авторефераты диссертаций БЕСПЛАТНАЯ БИБЛИОТЕКА РОССИИ

КОНФЕРЕНЦИИ, КНИГИ, ПОСОБИЯ, НАУЧНЫЕ ИЗДАНИЯ

<< ГЛАВНАЯ
АГРОИНЖЕНЕРИЯ
АСТРОНОМИЯ
БЕЗОПАСНОСТЬ
БИОЛОГИЯ
ЗЕМЛЯ
ИНФОРМАТИКА
ИСКУССТВОВЕДЕНИЕ
ИСТОРИЯ
КУЛЬТУРОЛОГИЯ
МАШИНОСТРОЕНИЕ
МЕДИЦИНА
МЕТАЛЛУРГИЯ
МЕХАНИКА
ПЕДАГОГИКА
ПОЛИТИКА
ПРИБОРОСТРОЕНИЕ
ПРОДОВОЛЬСТВИЕ
ПСИХОЛОГИЯ
РАДИОТЕХНИКА
СЕЛЬСКОЕ ХОЗЯЙСТВО
СОЦИОЛОГИЯ
СТРОИТЕЛЬСТВО
ТЕХНИЧЕСКИЕ НАУКИ
ТРАНСПОРТ
ФАРМАЦЕВТИКА
ФИЗИКА
ФИЗИОЛОГИЯ
ФИЛОЛОГИЯ
ФИЛОСОФИЯ
ХИМИЯ
ЭКОНОМИКА
ЭЛЕКТРОТЕХНИКА
ЭНЕРГЕТИКА
ЮРИСПРУДЕНЦИЯ
ЯЗЫКОЗНАНИЕ
РАЗНОЕ
КОНТАКТЫ


Pages:     | 1 || 3 | 4 |   ...   | 6 |

«1 Федеральное государственное бюджетное образовательное учреждение высшего профессионального образования «Московский государственный университет имени М.В. ...»

-- [ Страница 2 ] --

Ченг с соавторами исследовали также эффективность использования различных алгоритмов, отражающих соотношение мощностей ритмов ЭЭГ, для определения состояния утомления. В своем исследовании они использовали 3 индекса: тета/альфа, бета/альфа, (альфа+тета)/бета. В ходе эксперимента было показано, что лучшие результаты по детекции утомления были получены с помощью индекса (альфа+тета)/бета (Cheng, 2011). Джап с соавторами также исследовали различные алгоритмы вычисления индекса утомления: ((тета+альфа)/бета, альфа/бета, (альфа+тета)/(альфа+бета), тета/бета) (Jap, 2009). Они, также как и Ченг, показали, что алгоритм (тета+альфа)/бета имеет наибольшее увеличение после длительной когнитивной нагрузки и является наиболее чувствительным к изменениям функционального состояния по сравнению с остальными. Джап показал, что данный индекс наиболее сильно увеличивается в центральных, теменных и височных областях при закрытых глазах и в теменных и височных областях при открытых глазах. Также Джап показал увеличение дельта и тета активности во фронтальных, центральных и теменных регионах (Jap, 2009).

Альфа ритм хорошо видно в состоянии физического и умственного расслабления (Golojahani, 2012). На ЭЭГ в спокойном состоянии обычно хорошо видно отдельный пик на частоте альфа ритма (8-14 Hz). Данный параметр имеет высокую интраиндивидуальную стабильность (Fernandes, 1993;

Binni, 2003), а также достаточно сильную вариацию между отдельными людьми и изменчивость с возрастом (Klimesh, 1999). В исследовании Питерсона было показано, что у взрослого человека среднее значение индивидуального альфа пика составляет 10.2+/-0.9 Гц (Peterson, 1971). В целом ряде исследований было показано, что альфа пик характеризуется увеличением с детства до пубертата (Epstein, 1980). У взрослых людей, наоборот, альфа пик характеризуется уменьшением с возрастом - с 20 до лет его частота уменьшается в среднем с 10,89 Гц до 8,24 Гц (Klimesh, 1997).

Существуют различные способы вычисления индивидуального альфа пика.

Одним из основных способов является определение частоты, на которой возникает альфа пик (индивидуальный альфа пик). Другим, также часто используемым, способом является нахождение средневзвешенного центра альфа ритма (индивидуальная частота альфа ритма) (Klimesh 1999;

Angealakis, 2004). Для этого способа для каждого шага частоты в диапазоне альфа ритма (8-14 Гц) подсчитывается максимальное значение мощности, после чего высчитывается средневзвешенное значение мощности в альфа диапазоне и определяется частота альфа ритма, на которой наблюдается эта мощность (Klimesh, 1999). Первый способ определения пика альфа ритма является исторически более ранним и состоит в определении частоты, на которой наблюдается максимальная мощность альфа ритма (Galjahani, 2012).

Но данный метод достаточно плохо работает в тех случаях, когда на ЭЭГ наблюдается не один, а несколько пиков альфа ритма. В таких случаях обычно используется метод определения средневзвешенного пика.

Различные исследования показывают, что пик альфа ритма положительно коррелирует с успешностью выполнения когнитивных функций таких, как внимание, память, скоростью протекания информационных процессов (Klimesh, 1999;

Angealakis, 2004). Частота индивидуального альфа ритма возрастает больше в правом полушарии при выполнении зрительных заданий и больше в левом при выполнении арифметических заданий (Angealakis, 2004). Климеш показал, что испытуемые со сниженными мнестическими способностями характеризуются снижением пика альфа ритма во время выполнения заданий на память, а испытуемые с высокими мнестическими способностями характеризуются стабильностью пика альфа ритма в различных условиях (Klimesh, 1993).

Также Климеш показал, что испытуемые с высокими мнестическими способностями и высокой скоростью обработки информации характеризуются частотой альфа пика в среднем на 1 Гц большей по сравнению с контрольной группой (Klimesh 1996, 1997). Различные исследования показали, что целый ряд психических заболеваний также связан со снижением частоты индивидуального альфа пика – болезнь Альцгеймера, шизофрения, синдром хронического усталости, полушарный инсульт (Angealakis, 2004).

Б) Молекулярно-генетические корреляты утомления.

Многочисленные исследования (Newsholme, 1992, 1995;

Davis, 1995, 1997, 2000;

Salamone et al, 1999, 2010a, 2010b;

Blomstrand, 2001;

Nieoullon, 2002;

Narita et al, 2003;

Lorist et al, 2005;

Fernstrom, 2006;

Meeusen R, 2007;

Gosso, 2008;

Foley et al., 2008;

Sysoeva et al., 2009;

Bolton, 2010;

Barnes, 2011) показывают также связь между утомлением и уровнем концентрации определенных нейромедиаторов, преимущественно с дофамином и серотонином. Определенный уровень концентрации дофамина и серотонина зависит от наличия тех или иных полиморфизмов, связанных с транспортировкой, удалением этих нейромедиаторов, а также с плотностью рецепторов для них. Меузен показал, что высокая концентрация серотонина ведет к увеличению скорости развития утомления из-за того, что серотонин играет важную роль в процассе сна (Meeusen R, 2007). Повышение же концентрации дофамина и норадреналина ведет к увеличению мотивации и возбуждения (Salamone et al, 1999, 2010a).

