своим определенным законам. Гены, расположенные на добавочных элементах, имеют различные функции, однако появляется все больше данных о значительном преобладании протоонкогенов на В-хромосомах. До сих пор остается загадкой, почему В хромосомы присутствуют у одних видов и отсутствуют у других даже внутри отдельного семейства. Для ответа на этот вопрос и вопросы, связанные с механизмами и временем возникновения добавочных хромосом у изучаемого вида, необходимо учитывать его филогенетические взаимосвязи и особенности хромосомной эволюции. Кроме того, знание кариотипической эволюции позволит выявить роль добавочных элементов в эволюции геномов.

Семейство Cervidae отличается огромным разнообразием видов, живущих в разных климатических зонах. История оленьих насчитывает несколько млн. лет. Замечательным является то, что кариотип многих представителей Cervidae является очень консервативным и мало отличается от предкового. Отличительной особенностью семейства оленьих, а также и всего отряда парнокопытных является наличие видов, несущих кариотипы с преобладанием акроцентрических элементов. Как уже отмечалось выше, по гипотезе Палестиса с соавторами (Palestis et al., 2004) именно в кариотипах с акроцентрическими хромосомами чаще встречаются добавочные элементы.

Сибирская косуля как раз обладает кариотипом с преобладанием акроцентрических элементов, и в согласии с приведенной выше гипотезой несет разнообразное число В-хромосом. Число добавочных элементов у сибирской косули может варьировать от 0 до 14, что делает этот вид очень привлекательным для изучения феномена В-хромосом.

2. Материалы и методы 2.1 Материалы Биотин-11-дУТФ ”Medigene” Бромистый этидий ”Sigma” Глицерин ”Serva” Декстран-сульфат ”Pharmacia” Дигоксигенин-11-дУТФ ”Medigene” Колхицин «Fluka» (сухой) Ксилол (осч) “Реахим” Ледяная уксусная кислота (ч) “Реахим” Метанол (ч) “Реахим” Набор дезоксинуклеозидтрифосфатов (дАТФ, дТТФ, дЦТФ, дГТФ) “Sigma” Раствор красителя Гимза “Merk” Рабочий раствор красителя Гимза (основной раствор красителя Гимза (2 мл);

0.1% гидрокарбоната натрия (1 мл), вода дистиллированная до 50 мл) Твин-20 “Sigma” Тритон Х100 “Serva” Формамид ”Sigma” (предоставлен Межинститутским центром BigDye v1. секвенирования ДНК СО РАН) DABCO (1,4-диазабисцикло(2,2)октан) ”Sigma” DAPI ”Sigma” SYBR Green PCR Master Mix “Синтол” Антибиотики, культуральные среды, сыворотки Гентамицин “Биохимик” Канамицин “Биохимик” Пенициллин “Биохимик” Сыворотка крупного рогатого скота “HyClone” Эмбриональная бычья сыворотка “HyClone” MEM “Gibco” DMEM “Gibco” F12 “Gibco” Буферы Блокирующий буфер (1-3% обезжиренное сухое молоко, 4xSSC, 0,05% Тритон X100) Буфер для Межинститутским центром BigDye (предоставлен секвенирования ДНК СО РАН) Буфер для Taq ДНК-полимеразы (67 мМ трис-НСl рН 9.4, 18 мМ (NH4)2SO4, 0,01% твин-20) TAE (0,04 М трис-ацетат рН 7.5;

0,002 М ЭДТА) TE буфер (0,01 М трис-HCl pH 8.0;

0,001 М ЭДТА) Фиксатор: метанол: уксусная кислота 3: PBS буфер (0,13 М NаCl;

0,27 М KCl;

7 мM Na2HPO4;

3 мМ NaH2PO4, рН 7.2) SSC буфер (0,15 М NаCl;

0,15 М цитрат натрия) Ферменты и конъюгаты Авидин-FITC “Vector” USA Антидигоксигенин-родамин ” Medigene ” Биотинилированный антиавидин “Vector” USA Нуклеаза S1 “Sigma” Пепсин “Sigma” Протеиназа К “Sigma” РНКаза А “Sigma” Трипсин ”DIFCO” Taq ДНК-полимераза, выделена в ИЦиГ СО РАН ExoSap “GE Healthcare” Библиотека В-хромосом сибирской косули Библиотека В-хромосом сибирской косули была получена с помощью хромосомного сортинга П.О’Брайен (Центр сравнительной геномики, Кембриджский университет, Великобритания) и В.А. Трифоновым (лаборатория сравнительной геномики ИМКБ СО РАН) из культуры фибробластов сибирской косули, отловленной в Новосибирской области ( В-хромосом). Амплификацию фрагментов ДНК В-хромосом ( хромосом на библиотеку) осуществляли с помощью метода DOP-ПЦР (см.

главу Методы 2.2.6).

В-хромосом-специфичная библиотека кДНК была получена В.А.

Трифоновым (ИМКБ СО РАН, Новосибирск) на основе метода SHAC (“Selection of Hybrids by Affinity Capture ” отбор гибридов афинной сорбцией) (Chen-Liu et al., 1995). Из культуры клеток фибробластов сибирской косули с 8 В-хромосомами была выделена тотальная РНК и получена кДНК библиотека с помощью BD SMART PCR cDNA Synthesis Kit (BD Biosciences) по протоколу производителя. Затем полученная кДНК библиотека была амплифицирована со специфичным праймером (BD и гибридизована с В-хромосом-специфичной Biosciences) in vitro биотинилированной библиотекой, которая была помечена с помощью метода Захват полученных гибридов производили магнитными DOP-ПЦР.

микрочастицами с иммобилизованным авидином. Фрагменты кДНК амплифицировали с помощью ПЦР со специфичным праймером (BD Biosciences). Продукты ПЦР клонировали с использованием TOPO TA Cloning Kit (Invitrogen, UK) и секвенировали по стандартному протоколу.

Полученные последовательности были выровнены относительно генома коровы UCSC genome browser on Cow Oct. 2011 (Baylor Btau_4.6.1/bosTau7).

Суспензии клеток В работе использовались следующие суспензии клеток, приготовленные из культур фибробластов в лаборатории цитогенетики животных ИМКБ СО РАН:

1. Сибирская косуля, самец (Сapreolus pygargus, СРУ, 2n=70+8B), отловлен в Шебалинском районе Алтайского края.

2. Сибирская косуля, самец (2n=70+4B), отловлен в Шебалинском районе Алтайского края.

3. Сибирская косуля, самец (2n=70+0B), отловлен в Краснозерском районе Новосибирской области.

4. Корова, (Bos taurus, ВТА, 2n=60).

ДНК животных В работе использовались образцы ДНК сибирской и европейской косули, лося и марала выделенные из тканей животных:

Европейская косуля (Capreolus capreolus, CCA, 2n=70+0B), отловлена в Англии.

Европейская косуля (2n=70+0B), отловлена в Англии.

Лось (Alces alces, AAL, 2n=68), отловлен в Горном районе республики Якутия.

Марал алтайский (Cervus elaphus sibiricus, CEL, 2n=68), отловлен в Алтайском крае.

В работе использовались образцы ДНК сибирской косули, коровы и мазама, выделенные из культуры фибробластов:

Серый мазама (самец) (Mazama gouazoubira, MGO, 2n=70). Суспензия хромосом была любезно предоставлена профессором Янгом.

Сибирская косуля (2n=70+8B), отловлена в Шебалинском районе Алтайского края.

Сибирская косуля (2n=70+4B), отловлена в Шебалинском районе Алтайского края.

Сибирская косуля (2n=70+0B), отловлена в Краснозерском районе Новосибирской области.

Корова (2n=60), город Новосибирск.

Праймеры Праймеры, использованные для амплификации ДНК ВАС клонов, синтезированы фирмой “Биоссет” (Новосибирск).

DOP1-праймер (5’-CCGACTCGAGNNNNNNCTAGAA-3’) DOP2-праймер (5’-CCGACTCGAGNNNNNNTAGGAG-3’) DOP3-праймер (5’-CCGACTCGAGNNNNNNTTCTAG-3’) DOP4-праймер (5’-GGAAACAGCCCGACTCGAG-3’) Праймеры, использованные в ПЦР для картирования последовательностей на В-хромосомах в количестве 40 пар для геномной ДНК, приведены в главе 3.2.2 (Таблица 5). Cинтезированы фирмой “Биоссет” (Новосибирск).

Праймеры, использованные для секвенирования продуктов ПЦР в количестве 9 пар, приведены в главе 3.5 (Таблица 8). Синтезированы В.А.

Рябининым ИХБФМ СО РАН. Праймеры, использованные для ПЦР в реальном времени в количестве 4 пар, приведены в главе 3.3 (Таблица 6).

Синтезированы В.А. Рябининым ИХБФМ СО РАН.

ВАС клоны Клоны BAC библиотеки коровы CHORI-240 (8 штук) любезно предоставлены д-ром Д.М. Ларкиным (Университет Иллинойса, США);

список приведен в главе 3.2.1 (Таблица 4).

2.2. Методы 2.2.1 Культивирование культур клеток фибробластов и получение суспензии хромосом Культуры фибробластов косули были взяты из банка клеточных культур лаборатории цитогенетики животных ИМКБ СО РАН.

Культивирование клеток проводили при 37С на средах F12, DMEM и MEM с добавлением 10% сыворотки и антибиотиков: пеницилина ( мкг/мл) и канамицина (100 мкг/мл). Среду меняли 2-3 раза в неделю. Как только образовывались равномерные и плотные колонии, клетки снимали с помощью 0,25%-ного раствора трипсина с ЭДТА (0,3 г/л) и переносили в новую емкость, таким образом, осуществляя пересевание культуры фибробластов. Фиксацию культуры клеток фибробластов проводили следующим образом: через 24 часа после последнего пересева в культуральную среду добавляли бромистый этидий до конечной концентрации 0,025 мг/мл на 2 часа. Затем вводили колхицин в концентрации 0,05 мг/мл на 45 мин. Потом среду сливали и добавляли теплый (37С) 0,25%-ный раствор трипсина с ЭДТА в количестве, достаточном для снятия клеток. Для остановки действия трипсина во флакон добавляли 3-4 мл ростовой среды. Клетки переносили в центрифужную пробирку и проводили центрифугирование в течение минут со скоростью 1000 оборотов/мин. Затем к осадку клеток добавляли свежий гипотонический 3,7*10-4 М раствор KCl, содержащий 2-3% эмбриональной бычьей сыворотки, и осадок клеток суспендировали.