Связь серотонина с утомлением. Серотонин (5-НТ или 5 hydroxytryptamine) играет важную роль в регуляции эмоционального поведения (Lesch, 2000;

Adayev, 2005) и эмоционального статуса человека (Stein, 2000;

Balaban, 2002). Серотонинергическая система является одной из важнейших мишеней для лечения таких психических расстройств, как депрессия, тревожность, панические атаки, обсессивно-компульсивный синдром (Tamminga, 2002).

Серотонинергические нейроны широко распространены в центральной нервной системе, преимущественно они локализованы в ядрах ствола мозга – в ядрах шва (Николс, 2003). Ядра шва, расположенные в области среднего мозга и моста, иннервируют почти весь мозг и вместе с проекциями из голубого пятна образуют часть восходящей активирующей ретикулярной системы. Серотонинергические нейроны иннервируют обширные области мозга, включающие кору больших полушарий, гиппокамп, бледный шар, миндалину, область гипоталамуса (рисунок 1). Отличительной чертой распределения в ЦНС серотонина является то, что его высвобождает лишь небольшое количество нейронов. Однако они настолько сильно разветвляются, что каждый нейрон посылает тысячи отростков по всей ЦНС.

Такая морфология сочетается с физиологической ролью серотонинсодержащих нейронов в модулировании синаптической активности в различных областях ЦНС, в результате чего они регулируют такие глобальные функции, как внимание, пробуждение, цикл сон-бодрствование и настроение (Зинченко и др., 2011;

Николс, 2003).

Рисунок 1. Серотонинергические пути в мозге человека (Николлс и др., 2008) Транспортер серотонина (5-HTT) и его связь с утомлением. В настоящее время в литературе существует множество работ, посвященных исследованию гена серотонинового транспортера (5-НТТ) (Retz, 2004;

Sander, 1998). Переносчик серотонина (5-HT transporter gene, 5-НТТ) состоит из аминокислот (Dennis, 2004) и играет важную роль в трансмиссии серотонина в головном мозге, а также во многих периферических тканях. Он удаляет серотонин из синаптической щели и определяет величину и продолжительность сигнала на постсинаптической мембране. После выброса серотонина в синапс, транспортер перемещает его в пресинаптический нейрон, где он возвращается в нейромедиаторный пул.

Одним из наиболее изученных полиморфизмов является 5HTTLPR (5 HTT gene-linked polymorphic region). Под генетическим полиморфизмом понимается участок гена, для которого в популяции существует более одного варианта нуклеотидной последовательности. Наиболее часто встречаются однонуклеотидные полиморфизмы (SNP от single nucleotide polymorphism) – замена одного нуклеотида на другой в конкретной точке генома.

В полиморфизме 5HTTLPR обычно выделяют два аллеля – короткий «S» и длинный «L». Короткие и длинные аллели 5-HTTLPR по-разному влияют на транспортер серотонина, они приводят к различиям в мРНК, плотности белка и активности серотонина в головном мозге. При коротком аллеле (S) транспортер серотонина в меньшей степени представлен на пресинаптической мембране, чем при длинном (L). При наличии одной или двух S аллелей транскрипция 5-HTT снижается на 60-70% в головном мозге и на 30-40% в лимфобластах по сравнению с гомозиготой по L аллели (Зинченко и др., 2011).

Ряд авторов в свою очередь связывают скорость развития утомления с наличием определенных полиморфизмов гена 5НТТ. В частности было показано, что наличие полиморфизма S в гене 5НТТ ведет к более быстрому развитию утомления, по сравнению с LL полиморфизмом (Davis, 1995;

Weicker, 2001;

Meeusen, 2007).

Викер исследовал, как пароксетин (селективный ингибитор обратного захвата серотонина) влияет на выносливость атлетов, выполняющих тест на велоэргометре до отказа на средней интенсивности. Викер показал, что при приеме пароксетина время до наступления истощения на велоэргометре сокращается и ухудшаются показатели эффективности когнитивной деятельности после теста по сравнению с плацебо или без приема пароксетина В отличие результатов Викера, Барнетт (Weicker, 2001).

показал, что 5НТТ не имеет значимого влияния на префронтальные когнитивные функции (Barnett, 2011).

Также было показано, что у пациентов с синдромом хронической усталости, по сравнению с нормой, значимо чаще встречаются длинный аллель L в гене 5НТТ (Narita et al., 2003). LL полиморфизм сопряжен с более активным транспортом серотонина из синаптической щели, по сравнению с SS- и SL-носителями (Зинченко и др., 2011).

Связь дофамина с утомлением. Многие ученые сходятся в том, что дофаминергическая система играет важную роль в формировании когнитивной сферы человека. На рисунке 2 представлены основные дофаминергические пути в мозге.

В настоящее время появляется все больше работ, посвященных исследованию генетических основ поведения, важную роль в котором играет дофаминергическая система мозга. Перспективными кандидатами для изучения генетической природы поведения являются гены, кодирующие ключевые белки, участвующие в передаче дофаминергического сигнала, синтезе дофамина, его высвобождения в синаптическую щель. Прекращение воздействия дофамина на постсинаптический нейрон осуществляется путем обратного захвата медиатора белками-переносчиками (DAT) или путем разрушения в межклеточном пространстве ферментами (СОМТ, МАО).

Исследования последних лет показали, что в мозге млекопитающих обнаружено несколько типов дофаминергических рецепторов. Основными типами дофаминовых рецепторов являются Д1- и Д2-рецепторы. Недавно были открыты также рецепторы ДЗ, Д4 и Д5. Рецепторы дофамина локализованы как на пре-, так и на постсинаптической мембране.

Предполагается, что пресинаптические ауторецепторы, принадлежащие к Д и Д3 подтипу, могут находиться на соме, дендритах и нервных терминалях.

Они принимают участие в регуляции процессов синтеза и высвобождения дофамина во внеклеточное пространство. Для постсинаптических (Д1, Д4, Д5) рецепторов характерна локализация не только в области синаптического контакта, но и в значительном удалении от нее, что говорит о возможном действии медиатора вне синаптических терминалий.

Рецептор дофамина второго типа (DRD2, Д2-рецептор). Как уже было отмечено, дофаминовый рецептор второго типа относится к ауторецепторам, принимающим участие в регуляции процессов синтеза и высвобождения дофамина во внеклеточное пространство.

Стимуляция Д2-рецепторов приводит к торможению передачи нервного импульса в симпатических ганглиях, снижению выделения дофамина и норадреналина из симпатических окончаний. Д2-рецептор ингибирует аденилатциклазу и Ca-канал, но активирует K-канал. Д2-подобные рецепторы преобладают в стриатуме — хвостатом ядре и скорлупе, но имеются также в поясной извилине и коре островка (Joyce, 1986).

Одним из наиболее хорошо изученных полиморфизмов гена DRD является полиморфизм TaqI A. Он определяет плотность рецепторов дофамина второго типа в синаптической щели. У носителей аллеля А наблюдается 30-40% уменьшения плотности этих рецепторов, по сравнению с плотностью рецепторов у носителей генотипа А2А2. Аллель А встречается в популяции россиян с частотой 0.172, а аллель А2 – 0.828 (Kidd, 1998).

В нескольких работах было показано, что аллель A1 ассоциирован со снижением уровня дофамина в ЦНС. Также известно, что наличие аллеля A ведет к снижению сродства рецепторов к дофамину (Ritchie, 2003) и к уменьшению плотности дофаминовых рецепторов второго типа в стриатуме (Thompson, 1997). Считается, что стриатум является структурой принятия решения на уровне поведенческих реакций и одним из отделов головного мозга, отвечающих за регуляцию адаптивного поведения.

Рецептор Д2 был исследован на предмет ассоциации с чертами характера. Цай и соавторы обнаружили ассоциацию аллеля А1 с высоким уровнем интеллекта у женщин (Tsai, 2002). Исследования зависимости полиморфизма TaqIA от такой черты поведения, как креативность, показали, что носители аллеля А1 обладают повышенном уровнем индекса вербальной и общей креативности (Reuter, 2006). Блум и соавторы обнаружили ассоциацию аллеля А1 полиморфизма Taq1 с шизоидным или избегающим поведением (Blum, 1997). Посредством TPQ опросника было показано, что у носителей аллеля А1 наблюдаются повышенные показатели по шкале поиска новизны (Kaasinen, 2004).

Катехол-О-метилтрансфераза (СОМТ) и утомление. Два фермента отвечают за катаболизм катехоламинов в мозге: катехол-О-метилтрансфераза (СОМТ) и моноаминоксидаза (МАО). Фермент катехол-О-метилтрансфераза отвечает за разрушение в организме таких нейромедиаторов, как дофамин и норадреналин. Чем активнее работает данный фермент, тем быстрее разлагаются эти нейромедиаторы и тем меньше их количество в мозге и организме в целом.

СОМТ является ключевым ферментом в деградации дофамина в префронтальной коре головного мозга человека. СОМТ деградирует около 15% дофамина в стриатуме и прилежащих ядрах и более 60% во фронтальной коре (Karoum, 1994).

В последние годы было опубликовано несколько исследований, в которых показана связь СОМТ и таких психологических характеристик, как тревожность, экстраверсия, беспокойство, избегание ущерба, поиск новизны, агрессивность.

Учеными было обнаружено, что оптимальное количество дофамина положительно сказывается на рабочей памяти, а слишком малое или избыточное количество дофамина нарушает когнитивные способности. Было установлено, что для регулировки такого оптимального баланса дофамина задействована внутриклеточная сигнальная молекула – циклический аденозинмонофосфат (сАМР). Также известно, что один из основных дофаминовых путей находится в префронтальной коре, таким образом, наблюдается зависимость когнитивных способностей от содержания дофамина в данной области мозга. Базовое количество дофамина в префронтальной коре связано с вариациями гена СОМТ, кодирующего фермент катехол-О-метилтрансферазу.

Одним из наиболее хорошо изученных полиморфизмов гена СОМТ является Val158Met. У носителей аллеля М наблюдается снижение активности фермента на 40% (Chen, 2004). Гетерозигота имеет средний уровень активности. Частота встречаемости аллеля M варьирует в различных популяциях от 0.01 до 0.62, а для популяции русских приблизительно равна 0.5 (Palmatier, 1999).

Полиморфизм Val158Met COMT широко изучен на предмет ассоциации с агрессивным поведением. Было проведено небольшое исследование социально опасного поведения пациентов, страдающих шизофренией.

Результаты свидетельствуют о проявлении повышенной агрессивности у носителей мутантного М-аллеля (Strous, 1997). Ассоциация M-аллеля с агрессивностью была подтверждена другим исследованием пациентов с диагнозом – шизофрения или шизоидные расстройства, в котором больных, совершивших множественные нападения, сравнивали с мирными пациентами 1998). Вышеописанные данные проведены на пациентах, (Lachman, страдающих шизоидными расстройствами, что осложняет проекцию выводов на здоровых людей. В исследовании Куликовой и соавторов (Куликова, 2008) были подтверждены данные Джонса и соавторов (Jones, 2001), обнаруживших, что повышенная физическая агрессия, направленная на окружающих, ассоциирована с генотипом VV. Также ранее в исследовании Рейтера и Хеннига (Reuter, 2006) было обнаружено, что носители VV обладают более высокими уровнем экстраверсии, чем носители M аллеля.

Соломон показал, что дофамин в прилежащем ядре участвует в энергетических затратах поведенческой активации и поддержании высоких темпов работы, таким образом отвечая за функции, которые отражают область перекрытия двигательных и мотивационных процессов (Salamone et al., 1999). Лорист и Буксем также показали, что испытуемые с недостатком дофамина в передней поясной извилине и полосатом теле испытывают более сильное умственное утомление после двух часовой непрерывной когнитивной нагрузки, чем испытуемые с нормальным уровнем дофамина (Lorist et al., 2005).

Рисунок 2. Дофаминергические пути в мозге человека (Николлс и др., 2008) 1.4. Выводы из литературного обзора Из представленного литературного обзора мы можем сделать несколько выводов, касающихся современного состояния научных исследований по утомлению, а также еще нерешенных задач в данной области. Из представленной картины мы видим, что в настоящее время данная проблема является весьма актуальной и требующей использования хорошего методологического аппарата, включающего в себя комплексную оценку данного состояния. Мы видим, что общее направление исследования утомления движется в сторону использования комплексного подхода, учитывающего разноуровневые показатели: субъективные, поведенческие, электрофизиологические, генетические. Однако в настоящее время еще не существует работ, учитывающих все эти уровни. В нашей работе впервые делается попытка обширного исследования утомления, включающего все перечисленные уровни. В настоящее время проведено достаточно большое количество экспериментов и накоплен значительный материал в области психологии и психофизиологии утомления, биохимии утомления и др.

Также одной из проблем, существующих в области исследования утомления, как мы видим из литературного обзора, является неоднозначность и разнонаправленность некоторых электрофизиологических показателей, к примеру, динамики альфа, бета и тета ритмов. Как правило, это связано с тем, что различные исследователи используют различные схемы экспериментов, которые не всегда приводят к развитию состояний утомления, так как пороги его развития у каждого человека индивидуальны и зависят от различных факторов. В соответствии с чем, в нашем исследовании мы попытались сделать схему и длительность эксперимента, наиболее подходящие для диагностики состояний утомления. В нашем исследовании мы пытаемся решить эту проблему, во-первых, за счет длительности эксперимента. Общая длительность одного эксперимента в нашем исследовании составила около четырех часов. Показано, что одни люди могут долго не утомляться при выполнении когнитивных заданий, другие же – утомляются почти сразу. Но в течение длительного выполнения заданий процессы утомления, в большей или меньшей степени, начинают проявляться у всех испытуемых. Во-вторых, мы используем в исследовании различные методы подсчета и анализа данных ЭЭГ, а также разные методы статистической обработки, за счет чего достигается достаточно высокая достоверность полученных данных. Это позволяет сравнить наши данные с уже полученными и описанными ранее в литературе, а также выявить наиболее информативные из них.

Немаловажным преимуществом нашей работы является учет результатов генетического анализа, который в сочетании с психологическими и психофизиологическими параметрами помогает выявить наиболее объективные параметры утомления у носителей различных полиморфизмов генов 5НТТ, DRD2 и СОМТ. Таким образом, наше исследование направлено на комплексное и обширное исследование динамики процессов утомления при длительном выполнении когнитивной деятельности, а также отбор наиболее объективных и информативных из них.