Пробирки помещали в термостат и выдерживали при 37С в течение 45- мин. Стадия предфиксации после гипотонической обработки проводилась следующим образом: несколько капель метанол-уксусного фиксатора (3:1) добавляли к гипотоническому раствору с клетками. Раствор перемешивали и оставляли на 5-10 мин. Затем центрифугировали и снова добавляли свежеприготовленный охлажденный (при метанол-уксусный -20С) фиксатор (3:1). Раствор с клетками тщательно суспендировали и фиксировали при -20С в течение 20 мин. Затем проводили конечное центрифугирование и замену фиксатора. После чего раствор оставляли на 12 часов при -20С. Потом еще раз меняли фиксатор и оценивали качество полученного материала.

2.2.2 Приготовление препаратов метафазных хромосом Для приготовления препаратов метафазных хромосом исследуемых видов использовали чистые предметные стекла размером 76х26х1мм. Для обезжиривания стекла выдерживали в хромовой смеси около 30 мин., затем тщательно ополаскивали водопроводной и дистиллированной водой и использовали для приготовления препаратов. Далее на холодные влажные стекла наносили необходимое количество суспензии хромосом, промывали метанол-уксусным фиксатором (3:1) и помещали в пары водяной бани (65°С) до высыхания фиксатора.

Качество препаратов контролировали с помощью фазово контрастного микроскопа. Препараты прогревали в течение одного часа при температуре 65°С.

2.2.3 GTG-бэндинг Дифференциальное окрашивание проводили с помощью раствора трипсина и красителя Гимза. Препарат обрабатывался 0,12 % раствором трипсина от 1 мин. 30 сек. до 2 мин., в зависимости от температуры окружающей среды. Чтобы остановить действие трипсина препарат ополаскивали в 2xSSC и затем окрашивали красителем Гимза в течение 2- мин. После окрашивания препарат ополаскивали в дистиллированной воде и высушивали. Качество окраски метафазных хромосом контролировали под микроскопом и фотографировали подходящие метафазные пластинки с помощью CCD камеры и специального программного обеспечения.

2.2.4 Флуоресцентная in situ гибридизация 2.2.4.1 Гибридизация Гибридизационная смесь содержала: около 0,1 мкг/мкл зонда, 40% формамида, 10% декстрансульфата, 2xSSC. Денатурация проб проводилась при 75°C в течение 10 мин. Предгибридизация проб с Сot10 ДНК косули осуществлялась в смеси для гибридизации при 37°C в течение 30 мин.

Непосредственно перед гибридизацией фиксированные препараты денатурировали в растворе, содержащем 70%-ый формамид и 2xSSC.

Денатурацию препаратов проводили при 69-72°C в интервале от 1 мин. сек. до 2 мин. 15 сек. (время и температуру денатурации подбирали для каждой суспензии хромосом). Вслед за этим препараты проводили через серию охлажденных (-20°C) растворов этанола возрастающей концентрации (70%, 80% и 96%). Гибридизационную смесь наносили на препарат под покровное стекло размером 24х24мм в количестве 18 мкл. Затем стекло заклеивали резиновым клеем. Препараты с гибридизационной смесью инкубировали в термостате при 37°C во влажной камере в течение 18- часов.

2.2.4.2 Постгибридизационные отмывки, детекция и усиление сигнала После гибридизации препараты отмывали при 46°C 3 раза по 3 мин. в растворе, содержащем 50% формамид, 2xSSC;

3 мин. в 2xSSC и дважды по 3 мин. в 0,2xSSC. Препараты помещали в блокирующий буфер (1-3% обезжиренное сухое молоко, 4xSSC, 0,05% Тритон X100) на 15 мин. при 37°C. Детекция меченного биотином зонда осуществлялась с помощью растворов: авидина-FITC (0,0025 мг/мл), биотинилированного анти-авидина FITC (0,0025 мг/мл) и снова авидина-FITC (0,0025 мг/мл) в блокирующем буфере. Препараты с нанесенным коньюгатом инкубировали во влажной камере при 37°C в течение 30 мин. После инкубации отмывали в растворе 4xSSC, 0,05% Тритон X100 3 раза по 4 мин., при 46°C. После последней отмывки препараты ополаскивали дистиллированной водой и высушивали.

Препараты покрывали раствором DABCO (0,233 г DABCO в 10 мл раствора, содержащего 9 частей глицерина и 1 часть 1М трис-HCl pH 8.0) с DAPI (0,08 мкг/мл). Анализ препаратов осуществлялся с помощью флуоресцентного микроскопа "Axiscope 2 Plus" (Zeiss). Обработка рисунков была проведена с помощью графического редактора Adobe Photoshop CS2.

2.2.5 Полимеразная цепная реакция Подбор праймеров и температур отжига осуществлялся с помощью программы “OLIGO”. Данная программа считает теоретическую температуру плавления праймеров при заданной концентрации соли в реакционной смеси. На основе полученных теоретических данных нами экспериментально подбирались температуры отжига праймеров.

ПЦР проводили в 20 мкл смеси следующего состава: 10 мМ Трис-HCl (pH 9), 50 мМ KCl, 0,1% Тритон Х100 (или 67 мМ трис-НСl рН 9.4, 18 мМ (NH4)2SO4, 0,01% твин-20), 1 мкМ каждого праймера, по 250 мкМ каждого из дНТФ, 3мМ MgCl2, 10нг ДНК, 0.025-0.1 ед/мкл Taq ДНК-полимеразы.

ПЦР осуществлялась по следующей схеме:

1. 94С 2 мин.

2. 94С 15 сек.

3. ХС 30 сек.

4. 72С 30 сек.

Шаги 2-4 повторяли 30-35 раз, ХС – температура отжига, подобранная для каждой пары праймеров. Контроль размера продукта осуществлялся с помощью электрофореза в 1% агарозном геле.

Биотинилированные зонды, использующиеся при флюоресцентной in situ гибридизации, получали при помощи ПЦР по аналогичной схеме за исключением состава дНТФ (по 250 мкМ каждого из дАТФ, дГТФ, дЦТФ, 0,1 мМ дТТФ, 0,05 мM биотин-11-дУТФ).

2.2.6 DOP-ПЦР DOP-ПЦР проводили в 20 мкл смеси следующего состава: 10 мМ Трис-HCl (pH 9.0), 50 мМ KCl, 0,1% Тритон Х100 (или 67 мМ трис-НСl рН 9.4, 18 мМ (NH4)2SO4, 0,01% твин-20), 1 мкМ каждого праймера, по мкМ каждого из дНТФ, 3мМ MgCl2, 10нг ДНК, 0.025-0.1 ед/мкл Taq ДНК полимеразы. ПЦР осуществлялась по следующей схеме:

1. 95°С – 5 мин.

2. 95°С – 1 мин.

3. 60°С – 1мин. 30сек.

4. 72°С – 1 мин.

Шаги 2-4 повторяли 35 раз. Количество продукта анализировали электрофоретически.

2.2.7 Получение DOP библиотеки ДНК ВАС клонов Для амплификации ДНК ВАС клонов использовали ПЦР с частично вырожденными праймерами. ПЦР проводили в 20 мкл реакционной смеси, содержащих 67 мМ трис-НСl рН 9.4, 18 мМ (NH4)2SO4, 0,01% твин-20, 2, мМ MgCl2, по 0,25 мМ д(AТФ, ГТФ, ЦТФ, ТТФ), по 0,5 мкМ DOP1 праймера, DOP2-праймера и DOP3-праймера, 5 ед.акт. Taq ДНК полимеразы, 0,25 мкг ДНК ВАС клонов. ПЦР осуществлялась по следующей схеме:

1. 94°С – 3 мин.

2. 92°С – 1 мин.

3. 30°С – 2 мин. 30 сек., с постепенным повышением со скоростью 0.1°С в секунду до 72°С 4. 72°С – 1 мин.

5. 92°С – 30 сек.

6. 60°С – 30 сек.

7. 72°С – 1 мин.

Шаги 1-4 проводили 10 раз. Шаги 5-7 проводили 30 раз. Количество продукта оценивали электрофоретически в 1,5% агарозном геле.

2.2.8 Мечение ДНК ВАС клонов Мечение ДНК ВАС клонов, которые использовали в качестве зондов для флуоресцентной in situ гибридизации, проводили с использованием аналогов нуклеотидов: биотина-11-дУТФ или дигоксигенина-11-дУТФ. мкл реакционной смеси содержали 67 мМ трис-НСl рН 9.4, 18 мМ (NH4)2SO4, 0,01% твин-20, 2,5 мМ MgCl2, по 0,25 мМ д(AТФ, ГТФ, ЦТФ), 0,1 мМ дTTФ, 0,05 мM биотин-11-дУТФ или дигоксигенин-11-дУТФ, мкМ DOP4-праймер, 2 ед.акт. Taq ДНК-полимеразы, 0,25 мкг ДНК DOP библиотеки ВАС клонов. ПЦР осуществлялась по следующей схеме:

1. 95°С – 5 мин.

2. 95°С – 1 мин.

3. 60°С – 1мин. 30сек.

4. 72°С – 1 мин.

Шаги 2-4 повторяли 35 раз. Количество продукта анализировали электрофоретически.