ГЛАВА 2. МЕТОДИКА ИССЛЕДОВАНИЯ 2.1. Испытуемые и схема исследования В экспериментальном исследовании приняли участие 44 испытуемых мужского пола без каких-либо психических и неврологических заболеваний.

Все испытуемые были правшами. Средний возраст составил 24 6 лет.

Схема эксперимента состояла из трех блоков (рисунок 3). Первый и последний блоки были идентичными и включали в себя заполнение опросника САН (самочувствие, активность, настроение), запись ЭЭГ и выполнение заданий на время реакции (простую зрительно-моторную реакцию, реакцию выбора, теппинг-тест). Второй блок состоял из комплекса когнитивных заданий, направленных в основном на внимание и рабочую память. На этапе анализа данных проводилось статистическое сравнение результатов первого и последнего блоков, то есть проводился анализ влияния когнитивной нагрузки на психологические, электрофизиологические и поведенческие показатели. Общая длительность эксперимента составляла около 4 часов без предоставления испытуемому отдыха.

Рисунок 3. Схема эксперимента (*ПЗМР – простая зрительно моторная реакция;

**РВ – реакция выбора) Выбор данных методик обосновывается целями и задачами исследования. Утомление, как комплексное явление, отражается на всех системах организма и проявляется на психологических и на физиологических параметрах. Выбранные методики позволяют оценить и динамику субъективных ощущений человека;

параметры его поведенческих реакций, отражающие как моторные, так и когнитивные компоненты, и их изменения при утомлении;

а также динамику электрофизиологических показателей, служащих хорошими индикаторами функционального состояния человека.

Таким образом, использование данных методов и методик позволит комплексно изучить влияние утомления на человека.

2.2. Экспериментальные задания и стимульный материал.

В экспериментальном исследовании для анализа поведенческих реакций использовалось два типа заданий на время реакции (рисунок 4): 1) простая зрительно-моторная реакция (ПЗМР) и 2) реакция выбора (РВ). При выполнении данных заданий испытуемому требовалось, как можно быстрее реагировать на появление определенных крестиков в центре экрана.

В заданиях с ПЗМР от испытуемого требовалось как можно быстрее нажимать на «кнопку 1» при появлении красного крестика в центре экрана. В серии с РВ испытуемый должен был, при появлении красного крестика в центре экрана, нажимать также на «кнопку 1», а при предъявлении зеленого крестика - «кнопку 2».

ПЗМР, простая зрительно-моторная реакция РВ, реакция выбора Рисунок 4. Экспериментальные задания.

Для анализа поведенческих реакций в данном исследовании, помимо заданий на время реакции, также использовалось 2 типа теппинг-тестов: 1) комфортный теппинг-тест, 2) максимальный теппинг-тест.

При выполнении заданий с комфортным теппингом испытуемые должны были нажимать кнопку «Пробел» в любом удобном для них темпе. В заданиях с максимальным теппингом испытуемые должны были нажимать на кнопку «Пробел» с максимально возможной скоростью.

Испытуемые также заполняли компьютерный вариант теста САН (самочувствие, активность, настроение).

Стимульный материал. Для предъявления стимульного материала использовалась программа E-prime (версия 1.2). Стимулы предъявлялись на мониторе фирмы Dell с разрешением экрана 12801024 пикселей. Все стимулы предъявлялись на черном фоне. Фиксационная точка находилась в центре экрана в виде белого крестика (Courier New, размер 18).

Простая зрительно-моторная реакция (ПЗМР) и реакция выбора (РВ). Для ПЗМР и РВ заданий длительность фиксационной точки и стимула находилась в промежутке между 500-1500 мс. В ПЗМР стимулом служил красный крестик в центре экрана (Courier New, размер 72). В РВ стимулом был красный крестик (Courier New, размер 72) и зеленый крестик (Courier New, размер 72), которые предъявлялись в случайной последовательности. В обоих заданиях перед выполнением основной серии, испытуемые выполняли тренировочную серию из 10 стимулов. Основная серия же состояла из стимулов. При анализе данных учитывались стимулы только из основной серии.

Теппинг-тесты. В серии с комфортным теппингом испытуемый нажимал кнопку «Пробел» 90 раз. После 90 нажатий выполнение задания автоматически останавливалось. В максимальном теппинге испытуемые нажимали на кнопку «Пробел» в течение 60 секунд. Через 60 секунд выполнение задачи автоматически останавливалось.

2.3. Процедура эксперимента.

Перед выполнением экспериментальных заданий и записью ЭЭГ, испытуемые заполняли психологические опросники. После этого начиналась запись ЭЭГ и выполнение экспериментальных заданий. Вначале проводилась фоновая запись ЭЭГ – одна минута с закрытыми глазами и одна минута с открытыми. После чего испытуемые выполняли блок различных когнитивных заданий в течение 2,5 часов, направленных преимущественно на внимание и рабочую память. После этого испытуемые выполняли такой же блок заданий, как и в начале эксперимента: методика САН, запись фоновой ЭЭГ, задания на время реакции и теппинг-тесты.

Запись ЭЭГ проводилась с помощью 256-канального энцефалографа фирмы EGI Electrical Geodesics с частотой оцифровки 500 Гц и референтом в вертексе. Фоновая ЭЭГ состояла из двух периодов записи – 1 минуты с закрытыми глазами и 1 минуты с открытыми глазами. После записи ЭЭГ проводился ремонтаж и фильтрация в полосе от 1 до 150 Гц и удалением Гц наводки от сети. Каждая запись ЭЭГ была автоматически просканирована на наличие артефактов. Участки ЭЭГ с амплитудой более 200 мкВ в пределах окна в 640 мс отмечались, как плохой канал;

участки с амплитудой более мкВ рассматривались как двигательный артефакт (Net Station software).

2.4. Анализ данных Для статистического анализа данных использовались пакет Statistica (для Windows, V 8.0, StatSoft), а также пакет MatLab (версия R2007b).

Психологические и поведенческие тесты. Для различных экспериментальных заданий (ПЗМР, РВ, теппинг-тесты) и психологического опросника САН были посчитаны средние значения и стандартные отклонения. Для реакции выбора также было посчитано количество ошибок.

Статистические методы ANOVA и Т-тест для зависимых выборок были использованы для анализа влияния длительной когнитивной нагрузки на время реакции и субъективное состояние.

Рисунок 5. Области мозга для спектрального анализа ЭЭГ.

Анализ данных ЭЭГ. Для анализа ЭЭГ использовались отрезки фоновой ЭЭГ длительностью по 20 секунд с наименьшим содержанием артефактов в состояниях с закрытыми и открытыми глазами. На основе данных ЭЭГ были рассчитаны следующие показатели: спектр мощности, частота индивидуального альфа ритма (ИАР), индекс утомления (ИУ) и фронтальная асимметрия (ФА).

Индивидуальный альфа ритм рассчитывался как частота, на которой наблюдается максимальная мощность альфа ритма в диапазоне от 7 до 14 Гц.

Подсчет индивидуального альфа ритма проводился с помощью программы MatLab, используемый скрипт приведен в приложении (Приложение 1).

Спектр мощности ЭЭГ рассчитывался для следующих диапазонов: тета ритм (3,5-7,5 Гц), нижний альфа (7,5-10 Гц), верхний альфа (10-12,5 Гц), альфа (7,5-12,5 Гц), нижний бета (12,5-18 Гц), верхний бета (18-35 Гц), бета (12,5-35 Гц), гамма (35-45 Гц). Данные ЭЭГ были усреднены по пяти отдельным областям: фронтальной, центральной, височной, теменной и затылочной для обоих полушарий (рисунок 5).

Индекс утомления был рассчитан как отношение суммы мощностей медленных ритмов (альфа и тета ритмов) к мощности быстрого ритма (бета):

ИУ = (альфа + тета) / (бета)) (Jap et al, 2009, Cheng, 2011) Фронтальная асимметрия. Коэффициент фронтальной асимметрии рассчитывался как разность логарифмов сумм мощностей в отведениях F3, F и сумм мощностей в отведениях F4, F8:

ФА = log(sqrt(a)) –log (sqrt (b)) 2.5. Методики генотипирования 2.5.1. Методика генотипирования 5HTT Полиморфизм гена транспортера серотонина 5HTTLPR определяли с помощью полимеразной цепной реакции (ПЦР) и последующей идентификации различий длин продуктов (Ведяков А.М., Тоневицкий А.Г., Сысоева О.В., Портнова Г.В., Иваницкий А., 2006).

Для постановки ПЦР использовали следующие праймеры:

5HTT - F 5' – CAATGTCTGGCGCTTCCCCTACATAT - 3' 5HTT - R 5' – GACATAATCTGTCTTCTGGCCTCTCAAG - 3' Для аллеля L ожидаемая длина продукта амплификации 300 п.о., для аллеля S 256 п.о.

ПЦР проводили по следующей программе:

94С – 1 минута - 1 цикл;

1.

94С - 30 секунд, 61С – 1 минута, 72С – 1 минута;

- 35 циклов;

2.

Хранение: +10С.

3.

Детекцию продуктов проводили с помощью электрофореза в 2% агарозном геле. Гель готовили на ТАЕ–буфере (0,2 М Трис, 0,1 М Ледяная уксусная кислота, 0.5М ЭДТА pH8.0). Электрофорез проходил при напряжении 100 V в течение 30 минут с охлаждением. Результат детектировали на трансиллюминаторе ТСР 15М (Vilber lourmat) с помощью системы видеодетекции «DNA Analyzer».

2.5.2. Методика генотипирования DRD Проводили полимеразную цепную реакцию (ПЦР). Полиморфизм определяли по длине продуктов после рестрикции. ДНК выделяли из 100 мкл цельной крови с помощью наборов «ДНК-сорб Б» производства ЦНИИЭ (Россия). Реакцию проводили в объеме 25 мкл. Стандартная реакционная смесь включала: 67 мМ Трис-НCl (рН 8,4), 16 мМ сульфата аммония, 2,5 mM MgCl2, 0,125 мг/мл бычьего сывороточного альбумина, 8% глицерин, 0,001% ксиленцианол, 2,5 Ед Taq-ДНК-полимеразы (ЦНИИЭ, Россия), 0,2 мМ каждого из четырех дезоксинуклеозидтрифосфатов и по 8 пмоль праймеров.

При постановке ПЦР обязательно использовали технику «горячий старт», который обеспечивался разделением нуклеотидов с праймерами и Taq полимеразы прослойкой воска.

Для ПЦР-амплификации использовали следущие праймеры, фланкирующие полиморфный участок гена DRD2 (Farde L., Gustavsson J.P., Jonsson E., 2007).

5‘-ССGTCGACCCTTCCTGAGTGTCATCA-3‘ прямой 5‘-CCGTCGACGGCTGGCCAAGTTGTCTA-3‘ обратный Ожидаемая длина продукта амплификации 310 п.о. для обеих аллелей.

ПЦР проводили по следующей программе в амплификаторе Терцик (ДНК технология):

94С – 4 минут - 1 цикл;

94С - 30 сек., 58С - 30 сек., 72С – 30 сек;

всего 35 циклов;

72 С – 5 мин – 1 цикл;

Хранение: +10С.

Затем к 7.5 мкл каждого образца добавляли определенное количество рестриктазы Taq I, эквивалентное 5 единицам активности фермента и проводили рестрикцию амплифицированных продуктов в течение 22 часов при 65 С в суховоздушном термостате.

Мутантный аллель А1 не расщепляется. А2 аллель (дикий тип) расщепляется на продукты длинной 130 и 180 п.о.

Детекцию продуктов проводили с помощью электрофореза в 3% агарозном геле. Гель готовили на ТАЕ-буфере (0,1 М трис, 0,1 М уксусная кислота, 2 мМ ЭДТА, рН 8,3) с добавлением бромистого этидия до конечной концентрации 0,00001 %. Электрофорез проходил с охлаждением при напряжении 100 V в течение 1 часа. Результат детектировали на трансиллюминаторе ТСР 15М (Vilber lourmat) с помощью системы видеодетекции «DNA Analyzer».

2.5.3. Методика генотипирования COMT Проводили полимеразную цепную реакцию (ПЦР). Полиморфизм определяли по длине рестриктых фрагментов продуктов амплификации. ДНК выделяли из 100 мкл цельной крови с помощью наборов «ДНК-сорб Б»

производства ЦНИИЭ (Россия). Реакцию проводили в объеме 25 мкл.

Стандартная реакционная смесь включала: 67 мМ Трис-НCl (рН 8,4), 16 мМ сульфата аммония, 2,5 mM MgCl2, 0,125 мг/мл бычьего сывороточного альбумина, 8% глицерин, 0,001% ксиленцианол, 2,5 Ед Taq-ДНК-полимеразы (ЦНИИЭ, Россия), 0,2 мМ каждого из четырех дезоксинуклеозидтрифосфатов и по 8 пмоль праймеров. При постановке ПЦР обязательно использовали технику «горячий старт», который обеспечивался разделением нуклеотидов с праймерами и Taq-полимеразы прослойкой воска.

Для ПЦР-амплификации использовались следущие праймеры, фланкирующие полиморфный участок гена COMT.

5'-TCG TGG ACG CCG TGA TTC AGG-3' прямой 5'-AGG TCT GAC AAC GGG TCA GGC-3' обратный Ожидаемая длина продукта амплификации 217 п.о. для обоих аллелей.

ПЦР проводили по следующей программе в амплификаторе Терцик (ДНК технология):

94С – 5 минут - 1 цикл;

94С - 30 сек., 55С - 30 сек., 72С – 1 мин;

всего 35 циклов;

72 С – 10 мин – 1 цикл;

Хранение: +10С.

Затем к 7.5 мкл каждого образца добавляли определенное количество рестриктазы NlaIII, эквивалентное 1 единице активности и проводили рестрикцию амплифицированных продуктов в течение ночи при 37С.

Аллель, содержащий Val (дикий тип) расщепляется на продукты длинной 136 и 81 п.о. Мутантный аллель, содержащий Met, расщепляется на продукты длинной 96, 81, и 40 п.о.

Детекцию продуктов проводили с помощью электрофореза в 10% акриламидном геле. Гель готовили на ТВЕ-буфере (0,1 М трис, 0,1 М борная кислота, 2 мМ ЭДТА, рН 8,3) из исходного раствора акриламид:бисакриламид 19:1. Электрофорез проходил при напряжении V в течение 1,5 час. Затем гель 15 мин красили в 0,00001 % растворе бромистого этидия. Результат детектировали на трансиллюминаторе ТСР 15М (Vilber lourmat) с помощью системы видеодетекции «DNA Analyzer».