2.2.9 Полимеразная цепная реакция в реальном времени Подбор праймеров и температур отжига осуществлялся с помощью программы “OLIGO”. Контроль специфичности ПЦР реакции проводили с помощью анализа кривых плавления и анализа амплификации образцов, не содержащих матрицу ДНК. Неспецифическое включение использованного нами в реакции SYBR Green I красителя в двойную цепь ДНК служит причиной увеличения показаний флуоресценции благодаря амплификации неспецифических продуктов. В конце каждой ПЦР проводился финальный шаг диссоциации для того, чтобы выявить специфическую и неспецифическую амплификацию в каждом образце. Для проверки пригодности каждой пары праймеров использовались образцы, не содержащие матрицу ДНК. Это условие позволяло исключить образование праймерных димеров в экспериментальных условиях.

ПЦР проводилась, по крайней мере, трижды для каждого образца.

Реакция амплификации была выполнена в отдельных пробирках для ПЦР фирмы “BioRad” и содержала 10 мкл ДНК, 5 мкл смеси прямого и обратного праймера (финальная концентрация каждого праймера была равна 0,2 мМ) и 10 мкл смеси для ПЦР в реальном времени (SYBR Green PCR Master Mix). Общий объем смеси ПЦР составлял 25 мкл. ПЦР в реальном времени проводилась на приборе С1000 Termocycler фирмы “BioRad”.

Реакция осуществлялась по следующей схеме:

1. 95°С – 5 мин.

2. 95°С – 15 сек.

3. 60°С – 20 сек.

4. 72°С – 30 сек.

Шаги 2-4 повторяли 40 раз.

Диссоциация продуктов проводилась при температуре от 65°С до 95°С с увеличинием на 0,5°С.

Анализ данных проводили с помощью метода калибровочных прямых. Этот метод позволял учитывать различия в эффективностях амплификации между различными парами праймеров. Для каждой пары праймеров готовили серию разведений стандартной ДНК, а затем по полученным значениям, соответствующим концентрациям разведенной стандартной ДНК, строили калибровочные прямые для каждой пары праймеров. В качестве стандартной ДНК использовали геномную ДНК коровы, контрольный и исследуемый участок генома которой представлен в одной копии. Полученные экспериментально значения концентраций геномной ДНК сибирской косули с разным числом В-хромосом, сопоставляли с построенной калибровочной прямой. На основании данных калибровочной прямой определяли значения, соответствующие тому разведению стандарта, которому соответствует данное значение порогового цикла. Мы строили две калибровочных прямых: для контрольного участка, содержащего ген, представленный одной копией на геном у коровы и у сибирской косули, и для исследуемого образца, содержащего ген, копийность которого нужно было оценить у сибирской косули. Далее делили полученные разведения, сопоставленные с калибровочной прямой, друг на друга и получали число копий данного участка на геном.

2.2.10 Получение Cot10 ДНК косули 2.2.10.1 Реассоциация ДНК ДНК сибирской косули (1.8 г) растворяли в 10 мл ТЕ-буфера и сегментировали ультразвуком (УЗДН, 22кГц, 2 мин.) до среднего размера п.н. Затем раствор дважды экстрагировали смесью 500- фенол/хлороформ и осаждали ДНК двумя объемами этанола с добавлением 0,4 М NaCl. Затем ДНК, выпавшую в осадок, высушивали, растворяли в ТЕ буфере и еще раз переосаждали этанолом. Полученную ДНК растворяли в ТЕ-буфере, с помощью спектрофотометра определяли ее концентрацию и проводили реакцию реассоциации в течение 1 часа при концентрации ДНК 830 мкг/мл в растворе 1,2 SSC при 60С.

2.2.10.2 Гидролиз однонитчатой ДНК S1-нуклеазой После окончания реакции реассоциации раствор быстро охлаждали на льду. Затем к раствору добавляли буфер (0,5 М NaAc рН 5,5, 0,045 М ZnSO4) в количестве 1/10 объема и S1-нуклеазу до концентрации ед.акт./мг исходной ДНК. Потом через 1,5 часа инкубации при 42С двунитчатую ДНК осаждали 0,8 объемами изопропанола, центрифугировали. Выпавшую в осадок ДНК высушивали, растворяли в ТЕ-буфере и спектрофотометрически определяли концентрацию. Выход Cot10 ДНК составлял около 20% от общего количества ДНК.

2.2.11 Секвенирование ДНК 2.2.11.1 Секвенирование ДНК Очищение образцов ДНК от остатков праймеров, использующихся для секвенирования ПЦР продукта, проводили с помощью системы ExoSap по протоколу компании.

Секвенирование ПЦР продукта проводили в 10 мкл смеси следующего состава: 2 мкл BigDye, 2 мкл буфера, 0.2 мкM праймер, 10 нг ДНК. Реакция осуществлялась по следующей схеме:

1. 96С 20 сек.

2. 96С – 20 сек.

3. 57С – 5 сек.

4. 60С – 4 мин.

Шаги 2-4 повторяли 30 раз.

2.2.11.2 Переосаждение ДНК К продукту, полученному в реакции секвенирования, добавляли мкл воды, 1 мкл гликогена с концентрацией 5 мкг/мкл, 2 мкл 3 М ацетата калия pH 5.6, 46 мкл этанола 96% и центрифугировали 20 мин. при 4 С.

После центрифугирования удаляли супернатант, добвляли 70% этанол и оставляли на ночь при +4С. Затем снова центрифугировали 10 мин. при С. После удаления супернатанта образцы сушили на воздухе до полного испарения этанола. Анализ образцов ДНК проводился в Межинститутском центре секвенирования СО РАН.

3. Результаты и обсуждение Данная работа строилась на базе предварительных результатов, полученных зав. лаборатории сравнительной геномики к.б.н. В.А.

Трифоновым. С использованием основного принципа метода SHAC (“Selection of Hybrids by Affinity Capture” отбор гибридов афинной сорбцией) им была получена библиотека кДНК В-хромосом косули. Кратко, суть этого метода заключалась в следующем: была выделена тотальная кДНК косули и получена ПЦР кДНК библиотека под специфичным праймером, с которой in vitro гибридизовали В-хромосом-специфичную биотинилированную библиотеку. Затем производили захват полученных гибридов магнитными микрочастицами с иммобилизованным авидином.

Последний шаг дал возможность отобрать только те клоны кДНК, которые оказались гомологичны последовательностям с В-хромосом. Фрагменты кДНК амплифицировали с помощью ПЦР со специфичным праймером. Из этой библиотеки были отсеквенированы 45 клонов. Некоторые из этих клонов были представлены в генном банке под следующими номерами:

JN871269-JN871285 (Таблица 2). Среди клонов встретились транскрипты уникальных генов, в частности, гомологичные ген-содержащему району хромосомы 3 коровы и митохондриальные гены.

Таблица 2. Характеристика последовательностей В-хромосом-специфичной кДНК Координаты Гомология Уникальные гены, хромосомы с коровой, Длина, содержащиеся в коровы Номер в генном кДНК % п.н. кДНК (Btau_4.6.1), п.н. банке 74,572,819 c7g 90,3 440 TNNI3K (intron) 74,573,252 JN 74,666,209 c3t 94,3 310 TNNI3K (intron) 74,666,514 JN 74,727,542 cz2 91,7 371 TNNI3K (intron) 74,727,927 JN TNNI3K (exon) 74,729,423 c7i 95,8 308 FPGT (exons) 74,782,291 JN 74,855,578 cz1 92,8 597 LRRIQ3 (exon) 74,856,167 JN 74,856,714 c5b 90 331 LRRIQ3 (intron) 74,857,042 JN 74,866,986 c9t 93,9 384 LRRIQ3 (intron) 74,867,372 JN 76,073,726 c4f 92 595 76,074,320 JN 76,143,925 c3 90,8 481 76,144,402 JN 76,256,747 c7f 91,1 633 76,257,369 JN 76,257,204 c9 88,5 270 76,257,458 JN 76,260,507 c4b 88,6 586 76,261,080 JN 76,261,257 ct2 88,5 347 76,261,587 JN 76,261,288 c8g 93 322 76,261,613 JN 76,402,615 c9v 95,3 568 76,403,200 JN 76,402,676 c5 93,4 352 76,403,051 JN 76,448,848 cs9 91,4 405 76,449,833 JN Задачей данной работы являлось подтверждение ранее полученных данных, картирование участков ДНК, лежащих на В-хромосомах косули, и уточнение границ этих участков с помощью FISH и ПЦР-картирования.

Поставленная выше задача расширилась, как только было обнаружено, что участки ДНК, представленные на В-хромосомах сибирской косули, содержат значимые функциональные последовательности. В связи с этим стало необходимым провести секвенирование, анализ и сравнение этих последовательностей между собой, используя DОР-библиотеку добавочных хромосом и геномную ДНК представителей семейства оленьих.

Полученные данные были необходимы для того, чтобы ответить на вопрос о консервативности участков, представленных на В-хромосомах и у представителей семейства оленьих.

Поскольку косуля не относилась к числу видов, вовлеченных в исследования по картированию генома, то генетический состав и гомология хромосом косули с хромосомами хорошо картированных видов не были известны, а кариотип был охарактеризован только классическими цитогенетическими методами. Поэтому необходимым этапом работы стало проведение стандартизации кариотипа косули и определение гомологичных районов хромосом с таким хорошо картированным видом как корова (см.

пункт 3.1). Для выявления районов гомологии были использованы пробы верблюда, которые являются очень удобными для сравнительного пэйнтинга парнокопытных (гомология хромосом верблюда с хромосомами коровы, свиньи и человека известна по предыдущим работам (Balmus et al., 2007, Kulemzina et al., 2009)).

3.1 Стандартизация кариотипа косули, выявление гомологичных районов аутосом косули, коровы и верблюда Современные представители семейства Cervidae отличаются огромным разнообразием по числу хромосом в кариотипах. В настоящее время данное семейство достаточно хорошо изучено молекулярно цитогенетическими методами, за исключением видов с большим числом хромосом, к которым относится сибирская косуля.

Для сравнительного картирования хромосом косули мы использовали пэйнтинг-пробы верблюда, оказавшиеся очень удобными для пэйнтига в отряде парнокопытных (Balmus et al., 2007, Kulemzina et al., 2009). Для установления гомологичных районов хромосом коровы и косули мы использовали данные о гомологии районов хромосом коровы и верблюда, приведенные в статье Балмуса с соавторами (Balmus et al., 2007). Данные о гомологиях хромосом коровы и сибирской косули были дополнены на основании сравнения GTG-окрашивания хромосом этих видов (Рис.1). Мы обнаружили восемь перестроек, разделяющих кариотипы коровы и косули, из них шесть слияний хромосом в линии косули, одно слияние в линии коровы и одну инверсию на одиннадцатой хромосоме сибирской косули (Рис. 2, 3) (Таблица 3).

Предковый кариотип семейства Cervidae 2n = 70 (Neitzel et al., 1987) ведет свое происхождение от древнего кариотипа жвачных (2n=58) (Slate et al., 2002) и возник в результате шести хромосомных разрывов (Huang et al., 2006). Cибирская косуля (2n=70+12B) относится к группе видов, сохранивших предковый кариотип семейства оленьих, но до сих пор этот вид оставался невовлеченным в исследования по сравнительному пэйнтингу и картированию.

На основании полученных хромосомных гомологий мы построили сценарий эволюции кариотипа от предка жвачных (Pecoran Ancestral Karyotype) до сибирской косули (Таблица 3). В результате шести разрывов хромосом предкового кариотипа жвачных (2n=58) образовались хромосом сибирской косули. Хромосома 4 косули и хромосома 28 косули образовались при разрыве хромосомы А2 предкового кариотипа жвачных, гомологичной хромосоме 1 коровы. При разрыве хромосомы B (гомологичной хромосоме 2 коровы) образовались хромосома 10 косули и хромосома 19 косули, при разрыве хромосомы С2 (гомологичной хромосоме 5 коровы) – хромосома 21 косули и хромосома 29 косули, при разрыве хромосомы F (гомологичной хромосоме 6 коровы) – хромосома косули и хромосома 24 косули, при разрыве хромосомы В1 (гомологичной хромосоме 8 коровы) – хромосома 14 косули и хромосома 34 косули, и при разрыве хромосомы H1 (гомологичной хромосоме 9 коровы) – хромосома 20 косули и хромосома 33 косули. Похожий сценарий разрывов при формировании предкового кариотипа оленьих был предположен ранее (Huang et al., 2006). Таким образом, кариотип косули является очень консервативным и мало изменился со времени формирования предкового кариотипа оленьих.

С помощью хромосомспецифичных проб верблюда, полученных из пиков R10 и R33, была обнаружена инверсия на хромосоме 11 сибирской косули (Рис. 4). Присутствие этой инверсии подтвердилось и у серого мазама (Mazama gouazoubira). Проба R10 состояла из смеси хромосом 9, и 11 верблюда, таким образом, нельзя было исключать возможности, что прицентромерный блок на хромосоме 11 сибирской косули представляет собой транслокацию сегментов CDR9 или CDR11. Для решения этого вопроса мы использовали пробу человека HSA11, гомологичную CDR10 и CDR33 (Balmus et al., 2007). Мы обнаружили, что хромосома 11 косули полностью метится включая сегмент, расположенный HSA11, проксимальнее CDR33, что свидетельствует об однородном строении CPY11 и исключает возможность транслокации. Таким образом, было показано наличие парацентрической инверсии на хромосоме 11 сибирской косули и на хромосоме, соответствующей CPY11, у мазама (Рис.4).

Требуются дополнительные исследования других оленей для того, чтобы установить время появления инверсии на хромосоме 11 косули. Не исключено, что она может оказаться характерной для всего семейства.

Рисунок 1. Сравнительная карта GTG-окрашенных хромосом коровы и сибирской косули. Номера хромосом сибирской косули указаны слева и справа. Номера хромосом коровы указаны снизу.

Рисунок 2. Сравнительная карта гомологичных районов косули (CPY), верблюда (CDR) и коровы (BTA), основанная на данных хромосомного пэйнтинга. «В» В хромосомы.

Таблица 3. Гомологичные районы хромосом косули, верблюда, коровы и предка жвачных, определённые с помощью хромосомного пэйнтинга. “prox” – проксимальный район хромосомы, “dist” – дистальный район хромосомы.

№ хромосомы косули № хромосомы верблюда № хромосомы коровы № хромосомы предка жвачных (Slate et. al., 2002) 1 21 (prox), 9, 13 (dist) 3 A 2 7 4 D 3 22, 3 7 E 4 1 1 A 5 28, 15, 4 11 C 6 6 10 G 7 11 26 (prox), 28 (dist) U 8 19, 35 13 J 9 14 12 I 10 5 2 B 11 10, 33 15 L 12 2 6 F 13 25, 29 14 H 14 31 (prox), 4 (dist) 8 B 15 23, 21, 13 16 K 16 9 18 M 17 2 (prox), 32 (dist) 17 N 18 16 19 N 19 5 (prox), 13(dist) 2 B 20 8 9 H 21 12, 34 5 C 22 22 (prox), 3 (dist) 20 O 23 27 (prox), 6 (dist) 21 P 24 2 6 F 25 20 23 R 26 24, 30 24 S 27 26 27 V 28 1 1 A 29 12 5 C 30 17 22 Q 31 10, 33 29 W 32 18 25 T 33 8 9 H 34 31 (prox), 4 (dist) 8 B X X X X Рисунок 3. Примеры результатов FISH некоторых проб верблюда (CDR) на хромосомы косули (CPY). A –пробы CDR 9, 10, 11 (зеленый) и CDR 33 (красный).

Б – пробы CDR 3 (зеленый) и CDR 22 (красный). В – пробы CDR 13 (зеленый) и CDR 21, 27 (красный).

Рисунок 4. Схема, показывающая наличие инверсии на хромосоме 11 сибирской косули и хромосоме, соответствующей CPY11, у мазама. А – локализация проб верблюда CDR10 (зеленый) и CDR33 (красный) на CPY11. Б – локализация проб верблюда CDR (зеленый) и CDR33 (красный) на MGO11. В – локализация пробы человека HSA (зеленый) и пробы верблюда CDR 33 (красный) на CPY11.

3.2 Картирование участков ДНК, лежащих на В-хромосомах косули 3.2.1 Картирование участков ДНК, лежащих на В-хромосомах косули с помощью ВАС клонов коровы Основной задачей нашей работы являлось проведение картирования участков ДНК, лежащих на В-хромосомах косули, уточнение границ этих участков с помощью FISH и ПЦР-картирования и сравнение полученных данных с данными распределения В-хромосом-специфичной кДНК.

Последовательности кДНК, полученные нами ранее с помощью секвенирования, оказались гомологичными району хромосомы 3 коровы в пределах от 74,6 м.п.н. до 76,4 м.п.н. (по номенклатуре UCSC genome browser on Cow Oct. 2011 (Baylor Btau_4.6.1/bosTau7)). К выделенному району были подобраны ВАС клоны из библиотеки CHORI-240 и поставлена флуоресцентная in situ гибридизация на препаратах метафазных хромосом сибирской косули с разным числом В-хромосом и коровы (в качестве контроля). Для картирования участков ДНК, лежащих на В хромосомах косули, использовалась суспензия хромосом сибирской косули с 4 В-хромосомами и с 8 В-хромосомами.

Таблица 4. Список ВАС клонов, использованных для картирования добавочных хромосом сибирской косули.

ВАС Координаты Уникальные Наличие Наличие Наличие хромосомы 3 гены, сигнала на сигнала на сигнала на коровы содержащиеся в В- аутосомах хромосомах ВАС клоне хромосомах косули коровы (Btau_4.6.1), п.н. косули CH240-131I21 74 245 590- TNNI3K (partial) - + + 74 473 CH240-10H15 74 503 590- TNNI3K + + + 74 630 CH240-444I8 FPGT + + + 74 611 590 FGD5-AS 74 806 LRRIQ3 (partial) TNNI3K CH240-493Р4 74 795 590- LRRIQ3 + + + 74 990 590 RNPS CH240-515С3 74 944 590- + + + 75 180 CH240-454D22 76 240 590- + + + 76 385 CH240-351I13 76 410 590- ARPC2 + + + 76 580 CH240-385G2 76 693 590- - + + 76 980 Как видно из таблицы 4 и результатов гибридизации, приведенных на рисунках 5А, 5Б, 5В и 5Г, при локализации шести ВАС клонов коровы (CH240-10H15, CH240-444I8, CH240-493Р4, CH240-515С3, CH240-454D22, CH240-351I13) можно было увидеть специфические сигналы на В хромосомах, на хромосоме 1 косули и хромосоме 3 коровы. Полученные данные подтверждали присутствие фрагментов, представленных ВАС клонами, на добавочных хромосомах. ВАС клоны CH240-131I21 и CH240 385G2 не давали сигнала на В-хромосомах, но сигнал был виден на соответствующих аутосомах косули и коровы. На основании этих данных мы сделали вывод об отсутствии соответствующих фрагментов на добавочных элементах. При локализации ВАС клонов коровы мы наблюдали соответствующие сигналы не на всех добавочных хромосомах.

ВАС клон CH240-444I8 давал сигнал на шести из восьми В-хромосом у сибирской косули с 8 В-хромосомами (Рис. 5А), тогда как у сибирской косули с 4 В-хромосомами мы наблюдали сигнал на всех четырех добавочных хромосомах (Рис. 5В). Данная картина может быть связана с тем, что ВАС клон CH240-444I8 частично представлен на двух из восьми В хромосомах и получаемый сигнал плохо виден. ВАС клон CH240-454D давал сигнал разной интенсивности на В-хромосомах сибирской косули с добавочными элементами: на двух В-хромосомах наблюдали сигнал в 2- раза интенсивнее, чем на двух других добавочных элементах (Рис. 5Г). Это может быть связано с амплификацией данного участка на двух из четырех добавочных хромосом.