ГЛАВА 3. РЕЗУЛЬТАТЫ ИССЛЕДОВАНИЯ Результаты экспериментального исследования представлены в двух разделах. В первом разделе представлены результаты по субъективным, поведенческим и электрофизиологическим показателям, усредненные по всей группе испытуемых. Во втором разделе представлены результаты по субъективным, поведенческим и электрофизиологическим показателям для носителей различных полиморфизмов генов 5НТТ, DRD2 и СОМТ.

3.1. Результаты по субъективным, поведенческим и электрофизиологическим показателям по всей выборке.

3.1.1. Субъективные и поведенческие данные.

А) Методика САН В таблице 1 показаны средние значения для каждой шкалы опросника САН для обоих состояний: до и после влияния длительной когнитивной нагрузки. Результаты Т-теста для зависимых выборок показали значимое снижение показателя по шкалам Самочувствие, Активность и Общему баллу.

Таким образом, когнитивное утомление не отражается на настроении испытуемого, но значимо влияет на его субъективное самочувствие и активность.

Таблица Методика САН.

Общий Самочувствие Активность Настроение балл До утомления 5,45 5,05 5,42 5, После утомления 4,61** 4,18** 5,23 4,69** Ср. значения, шкала: 1-7 баллов **значимые изменения (p0.01) Б) Простая зрительно-моторная реакция В таблице 2 представлены результаты для Простой зрительно моторной реакции (ПЗМР) до и после влияния длительной когнитивной нагрузки. Статистический анализ данных выявил значимое увеличение времени реакции. Статистический анализ ANOVA показал значимые различия в скорости простой зрительно-моторной реакции в начале и в конце эксперимента (F (1,58)=12,016;

p0,001). Таким образом, можно говорить о том, что в состоянии утомления, вызванном длительной когнитивной нагрузкой, происходит значимое замедление простой зрительно-моторной реакции.

Таблица Простая зрительно-моторная реакция.

Ср. время р-ции Ст. откл.

До утомления 228,13 После утомления 238,94** **значимые изменения (p0.01) В) Реакция выбора В таблице 3 представлены результаты для Реакции выбора (РВ) до и после влияния длительной когнитивной нагрузки. Статистический анализ данных выявил значимое уменьшение времени реакции одновременно со значимым увеличением количества ошибок. Статистический анализ ANOVA покзал значимое снижение скорости реакции выбора после утомления (F(1,58)=9,291;

p0,004). ANOVA также показала значимое увеличение ошибок после утомления в реакции выбора (F (1,58)=7,62;

p0,008). Это означает, что когнитивное утомление отражается в увеличении скорости реакции выбора с одновременным увеличением количества ошибок.

Таблица Реакция выбора.

Ср. время р-ции Ст. откл. Ошибки До утомления 419,61 5, После утомления 405,18** 7,08** **значимые изменения (p0.01) Г) Теппинг-тесты В таблице 4 представлены результаты для разных видов теппинг-тестов до и после влияния длительной когнитивной нагрузки. Статистический анализ ANOVA показал значимое снижение скорости комфортного теппинга (F(1,48)=9,74;

p0,004). Скорость максимального теппинга значимо не изменилась. Из этого следует, что когнитивное утомление практически не влиет на моторные процессы, но значимо отражается на субъективном течении времени.

Таблица Теппиг-тесты.

Комфортный (мс) Максимальный (мс) До утомления 172,82 (17) 819,55 (498) После утомления 171,56 (17) 1131,62 (962)** Сред.время реакции (ст.откл) **значимые изменения (p0.01) 3.1.2. Результаты ЭЭГ А) Индивидуальный альфа ритм В таблице 5 представлены электроэнцефалографические результаты по показателю индивидуального альфа ритма (ИАР) для 5 мозговых регионов в обоих полушариях (лобном, центральном, височном, теменном и затылочном) для обоих состояний: до и после влияния длительной когнитивной нагрузки.

Статистический анализ данных показал значимое снижение ИАР в правом полушарии после длительной когнитивной нагрузки. Результаты Т теста показали значимое снижение частоты индивидуального альфа ритма в правом полушарии в теменной, височной и затылочной областях.

Таблица Частота индивидуального альфа ритма до и после утомления (Гц).

После Области мозга До утомления Ст.откл. Ст.откл.

утомления Лобная левая 9,72 0,98 9,62 0, Лобная правая 9,79 0,93 9,63 1, Центральная левая 9,72 0,93 9,65 1, Центральная правая 9,75 0,90 9,57 1, Теменная левая 9,90 0,93 9,92 0, Теменная правая 10,16 0,86 9,87 0,93** Височная левая 9,82 0,91 9,73 0, Височная правая 9,95 0,80 9,74 0,89* Затылочная левая 10,01 0,93 9,82 0, Затылочная правая 10,12 0,84 9,83 0,84* Ср.знач. /ст.откл.

(*значимые изменения (p0.05);

** значимые изменения (p0.01)) Трехфакторная модель ANOVA выявила значимое взаимодействие двух факторов (рисунок 6): состояние – до и после влияния длительной когнитивной нагрузки;

а также фактора полушарие (F(1,44)=5,74;

p0,02).

Это означает, что в разных полушариях ИАР изменяется разнонаправленно. В правом полушарии в фоне наблюдается более высокая частота ИАР, чем в левом полушарии. После утомления в правом полушарии наблюдается более сильное снижение частоты ИАР, хотя и не значимое. При этом различные области мозга не различают по частоте индивидуального альфа ритма.

Current effect: F(4, 176)=1,5194, p=, 10, 10, 10, частота альфа ритма 10, 9, 9, 9, 9, До утом-я После 9, ОБЛАСТЬ: ОБЛАСТЬ:

2 4 2 4 утом-я 1 3 5 1 3 ЛЕВОЕ ПОЛУШАРИЕ ПРАВОЕ ПОЛУШАРИЕ Рисунок 6. Частота индивидуального альфа ритма до и после утомления в правом и левом полушариях для 5 областей (1 – лобная;

2 – центральная;

3 –теменная;

4 – височная;

5 –затылочная).

Б) Спектральный анализ данных ЭЭГ Для статистического анализа спектральных характеристик ЭЭГ использовался двухфакторный дисперсионный анализ ANOVA. Первым из факторов было состояние – до и после влияния длительной когнитивной нагрузки;

а вторым фактором были области мозга – лобная, центральная, теменная, височная правая, височная левая и затылочная области.

Статистический анализ проводился отдельно для каждого спектрального диапазона (тета, нижний альфа, верхний альфа, альфа, нижний бета, верхний бета, бета, гамма), а также для состояний с зактрытыми и открытыми глазами.

Спектральный анализ подсчитывался двумя различными способами, отражающими разные его характеристики. В первом случае он подсчитывается как относительная логарифмизированная мощность для каждого диапазона в каждой области. Во втором же он представлял среднее значение мощности, усредненное внутри каждой области и для каждого диапазона.

I способ. Обработка и анализ спектральных данных ЭЭГ в первом способе состояла из следующих этапов:

1. Отфильтрованные и очищенные от артефактов показатели мощности ЭЭГ, представленные в трехмерной матрице (257 каналов;

частота 1-40 Гц с частотой дискретизации 0,03 Гц;

44 испытуемых), были усреднены по каждому отдельному региону (лобному, центральному, височным, теменному и затылочному) (см. рисунок 5).