На основе расположения ВАС клонов и кДНК на гомологичном сегменте генома коровы выделены два участка, локализованные на В хромосомах (Рис. 7). Один из этих участков располагается в районе от 74, м.п.н. до 74,9 м.п.н. хромосомы 3 коровы, другой от 76,0 м.п.н. до 76, м.п.н. хромосомы 3 коровы. Между этими участками располагается район, бедный генами. В исследуемых участках у коровы находится ряд уникальных генов: TNNI3K, LRRIQ3, FPGT, а также псевдогены RNPS1, Arpc2 и ген FGD5-AS1, кодирующий РНК. Таким образом, можно предположить присутствие этих генов или их фрагментов на добавочных хромосомах.

По распределению ВАС клонов удалось установить примерное местоположение участка, присутствующего на добавочных элементах, относительно хромосомы 3 коровы, а также примерный размер этого участка, который был уточнен с помощью ПЦР-картирования.

Рисунок 5А. Результаты локализации ВАС клонов на хромосомы сибирской косули с В-хромосомами: ВАС CH240-444I8.

Рисунок 5Б. Результаты локализации ВАС клона на хромосомы сибирской косули с 8 В хромосомами: ВАС СH240-10H15.

Рисунок 5В. Результаты локализации ВАС клона на хромосомы сибирской косули с 4 В хромосомами: ВАС CH240-444I8.

Рисунок 5Г. Результаты локализации ВАС клона на хромосомы сибирской косули с 4 В хромосомами: ВАС CH240-454D22.

3.2.2 Картирование участков ДНК, лежащих на В-хромосомах косули, с помощью ПЦР на библиотеке сортированных добавочных хромосом Для выяснения границ и примерного размера участков хромосомы косули, локализованных на В-хромосомах, было выполнено “тонкое” картирование с помощью ПЦР. Было использовано 40 пар праймеров (Таблица 5). Праймеры подбирались в зависимости от распределения кДНК и ВАС клонов, которые давали сигнал на добавочных хромосомах. Подбор праймеров осуществлялся по геномной последовательности коровы (UCSC genome browser on Cow Oct. 2011 (Baylor Btau_4.6.1/bosTau7)). ПЦР проводили, используя в качестве матрицы DOP-библиотеку сортированных добавочных хромосом. В качестве первого контроля брали ДНК коровы, по которой подбирали оптимальные условия отжига праймеров и определяли качество ПЦР-продукта. В качестве второго контроля брали ДНК косули с В-хромосомами. Вывод о присутствии фрагментов на добавочных хромосомах делался на основе наличия ПЦР-продукта ожидаемого размера на библиотеке В-хромосом, геномной ДНК косули и коровы.

Таблица 5. Список праймеров, использованных в ПЦР для картирования отдельных участков района хромосомы 1 косули на В-хромосомах. “В” наличие ПЦР продукта при использовании библиотеки сортированных В-хромосом. “СРYВ” наличие ПЦР продукта при использовании геномной ДНК косули с В-хромосомами. “ВТА” – наличие ПЦР продукта при использовании геномной ДНК коровы.

№ Назва- Последовательность праймеров, координаты Раз- В СРУ ВТА ние 5’ – 3’ хромосомы мер В прай- 3 коровы фраг меров мента (Btau_4.6.1) п.н.

1 T5F: TCGCTAAGAAGAACACTGTCC 74505791- 226 - + + T5R: TGACCGCTGGACCACCAG 2 T159F: GCATGTAGGGAAGAACCATG 74530162- 310 - + + T159R: CAATCCCACTGGCAATGG 3 5168F: TCACATTGCTAACTTGAAAGAGC 74538669- 307 - + + 5168R: CTGGCCATCCATGTTTCGC 4 5182F: CTTAGCATGCAATGTATGCTCT 74553324- 218 + + + 5182R: ATCACAGCCTGAGACTGGC 5 T19LF: GGTGCAACATTCTATTGCCT 74600303- 242 + + + T19LR: ATCATTGCAGTAGATGTTGCC 6 24F: ATGCCTTCTTATGTATCTCGGTGG 74620585- 843 + + + 24R: CAGGACAATGAAGATCACGTTCC 7 T4F: GTGTCTACATTTTGCAAAGCACTGTTGAA 74729283- 270 + + + T4R: GGTTACATGAGTTGC 8 35F: CTTTACCCAAATATATGCCTCAGTTCT 74729379- 961 + + + 35R: CTGATTAATTCCTTTCATGATTTCACC 9 T2F: GGTAAAACCTGTAACAGCTAGAGAGGTG 74780426- 336 + + + T2R: GAAACATACATAGTCCC 10 LR1F: CATGGAACAATCATAGAAGAGCT 74801521- 321 + + + LR1R: ACTGTGTATCGATAACCTAAGAGC 11 LR2F: TTCTCTATCTACATGACAATGGG 74805587- 221 + + + LR2R: GAATCTTTCAGGAAGATGCCAG 12 LR4F: GCAATTCCCTCTTCCTCCC 74855858- 188 + + + LR4R: CTTACATGTTTCCAGCGTGC 13 LR5F: GGAGCTCACTGTCCTCAAG 74893978- 259 + + LR5R: CTAGTGTCCAATCAGAGACAGG 14 5618F: AAGAGAATGAAAGCTGGTCTCT 74989034- 190 + + + 5618R: GCAGCAGCTTACAAGAAGAGA 15 5709F: GTGATCTATCGCCTCACGGAAGG 75080444- 544 + + + 5709R: GGAGTAGAAGGGAGTGCCTGTGC 16 5711F: GTGCCTAGATATCACAAACCACAGG 75082566- 320 + + + 5711R: GGCATCCTGTACCTCTTCACTTGAT 17 5715F: CAGATACTGGCAGTATGACCAAG 75085756- 403 - + + 5715R: GTAGGTTTCTGAAGTTGCAAGGTAG 18 5716F: GTCCAACATTGATCTAATCTGTACC 75087511- 332 - + + 5716R: AAAGAGCTACTGTTTGCTAGATGC 19 5768F: GTGGGATTGGAGTCAGGAGG 75139555- 618 + + + 5768R: CAAAGCTCACTCCTGTTAGCAGAT 20 5863F: CATGAATGGATCCCAAGGC 75233849- 562 - + + 5863R: TGACTGTGACCCTTCACTCCC 21 759F: CAAGAGGGACACTGAGGTCAGC 75303594- 519 + + + 759R: CCCACACGGTGGCACATG 22 604F: TAGATGTGTTCTGCAAGATGGGGA 75412211- 171 + + + 604R: TGTCATCATCAAAATGCCAGGATC 23 6103F: GGTGGCCTTCTCCTCAGGTC 75473859- 273 + + + 6103R: GAAGCTCGGGAACCTCTGGAG 24 6135F: GCTTCTGCTTCCTCTTTGTCCAC 75505897- 214 + + + 6135R: TGTTGCCTGGTAACCAACTTGC 25 6179F: CAGTAGCCACTCTAGAAGATTCTGG 75550251- 369 + + + 6179R: CTGTTCCTGCCTTCCAGAGAA 75550616 / 26 762F: CAGCACATGCATCACTCAGGG 75571319- 257 - + + 762R: GTCAGCCACCATGCAGAGCC 27 7620F: TCGTCAAGCTAGGTTAATGGTGG 75571678- 465 + + + 7620R: CCTCATGGCTCTCTTGATCAGTT 28 6232F: CTGGTTCTACCTACCCTACTCAACA 75603320- 179 + + + 6232R: ATTTAGCCAAGTCTGTTCTGGGA 29 6307F: CAGGCAATGAAGGGTGGAG 75677761- 618 + + + 6307R: CGTCATTCAGCATGAGGCAA 30 766F: GAGATCTTCCTGGCAGTTGCTC 75686759- 397 - + + 766R: CATGTCATCAGCCTGGGTGAG 31 6343F: GCTTCTCTCTTTGTTGCCTGC 75714280- 375 - + + 6343R: GGCTGGTTTTAGCTAATCAAGCT 32 6453F: TTCACAGGGTTGGAAGCAGTC 75823761- 506 + + + 6453R: TGCTTGCACCACTGCTGTC 33 764F: CACAGATCCTTCCCCTCTCCC 75830409- 488 + + + 764R: GTGGTGCCCAATAGCACAGC 34 6685F: CCCACTAACTACCATAGCAGATACC 76001587- 366 + + + 6685R: GTCTCAAGCCATCTGGAAGAGTC 35 669F: AGCTTTCGTAGTTCAGGGGCAGT 76008917- 594 + + + 669R: AATGCCCTGAATAATATTGCCAGG 36 6719F: CCCTAAGGAAACAGAGGGGG 76035003- 274 + + + 6719R: GTCATGGAGACTTCATCTTGGG 37 6752F: TACACTTCTCAGTAAGAGCACAG 76068308- 320 + + + 6752R: GGAAACATGAGCTGATACAGTTC 38 7152F: GGAGGGTCAAGTGGGGC 76468193- 427 + + + 7152R: ACCAACCAGGAATGAACCATG 39 7186F: AAGGCCTCTGGACTTCTGTCC 76502073- 190 - + + 7186R: GCACTGAACAGGCATAATCCCTC 40 725F: CCAAGGCAACATGACAGGG 76568504- 381 - + + 725R: GCCAACACTACCTGGTTGC С помощью ПЦР-картирования мы уточнили внешние границы района, локализованного на В-хромосомах.

Для выявления верхней границы исследуемого участка, мы использовали пять пар праймеров (Т5, Т159, 5168, 5182, Т19L). Было показано, что верхняя граница района, располагается между позициями 74 538 976 п.н. (праймер 5168) и 74 600 303 п.н. (праймер Т19L) (позиции были определены по последовательности коровы UCSC genome browser on Cow Oct. 2011 (Baylor Btau_4.6.1/bosTau7)) (Рис. 6А, 6Б). Кроме того, на В хромосомах по результатам ПЦР были обнаружены экзоны гена LRRIQ3, которым соответствуют подобранные нами праймеры LR1, LR2 и LR4 (Рис.

6В, 6Г). Последний экзон данного гена не был локализован на добавочных хромосомах (праймер LR5) (Рис. 6Д).

Для выявления нижней границы исследуемого участка, мы использовали три пары праймеров (7152, 7186, 725). Было показано, что нижняя граница района, представленного на В-хромосомах, проходит между позициями 76 468 619 п.н. (праймер 7152) (Рис. 6Е) и 76 502 073 п.н.

(праймер 7186) (UCSC genome browser on Cow Oct. 2011 (Baylor Btau_4.6.1/bosTau7)) (Рис. 6Ж).

Внутри рассмотренного нами участка располагается внутренняя некодирующая область, составляющая примерно около 1 196 000 п.н. Для того чтобы выявить присутствие этой области или отдельных ее частей на В-хромосомах было использовано двадцать четыре пары праймеров. ПЦР продукт был получен при использовании 17 праймеров, в частности праймера 764 (Рис. 6З). Мы наблюдали отсутствие продукта ПЦР в случаях с использованием 6 праймеров, в частности праймера 762 (Рис. 6З). При использовании праймера 759 на добавочных хромосомах были выявлены два фрагмента. Один из полученных фрагментов был нужной длины, а другой оказался короче, что, по-видимому, является артефактом, возникшим в результате использования DOP-библиотеки В-хромосом (Рис.

6З). В одном случае с использованием праймера 6179 на В-хромосомах и на геномной ДНК сибирской косули с В-хромосомами размер полученного ПЦР-продукта был больше по сравнению с синтезированным фрагментом на геномной ДНК коровы. При секвенировании фрагмента с В-хромосом, была обнаружена вставка SINE – элемента класса BOV-2.

Таким образом, были выявлены присутствующие и отсутствующие фрагменты внутреннего района на добавочных элементах. Удалось установить, что участок, расположенный на В-хромосомах, составляет примерно 2 м.п.н. и характеризуется незначительными делециями в районе генной пустыни.

По результатам ПЦР и гибридизации ВАС клонов коровы на хромосомы косули можно заключить, что В-хромосомы сибирской косули происходят из одного и того же участка генома, но отличаются гетерогенным строением. Между добавочными элементами возможны вариации по числу сегментов: амплификации или делеции отдельных фрагментов или их частей.

Рисунок 6. Результаты гель-электрофореза ПЦР продуктов при картировании отдельных фрагментов хромосомы 1 косули на В-хромосомах. HindIII/L – маркер молекулярного веса, “В” – продукт ПЦР с использованием ДНК сортированных В-хромосом, “КВ” – продукт ПЦР с использованием геномной ДНК косули с В-хромосомами, “ВТА” – продукт ПЦР с использованием геномной ДНК коровы. А – праймеры 5168F/5168R. Б – праймеры 19LF/19LR, 336 п.н. – маркерная последовательность длиной 336 п.н. В – праймеры LR1F/LR1R, 270 п.н. – маркерная последовательность длиной 270 п.н. Г – праймеры LR2F/LR2R. Д – праймеры LR5F/LR5R. E – праймеры 7152F/7152R. Ж – праймеры 7186F/7186R. З – праймеры 759F/759R, 762F/762R, 764F/764R.

Рис. 6А Рис. 6Б Рис. 6В Рис. 6Г Рис. 6Д Рис. 6Е Рис. 6Ж Рис. 6З Рисунок 7. Схема района хромосомы 3 коровы с координатами и нанесенными маркерами, картированными на В-хромосомах сибирской косули. “TNNI3K”, “LRRIQ3”, “FPGT”, “FGD5-AS1”, “RNPS1”, “Arpc2” – названия генов, располагающихся на хромосоме 3 коровы (по данным UCSC genome browser on Cow Oct. 2011 (Baylor Btau_4.6.1/bosTau7)).

3.3 Оценка копийности генов, присутствующих на добавочных хромосомах у сибирской косули Для оценки копийности фрагментов, представленных на добавочных хромосомах, использовался метод ПЦР в реальном времени. В качестве маркеров использовали консервативные участки генов FPGT и LRRIQ3, а также промоторную область гена TNNI3K. В качестве контрольного гена использовали консервативный участок гена PTGFR, который располагается на хромосоме 3 коровы и представлен единственной копией в геноме коровы (по данным UCSC genome browser on Cow Oct. 2011 (Baylor Btau_4.6.1/bosTau7)). Кроме того, с учетом полученных нами данных, этот ген лежит далеко за пределами области, представленной на добавочных хромосомах сибирской косули (примерно на расстоянии 4,6 м.п.н.) и поэтому подходит для нашего исследования.

Ранее были получены данные о том, что при межвидовых исследованиях различия в нуклеотидной последовательности ДНК праймеров приводят к искажению в подсчете копийности изучаемых генов (Bel et. al., 2011). Поскольку сибирская косуля и корова - относительно филогенетически отдаленные виды, мы предварительно проводили секвенирование участков, по которым далее подбирали праймеры для ПЦР в реальном времени. Нуклеотидные последовательности отобранных праймеров были идентичны у коровы и сибирской косули. Список, использованных нами праймеров для ПЦР в реальном времени, приведен в таблице 6.

Таблица 6. Список праймеров, использованных в ПЦР в реальном времени.

Название Последовательность праймеров, Координаты Размер Название праймеров 5’ – 3’ хромосомы фрагмента, гена 3 коровы п.н.

(Btau_4.6.1) PT4RF: TCCATTTGGCAGTCAGCTT 74730128- TNNI3K PT4RR: AATTTCCCATTTGTTAGAAGTTTC FPGTBF: CTTGCACTCCACATGCCAT 74775958- FPGT FPGTBR: AATTGCATCATTAGTGGTGCTTAT LR4F: GCAATTCCCTCTTCCTCCC 74855858- LRRIQ LR4R: CTTACATGTTTCCAGCGTGC NBF: TGTAGCTTTGCTGCCCATC 70104006- PTGFR NBR: AACCTATCTTCCCAGTCTTTGATT Копийность участков, представленных на добавочных хромосомах, определяли для сибирской косули без В-хромосом, сибирской косули с 4 В хромосомами и сибирской косули с 8 В-хромосомами. Мы установили, что участки генов TNNI3K и LRRIQ3 представлены в двух копиях на диплоидный геном у сибирской косули без В-хромосом, так же как в случае с геном PTGFR. Тогда как участок гена FPGT представлен в четырех копиях на диплоидный геном у сибирской косули без добавочных хромосом, что говорит о возможной дупликации этого гена. Участки генов FPGT и LRRIQ имеют шесть копий на диплоидный геном у сибирской косули с 4 В хромосомами. Эти данные прямо согласуются с числом добавочных хромосом. Т.е. две копии этих генов лежат на аутосомах и, возможно, по одной копии на четырех В-хромосомах. Участок гена TNNI3K у сибирской косули с 4 В-хромосомами представлен в четырех копиях на диплоидный геном. Это означает, что две копии данного гена присутствуют на аутосомах и две копии, вероятно, на двух из четырех В-хромосом. В данном случае видно, что, возможно, не все добавочные элементы содержат копию TNNI3K. Участок гена TNNI3K имеет десять копий на диплоидный геном сибирской косули с 8 В-хромосомами. Вероятно, что по одной копии этого гена содержится на всех восьми добавочных хромосомах и две копии – на аутосомах. Участки генов FPGT и LRRIQ3 представлены в восьми копиях на диплоидный геном сибирской косули с 8 В-хромосомами (Рис. 8). Т.е. по две копии этих генов приходится на аутосомы и шесть копий расположены на 8 добавочных хромосомах. Эти данные коррелируют с результатами локализации ВАС клонов коровы на хромосомы косули и говорят в пользу того, что не все добавочные элементы содержат копии этих генов.


Рисунок 8. Степень копийности генов TNNI3K, FPGT и LRRIQ3 относительно однокопийного аутосомного гена PTGFR, у сибирской косули (CPY) без В-хромосом (0B), у сибирской косули с 4 В-хромосомами (4B) и 8 В-хромосомами (8B).

Таким образом, копийность участков генов TNNI3K, FPGT и LRRIQ коррелирует с числом В-хромосом, но не всегда в прямо пропорциональной зависимости. Этот факт объясняется тем, что не все добавочные элементы содержат копии участков этих генов.

3.4 Сравнение первичной структуры гомологичных фрагментов ДНК аутосом и В-хромосом На основе распределения кДНК, локализации ВАС клонов коровы на хромосомы сибирской косули и ПЦР-картирования было обнаружено и подтверждено присутствие аутосомных генов TNNI3K, FPGT, LRRIQ3 на добавочных хромосомах. В результате ПЦР в реальном времени мы показали, что копийность данных генов выше у сибирской косули с В хромосомами по сравнению с сибирской косулей без В-хромосом.

Результаты ПЦР в реальном времени указывают на гетерогенный состав В хромосом, что согласуется с результатами локализации ВАС клонов коровы, которые при гибридизации показывали разную интенсивность сигналов на добавочных элементах.

В связи с обнаружением функциональных последовательностей на добавочных хромосомах стало необходимым провести сравнение первичной структуры гомологичных фрагментов ДНК аутосом и В-хромосом.

Полученные данные позволили бы обнаружить В-хромосом-специфичные замены, играющие роль маркеров при экспрессии генов, расположенных на добавочных элементах.

3.4.1 Сравнение первичной структуры гомологичных фрагментов ДНК аутосом и В-хромосом гена LRRIQ Последовательность фрагментов ДНК, специфичных для аутосом и В хромосом косули, определяли с помощью секвенирования. Нами были отсеквенированы аутосомные и В-хромосомные копии второго и четвертого экзонов гена В качестве материала для секвенирования LRRIQ3.