2. Полученные усредненные данные мощности ЭЭГ для каждой области были просуммированы внутри каждого диапазона (тета, нижний альфа, верхний альфа, альфа, нижний бета, верхний бета, бета, гамма).

3. Был посчитан натуральный логарифм полученных мощностей (LN).

4. Была посчитана относительная мощность логарифмизированных данных, которая высчитывалась как отношение мощности данного диапазона к сумме мощностей всех диапазонов (тета, альфа, бета, гамма).

5. Для каждого отдельного ритма и каждого состояния был проведен статистический анализ ANOVA.

II способ. Для второго способа анализ и обработка данные состояла из следующих этапов:

1. Отфильтрованные и очищенные от артефактов показатели мощности ЭЭГ, представленные в трехмерной матрице (257 каналов;

частота 1-40 Гц с частотой дискретизации 0,03 Гц;

44 испытуемых), были усреднены по каждому отдельному региону (лобному, центральному, височным, теменному и затылочному) (см. рисунок 5).

2. Полученные усредненные данные мощности ЭЭГ для каждой области были усреднены также внутри каждого диапазона (тета, нижний альфа, верхний альфа, альфа, нижний бета, верхний бета, бета, гамма).

3. Для каждого отдельного ритма и каждого состояния был проведен статистический анализ ANOVA.

Спектральный анализ в диапазоне тета ритма. Двухфакторная модель ANOVA выявила значимое увеличение мощности тета ритма после длительной когнитивной нагрузки только для усредненных данных (F(1,27)=7,98;

p0,009) (рисунок 7) и не выявила значимых изменений для логарифмизированных данных, для которых наблюдалась лишь небольшая тенденция к увеличению. Из графика видно, что наибольшие изменения в тета диапозоне наблюдались в левой височной и затылочных областях.

5, 4, средняя мощность, мкВ 4, 3, 3, 2, 2, 1, До 1, утомления 0, После 1 2 3 4 5 утомления ОБЛАСТИ Рисунок 7. Спектральные характеристики для усредненных данных в диапазоне тета ритма (3,5-7,5 Гц) для закрытых глаз во всех мозговых областях (1 – лобная;

2 – центральная;

3 –теменная;

4 – левая височная;

5 – правая височная;

6 –затылочная).

Спектральный анализ ЭЭГ в диапазоне нижнего альфа ритма.

Двухфакторный статистический анализ ANOVA выявил значимое увеличение нижнего альфа ритма для логарифмизированных данных после длительной когнитивной нагрузки, как в состоянии с открытыми глазами (F(1,43)=15,048, p0,0004), так – и в состоянии с закрытыми (F(1,43)=10,903, p0,001) (рисунок 8). Для усредненных данных статистический анализ 0, 0, 0,29 0, 0,28 0, относительная мощность относительная мощность 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, До До 0, 0,20 утомления утомления После После 0, 0, утомления утомления 1 2 3 4 5 1 2 3 4 5 ОБЛАСТЬ ОБЛАСТЬ а б Рисунок 8. Спектральные характеристики для LN данных в диапазоне нижнего альфа ритма (7,5-10 Гц) для закрытых (а) и открытых (б) глаз во всех мозговых областях (1 – лобная;

2 – центральная;

3 –теменная;

4 – левая височная;

5 – правая височная;

6 – затылочная).

средняя мощность, мкВ ^ До утомления После утомления 1 2 3 4 5 ОБЛАСТИ Рисунок 9. Спектральные характеристики для усредненных данных в диапазоне нижнего альфа ритма (7,5-10 Гц) для закрытых глаз во всех мозговых областях (1 – лобная;

2 – центральная;

3 –теменная;

4 – левая височная;

5 – правая височная;

6 –затылочная).

ANOVA выявил значимое увеличение нижнего альфа ритма только в условиях с закрытыми глазами (F(1,38)=13,413;

p0,0008) (рисунок 9). Из графиков видно, что наибольшее увеличение мощности альфа ритма наблюдается в теменной и височных областях и чуть меньше – в затылочной области. При этом также видно, что усредненная мощность альфа ритма максимальна в теменной и затылочной областях.

Спектральный анализ ЭЭГ в диапазоне верхнего альфа ритма.

Двухфакторный статистический анализ ANOVA выявил значимое увеличение верхнего альфа ритма для логарифмизированных данных после длительной когнитивной нагрузки как в состоянии с открытыми глазами (F(1,43)=5,08;

p0,03), хотя оно менее значимое, чем в диапазоне нижнего альфа ритма 10). Для усредненных данных статистический анализ ANOVA (рисунок выявил значимое увеличение верхнего альфа ритма только в условиях с закрытыми глазами (F(1,37)=4,646;

p0,04). В данном случае также видно, что это изменение менее значимо, чем в диапазоне нижнего альфа ритма (рисунок 11).

До утомления После утомления 0, 0, 0, относительная мощность 0, 0, 0, 0, 0, 0, 0, 0, 1 2 3 4 5 ОБЛАСТЬ Рисунок 10. Спектральные характеристики для LN данных в диапазоне верхнего альфа ритма (10-12,5 Гц) для открытых глаз во всех мозговых областях (1 – лобная;

2 – центральная;

3 –теменная;

4 – левая височная;

5 – правая височная;

6 –затылочная).

До утомления 75 После утомления средняя мощность, мкВ 1 2 3 4 5 ОБЛАСТИ Рисунок 11. Спектральные характеристики для усредненных данных в диапазоне верхнего альфа ритма (10-12,5 Гц) для закрытых глаз во всех мозговых областях (1 – лобная;

2 – центральная;

3 – теменная;

4 – левая височная;

5 – правая височная;

6 –затылочная).

Спектральный анализ ЭЭГ в диапазоне альфа ритма. В диапазоне альфа ритма статистический анализ ANOVA для логарифмизированных данных выявил значимое увеличение ритма после длительной когнитивной нагрузки только в условиях с открытыми глазами (F(1,43)=9,764;

p0,003). Но оно также намного меньше, чем в диапазоне нижнего альфа ритма (рисунок 12).

0, 0, 0, относительная мощность 0, 0, 0, 0, 0, 0, 0, До утомления 0, После 0, утомления 1 2 3 4 5 ОБЛАСТЬ Рисунок 12. Спектральные характеристики для LN данных в диапазоне альфа ритма (7,5-12,5 Гц) для открытых глаз во всех областях (1 – лобная;

2 – центральная;

3 –теменная;

4 – левая височная;

5 – правая височная;

6 –затылочная).

средняя мощность, мкВ До утомления После утомления 1 2 3 4 5 ОБЛАСТИ Рисунок 13. Спектральные характеристики для усредненных данных в диапазоне альфа ритма (7,5-12,5 Гц) для закрытых глаз вр всех областях (1 – лобная;

2 – центральная;

3 –теменная;

4 – левая височная;

– правая височная;

6 –затылочная).

Для усредненных данных статистический анализ ANOVA выявил значимое увеличение ритма после утомления только в условиях с закрытыми глазами (F(1,38)=12,694;

p0,002) (рисунок 13). Из графика видно, что максимальная мощность альфа ритма наблюдается в теменной и затылочной областях. Таким образом, из полученных данных видно, что максимальные изменения в диапазоне альфа ритма наблюдаются в поддиапазоне нижнего альфа ритма (7,5 – 10 Гц).