использовали геномную ДНК косули без В-хромосом и DOP-библиотеку В хромосом сибирской косули. Последовательности второго экзона гена LRRIQ3 были представлены в генном банке под следующими номерами:

JN871294, JN871295. Праймеры, использовавшиеся для секвенирования (LR2, LR4), были описаны выше (глава 3.2.2, таблица 5). В четвертом экзоне гена LRRIQ3 различий обнаружено не было. Это свидетельствует о консервативности этой части гена LRRIQ3, представленного на В хромосомах. Во втором экзоне на В-хромосомах косули мы обнаружили транзицию (GA), которая привела к замене аминокислотной последовательности (валин141 на изолейцин141) (Рис. 9А).

Подтверждением того, что замена произошла именно в В-хромосомах, является консервативность этой позиции у косули и коровы (Рис.9Б). При сравнении аутосомных последовательностей второго экзона гена LRRIQ косули и коровы (GI:154425702) мы обнаружили ряд нуклеотидных замен, одна из которых привела к замене аминокислотной последовательности (лейцин122 на валин122) у косули (Рис.9Б).

Таким образом, из пяти экзонов гена LRRIQ3 только четыре представлены на добавочных хромосомах, последовательности двух из них, исходя из результатов секвенирования, оказались консервативными относительно последовательностей этих экзонов у сибирской косули и коровы.

Рисунок Сравнение нуклеотидных и аминокислотных последовательностей 9.

фрагментов второго экзона гена LRRIQ3. CPY аутосомная последовательность косули, CPYB – последовательность на добавочных хромосомах, ВТА – аутосомная последовательность коровы. А – сравнение нуклеотидных и аминокислотных последовательностей косули и коровы. Б сравнение нуклеотидных и аминокислотных последовательностей аутосом косули и В-хромосом.

Рис. 9А CPY TTCTCTATCTACATGACAATGGGTTTGCAAAGTTAAAGAACGTATGTATGTTATCTGCCT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| СPYB TTCTCTATCTACATGACAATGGGTTTGCAAAGTTAAAGAACGTATGTATGTTATCTGCCT CPY GTCCGAGCCTCATTGCCCTCACTATGTTTGATTGTCCAGTAAGCCTTAAAAAAGGATATA |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| CPYB GTCCGAGCCTCATTGCCCTCACTATGTTTGATTGTCCAATAAGCCTTAAAAAAGGATATA CPY GACATGTTCTTGTCAACAGTATATGGACTCTCAAAGCATTGGATCACCATGTGATTTCTG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CPYB GACATGTTCTTGTCAACAGTATATGGACTCTCAAAGCATTGGATCACCATGTGATTTCTG CPY ATGAAGAAATAATTCAAAACTGGCATCTTCCTGAAAGATTCA |||||||||||||||||||||||||||||||||||||||||| CPYB ATGAAGAAATAATTCAAAACTGGCATCTTCCTGAAAGATTCA BCPY LYLHDNGFAKLKNVCMLSACPSLIALTMFDCPISLKKGYRHVLVNSIWTLKALDHHVISD CPY LYLHDNGFAKLKNVCMLSACPSLIALTMFDCPVSLKKGYRHVLVNSIWTLKALDHHVISD BCPY EEIIQNWHLPERF CPY EEIIQNWHLPERF Рис. 9Б CPY TTCTCTATCTACATGACAATGGGTTTGCAAAGTTAAAGAACGTATGTATGTTATCTGCCT ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| BTA TTCTCTATCTACATGACAATGGGTTTGCAAAGTTAAAGAACTTATGTATGTTATCTGCCT CPY GTCCGAGCCTCATTGCCCTCACTATGTTTGATTGTCCAGTAAGCCTTAAAAAAGGATATA |||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||| BTA GTCCAAGCCTTATTGCCCTCACTATGTTTGATTGTCCAGTAAGCCTTAAAAAAGGATATA CPY GACATGTTCTTGTCAACAGTATATGGACTCTCAAAGCATTGGATCACCATGTGATTTCTG |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| BTA GACATGTTCTTGTCAACAGTATATGGACTCTCAAAGCATTGGATCATCATGTGATTTCTG CPY ATGAAGAAATAATTCAAAACTGGCATCTTCCTGAAAGATTCA |||||||||||||||||||||||||||||||||||||||||| BTA ATGAAGAAATAATTCAAAACTGGCATCTTCCTGAAAGATTCA CPY LYLHDNGFAKLKNVCMLSACPSLIALTMFDCPVSLKKGYRHVLVNSIWTLKALDHHVISD BTA LYLHDNGFAKLKNLCMLSACPSLIALTMFDCPVSLKKGYRHVLVNSIWTLKALDHHVISD CPY EEIIQNWHLPERF BTA EEIIQNWHLPERF 3.4.2 Сравнение первичной структуры гомологичных фрагментов ДНК аутосом и В-хромосом генов TNNI3K и FPGT Как уже было сказано ранее, исследуемый район содержит три уникальных гена: LRRIQ3, TNNI3K и FPGT. Причем у человека был обнаружен транскрипт образованный посредством FPGT-TNNI3K, альтернативного сплайсинга (http://www.ncbi.nlm.nih.gov/gene?cmd=Retrieve&dopt=Graphics&list_uids= 0526835). У сибирской косули данный вопрос не изучался, но, вероятно, что в данном случае также возможен альтернативный сплайсинг.

Нами были получены аутосомные и В-хромосомные копии первого, второго, третьего экзонов гена FPGT (примечание 1, 2, 3), а также промоторная область гена TNNI3K (таблица 7). Последовательности промоторной области гена TNNI3K для разных видов Cervidae были представлены в генном банке под следующими номерами: JN871289 JN871293.

Ранее зав. лаборатории сравнительной геномики ИМКБ СО РАН В.А.Трифоновым была получена В-хромосом-специфичная кДНК (глава 3), полная последовательность которой также была вовлечена в наше исследование. В качестве материала для секвенирования использовали геномную ДНК косули без В-хромосом и DOP-библиотеку В-хромосом сибирской косули. Праймеры, использовавшиеся для секвенирования (T1, T2, T3, PT4, 40, FPGT1, FPGT2, FPGT3, T4) описаны в таблице 8.

В третьем экзоне гена FPGT и промоторной области гена TNNI3K не было обнаружено замен, специфичных для В-хромосом. В первом экзоне гена FPGT на В-хромосомах косули мы обнаружили транзицию (AG), которая привела к замене аминокислотной последовательности (метионин на валин1). Во втором экзоне гена FPGT на В-хромосомах косули нами также была найдена транзиция обусловившая замену (AG), аминокислотной последовательности (лизин83 на аргинин83).

Обнаруженная замена во втором экзоне также подтверждается В-хромосом специфичной кДНК. Вывод о специфичности замен, найденых на В хромосомах, был сделан на основе сравнения первого и второго экзонов гена в ряду млекопитающих (глава 3.5). Синонимичные FPGT полиморфизмы, обнаруженные в экзонах гена FPGT на В-хромосомах, также описаны в главе 3.5.

3.5 Оценка эволюционной консервативности генов TNNI3K и FPGT В связи с обнаружением копий генов FPGT, TNNI3K на добавочных хромосомах оказалось интересным оценить их консервативность в эволюции путем сравнения последовательностей экзонов у косули, лося, марала, мазама и других видов позвоночных.

Мы получили полную последовательность гена FPGT, состоящего из четырех экзонов (примечание 1, 2, 3;

JN871286-JN871288), а также последовательность промоторной области и первого экзона гена TNNI3K (JN871289-JN871293;

примечание 4). Полные последовательности были получены у следующих представителей рода оленьих: у сибирской косули с 8 В-хромосомами, у двух особей европейской косули без В-хромосом, у сибирской косули без В-хромосом, у марала, лося и мазама (Таблица 7).

Для секвенирования были использованы девять пар праймеров 8). С помощью праймера Т1 была получена полная (Таблица последовательность первого экзона гена FPGT у двух особей европейской косули, у сибирской косули без В-хромосом, у сибирской косули с 8 В хромосомами, у марала и мазама (примечание 1). С помощью праймера Т была получена полная последовательность второго экзона гена FPGT у сибирской косули без В-хромосом, у лося, марала и мазама (примечание 2).

С помощью праймера Т3 была получена последовательность третьего экзона гена FPGT у европейской косули, у сибирской косули без В хромосом, у сибирской косули с 8 В-хромосомами, у лося, марала и мазама (примечание 3). С помощью праймеров 40, FPGT1, FPGT2, FPGT3 была получена последовательность четвертого экзона гена FPGT у европейской косули, у сибирской косули с 8 В-хромосомами и у марала (JN871286 JN871288). Праймер PT4 позволил получить полную последовательность промоторной области гена TNNI3K у европейской косули, у сибирской косули с 8 В-хромосомами, у лося и марала (JN871289-JN871293). Праймер Т4 позволил получить полную последовательность первого экзона гена TNNI3K у европейской косули, у сибирской косули с 8 В-хромосомами и у марала (примечание 4) (Таблица 7, 8).

Таблица 7. Список отсеквенированых фрагментов генов FPGT и TNNI3K у разных видов оленьих. “CCA 1” – наличие отсеквенированного продукта у одной особи европейской косули. “CCA 2” – наличие отсеквенированного продукта у второй особи европейской косули. “CPY (0В)” – наличие отсеквенированного продукта у сибирской косули без В хромосом. “CPY (8B)” – наличие отсеквенированного продукта у сибирской косули с В-хромосомами. “B” – наличие отсеквенированного продукта на ДОР-библиотеке В хромосом. “AAL” – наличие отсеквенированного продукта у лося. “CEL” – наличие отсеквенированного продукта у марала. “MGO” – наличие отсеквенированного продукта у мазама. “Пр.1, Пр.2, Пр.3, Пр.4” – ссылки на последовательности экзонов генов FPGT и TNNI3K в примечании 1, 2, 3 и 4 этого текста. “JN8712..” – ссылки на последовательность четвертого экзона гена FPGT и последовательность промоторной области гена TNNI3K в генном банке.

Название Участок Длина CCA CCA CPY CPY B AAL CEL MGO фрагмента фрагмент, 1 2 (0B) (8B) п.н.

Первый экзон 1 84 + + + + + + + Пр.1 Пр.1 Пр.1 Пр.1 Пр.1 Пр.1 Пр. FPGT Второй экзон 2 168 + + + + + + Пр.2 Пр.2 Пр.2 Пр.2 Пр.2 Пр. FPGT Третий экзон 3 93 + + + + + + + Пр.3 Пр.3 Пр.3 Пр.3 Пр.3 Пр.3 Пр. FPGT Четвертый 4 1443 + + + экзон JN87 JN87 JN FPGT 1288 1287 Промоторная PT4 234 + + + + + область гена JN87 JN87 JN87 JN87 JN TNNI3K 1289 1290 1291 1293 Первый экзон T4 111 + + + Пр.4 Пр.4 Пр. TNNI3K Таким образом, нам удалось получить полную нуклеотидную последовательность целого гена FPGT (примечание 1, 2, 3;

JN871286 JN871288), представленного на добавочных хромосомах сибирской косули, а также промоторную область и первый экзон гена TNNI3K (JN871289 JN871293;

примечание 4), частично представленного на В-хромосомах.

Таблица 8. Список праймеров, используемых для секвенирования генов TNNI3K и FPGT.

№ Название Последовательность праймеров, координаты Размер праймеров 5’ – 3’ хромосомы 3 фраг коровы мента п.н.

(Btau_4.6.1) 1 40F TGAGATTCCAAATGTCTAAGCATGAC 74775862- 40R ACCTCGAATACAGAAGTTGCCATC 2 FPGT1F ATGTCTCTAAATCAGACTGCTTCCTA 74775586- FPGT1R CCATCGATACCAGAATGCTCTACT 3 FPGT2F GGTCTACACACAGCATCAAACTCATAC 74776647- FPGT2R ATGTGTCATAGCCTGTAAAGCATATTTAG 4 FPGT3F ACTCCTGCATTTGTGATCTTGCT 74775394- FPGT3R GGGTCTGTTTCCTGTCATGCTT 5 T3F GCCTGTACCTTTGCTCTCTGC 74779024- T3R AATGTCCCTGAGATATCAAGGG 6 T2F GGTAAAACCTGTAACAGCTAGAG 74780426- T2R AGGTGGAAACATACATAGTCCC 7 T1F GCCAATGTCCTAGGTCCGCA 74782110- T1R AGAGCTTCGGGGGCGTGG 8 PT4F CAGTACAAGTTTGCGTTGGTCTG 74730098- PT4R TTCCTTTCATGATTTCACCCTTG 9 T4F GTGATGCAAACAGGCAAGGC 74729166- T4R TCACTTGTATGTTATGAGCTGTGTCTAC 3.5.1 Сравнение первого экзона гена FPGT в ряду млекопитающих Мы отсеквенировали копии первого экзона гена FPGT на геномной ДНК сибирской косули с 8 В-хромосомами, сибирской косули без В хромосом, у двух особей европейской косули, у марала и мазама.

При сравнении аминокислотных последовательностей, кодируемых генами, мы обнаружили одну замену, специфичную только для мазама (аргинин13 на глутамин13), причем аргинин встречается у всего ряда рассмотренных млекопитающих вплоть до опоссума (Рис.11). Также была обнаружена одна замена, специфичная только для марала (пролин7 на лейцин7), относительно большинства рассмотренных млекопитающих (Рис.11). Кроме того, при сравнении нуклеотидных последовательностей в 22 позиции в двух различных образцах ДНК европейской косули нами была обнаружена несинонимичная замена (GT), приводящая к замене на уровне аминокислотной последовательности аланина8 на серин8 у европейской косули относительно рассмотренного ряда позвоночных.

Однако секвенирование клонированных фрагментов первого экзона гена FPGT европейской косули показало отсутствие замены в данной позиции, что является подтверждением наличия SNP. Также была обнаружена одна замена, специфичная для оленьих (аланин6 на аргинин6) и одна видоспецифичная замена у сибирской и европейской косули (глутаминовая кислота2 на аспарагиновую кислоту2) (Рис.11).

Особого внимания заслуживает рассмотрение первой позиции данного экзона. На уровне нуклеотидной последовательности на В хромосомах и у трех особей сибирской косули с разным числом добавочных хромосом относительно сибирской косули без В-хромосом, марала, мазама, коровы и других видов рассматриваемых позвоночных имеет место замена (AG), которая приводит к замене аминокислоты метионин1 на валин (Рис.10, таблица 9). Однако у европейской косули в этой позиции наблюдаются смешанные пики гуанина и аденина. Дополнительное секвенирование клонированных фрагментов первого экзона гена FPGT сибирской косули с В-хромосомами выявило присутствие в первой позиции аминокислотной последовательности только валина, тогда как у клонированных фрагментов первого экзона гена FPGT европейской косули был обнаружен метионин. Кроме того, при анализе клонов сибирской косули с добавочными хромосомами мы обнаружили замену в аминокислотной последовательности, относительно всего ряда рассматриваемых позвоночных (серин5 на аспарагин5) (Рис.11).

Поскольку у европейской косули по первой позиции первого экзона гена FPGT был обнаружен полиморфизм, мы не будем считать замену в этом экзоне В-хромосом-специфичной.

Рисунок 10. Схема, отражающая полиморфизм по первой позиции первого экзона гена, FPGT у марала (CEL), сибирской косули без В-хромосом (CPY (0B)), у европейской косули (CCA), у сибирской косули с 4 В-хромосомами (CPY (4B)) и на В-хромосомах.

Таблица 9. Полиморфизмы, в первом экзоне гена FPGT, обнаруженные на В хромосомах, у сибирской косули с 8 В-хромосомами, у сибирской косули без В хромосом, у европейской косули, у марала, мазама и коровы.

позиция B CPY(8В) CPY(0B) CCA CCA Cel MGO BTA 1 G G A G/A A/G A A A 12 A A A A/G A/G A A A MEAESAPAGESLREATQRRLLRFSELRG Bos taurus _AGESLREATQRRLRRFSELRG КДНК VDAESRPAGESLREATQRRLRRFSELRG Capreolus pygargus (8B) VDAESRPAGESLREATQRRLRRFSELRG В-хромосомы VDAESRPSGESLREATQRRLRRFSELRG Capreolus capreolus MDAESRPSGESLREATQRRLRRFSELRG Сapreolus capreolus VDAESRPSGESLREATQRRLRRFSELRG Capreolus capreolus MDAESRPAGESLREATQRRLRRFSELRG Capreolus capreolus MDAESRPAGESLREATQRRLRRFSELRG Capreolus pygargus (0B) VDAESRPAGESLREATQRRLRRFSELRG Capreolus pygargus (4B) VDAENRPAGESLREATQRRLRRFSELRG Capreolus pygargus (4B) MEAESRLAGESLREATQRRLRRFSELRG Cervus elaphus MEAESRPAGESLQEATQRRLRRFSELRG Mazama gouazoubira MAATSTPPSVCLREATQRRLQRFSELRG Vicugna pacos MAAASVAPGVALREATQRRLQRFSELRG Equus ferus caballus MAAARDPPEVSLREATQRKLRRFSELRG Homo sapiens MAAARDPPEVSLREATQRKLRRFSELRG Pan troglodytes MAAARDPPEVSLREATQRKLLKFSELRG Callithrix jacchus MAAARAPPDVALRESTQRKLRKFSELRG Loxodonta africana MAAAGAGAGAALREAAQRKLRRFSELRG Canis lupus familiaris MAAPVAPGVVALREATQRKLRRFSELRG Ailuropoda melanoleuca -VCSRKSAMASLREATLRKLRRFSELRG Mus musculus -VGSRKSAMETLREATLRKLRRFSELRG Rattus norvegicus MAAARVRFNESLREATQRKLQKFSELRG Cavia porcellus MEAARVFSDASLREATERKLRRFSKLRG Oryctolagus cuniculus MAAAETGPDVALREATQRKLRKFERLRG Didelphis virginiana Рисунок 11. Сравнение аминокислотных последовательностей первого экзона гена FPGT, у представителей семейства оленьих и других млекопитающих. Черным цветом отмечены значимые замены, описанные в тексте. Серым цветом отмечены замены, встречающиеся у других видов животных относительно замен, рассматриваемых нами.

3.5.2 Сравнение второго экзона гена FPGT в ряду млекопитающих Мы отсеквенировали копии второго экзона гена FPGT у европейской косули, у сибирской косули без В-хромосом, у марала, лося и мазама.

Частично были отсеквенированы копии этого экзона на DОР-библиотеке В хромосом (глава 3.4.2) и на геномной ДНК сибирской косули с 8 В хромосомами. Была обнаружена одна замена, встречающаяся только у мазама (глутамин92 на лизин92) (Рис.13). Также была найдена замена, общая для мазама и лося (аспарагиновая кислота47 на аспарагин47) (Рис.13). В результате секвенирования были выявлены различия в аминокислотной последовательности копий второго экзона в В-хромосом специфичной кДНК, на В-хромосомах и у сибирской косули с В хромосомами относительно других рассматриваемых видов (лизин83 на аргинин83) (Рис.13). Интересным является то, что в данной позиции у сибирской косули с добавочными хромосомами на уровне нуклеотидной последовательности встречается полиморфизм: пик, соответствующий гуанину в четыре-пять раз выше пика, соответствующего аденину (Рис.12, таблица 10). На В-хромосомах и в В-хромосом-специфичной кДНК в данной позиции присутствует только гуанин, у других рассматриваемых видов – аденин (Рис.12, таблица 10). Таким образом, мы сделали вывод о специфичности данной замены для В-хромосом. Нужно отметить, что данная позиция очень консервативна у всего ряда рассмотренных организмов, в том числе у опоссума, утконоса, курицы и каролинского анолиса. У всех этих оганизмов в данном участке геномов кодируется лизин, тогда как в В-хромосом-специфичной кДНК – аргинин.



Pages:     | 1 || 3 |
 





 
© 2013 www.libed.ru - «Бесплатная библиотека научно-практических конференций»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.