Спектральный анализ ЭЭГ в диапазоне нижнего бета ритма.

Двухфакторный статистический анализ ANOVA выявил значимое увеличение нижнего бета ритма для логарифмизированных данных после длительной когнитивной нагрузки в состоянии с открытыми глазами (F(1,43)=4,651;

p0,04) (рисунок 14). Для усредненных данных статистический анализ ANOVA не выявил значимых изменений.

До утомления После 77 утомления 0, 0, относительная мощность 0, 0, 0, 0, 0, 0, 0, 1 2 3 4 5 ОБЛАСТЬ Рисунок 14. Спектральные характеристики для LN данных в диапазоне нижнего бета ритма (12,5-18 Гц) для открытых глаз во всех областях (1 – лобная;

2 – центральная;

3 –теменная;

4 – левая височная;

– правая височная;

6 –затылочная).

Спектральный анализ ЭЭГ в диапазоне верхнего бета ритма. В диапазоне верхнего бета ритма статистический анализ ANOVA для логарифмизированных данных выявил значимое уменьшение ритма после длительной когнитивной нагрузки в условиях с закрытыми глазами (F(1,43)=4,292;

p0,04) (рисунок 15).

Для усредненных данных статистический анализ ANOVA выявил значимое увеличение верхнего бета ритма послеутомления длительной когнитивной До нагрузки в условиях с закрытыми глазами (F(1,37)=4,558;

p0,04) (рисунок После утомления 16). 0, 0, относительная мощность 0, 0, 0, 0, 0, 1 2 3 4 5 ОБЛАСТЬ Рисунок 15. Спектральные характеристики для LN данных в диапазоне верхнего бета ритма (18-35 Гц) для закрытых глаз во всех областях (1 – лобная;

2 – центральная;

3 –теменная;

4 – левая височная;

– правая височная;

6 –затылочная).

1, 1, средняя мощность, мкВ 1, 0, 0, 0, 0, До утомления После 0, утомления 1 2 3 4 5 ОБЛАСТИ Рисунок 16. Спектральные характеристики для усредненных данных в диапазоне верхнего бета ритма (18-35 Гц) для всех областей (1 – лобная;

2 – центральная;

3 –теменная;

4 – левая височная;

5 – правая височная;

6 –затылочная).

Спектральный анализ ЭЭГ в диапазоне бета ритма. В диапазоне бета ритма статистический анализ ANOVA для логарифмизированных данных выявил значимое уменьшение ритма после длительной когнитивной нагрузки в условиях с закрытыми глазами (F(1,43)=8,121;

p0,007) (рисунок 17).

0, 0, относительная мощность 0, 0, 0, 0, 0, До утомления После 0, утомления 1 2 3 4 5 ОБЛАСТЬ Рисунок 17. Спектральные характеристики для LN данных в диапазоне бета ритма (12,5-35 Гц) для закрытых глаз во всех областях ( – лобная;

2 – центральная;

3 –теменная;

4 – левая височная;

5 – правая височная;


6 –затылочная).

Для усредненных данных статистический анализ ANOVA выявил значимое увеличение верхнего бета ритма после утомления в условиях с закрытыми глазами (F(1,38)=5,399;

p0,03) (рисунок 18).

1, 1, средняя мощность, мкВ 1, 0, 0, 0, До у томления 0, После у томления 0, 1 2 3 4 5 ОБЛАСТ И Рисунок 18. Спектральные характеристики для усредненных данных в диапазоне бета ритма (12,5-35 Гц) для закрытых глаз во всех областях (1 – лобная;

2 – центральная;

3 –теменная;

4 – левая височная;

– правая височная;

6 –затылочная).

Спектральный анализ ЭЭГ в диапазоне Гамма ритма. Статистический анализ ANOVA для логарифмизированных данных не выявил значимых изменений в диапазоне гамма ритма. Отмечается лишь маленькая тенденция к уменьшению после длительной когнитивной нагрузки. Для усредненных данных статистический анализ ANOVA не выявил значимых изменений.

В) Индекс утомления.

Индекс утомления, отражающий отношение суммарной мощности альфа и тета ритмов к суммарной мощности бета ритма (FAT= (alpha + theta) / (beta)) (Jap et al, 2009), высчитывался отдельно для всех каналов для закрытых и открытых глаз для обоих состояний: до и после длительной когнитивной нагрузки. После проведения данного подсчета индекс утомления был усреднен по 6 выделенным мозговым регионам.

Статистический анализ (Т-тест) проводился отдельно, как для каждого электрода, так и для усредненных данных по мозговым областям для обоих полушарий. Т-тест для отдельных каналов выявил значимое увеличение индекса утомления в 133 каналах из 257 в условиях с закрытыми глазами, и в 55 каналах – с открытыми глазами (Рисунок 19). В таблице 6 представлены значения индекса утомления со стандартными отклонениями по отдельным регионам. Статистический анализ Т-тест показал значимое увеличение индекса утомления практически во всех регионах в условиях с закрытыми глазами, кроме лобных и центральной левой области, а также в теменных отделах в условиях с открытыми глазами.

Таблица Индекс утомления до и после когнитивной нагрузки.

ИНДЕКС УТОМЛЕНИЯ (закрытые глаза) Области До После Ст.откл. Ст.откл.

мозга утомления утомления Лобная левая 4,59 2,90 4,94 3, Лобная правая 7,02 2,58 7,41 2, Центральная левая 3,50 2,49 4,04 2, Центральная правая 3,51 2,54 4,75 2,56** Теменная левая 3,86 3,03 5,26 3,32** Теменная правая 5,20 4,00 6,47 4,25** Височная левая 3,05 2,08 3,98 2,33** Височная правая 3,26 2,33 4,19 2,90** Затылочная левая 3,85 2,85 4,51 2,83* Затылочная правая 3,50 2,49 4,34 2,58** Ср.знач. /ст.откл.

*значимые изменения (p0.05) ** значимые изменения (p0.01) ИНДЕКС УТОМЛЕНИЯ (открытые глаза) Области До После Ст.откл. Ст.откл.

мозга утомления утомления Лобная левая 5,80 6,37 5,42 5, Лобная правая 5,39 4,12 5,12 3, Центральная левая 2,86 1,79 3,75 4, Центральная правая 2,89 1,80 3,94 3, Теменная левая 2,92 1,99 4,23 4,36* Теменная правая 2,99 2,07 4,80 4,74* Височная левая 2,25 1,30 3,10 3, Височная правая 2,21 1,31 3,16 3, Затылочная левая 2,11 1,32 2,81 3, Затылочная правая 2,12 1,36 3,00 3, Ср.знач. /ст.откл.

*значимые изменения (p0.05) ** значимые изменения (p0.01) (а) (б) значимые изменения (p0.05) Рисунок 19. Значимое увеличение индекса утомления после когнитивной нагрузки в условиях с закрытыми (а) и открытыми (б) глазами.

Для индекса утомления проводился также более сложный статистический анализ – дисперсионный анализ ANOVA. Статистический анализ ANOVA показал, что индекс утомления значимо увеличивается после утомления в обоих полушариях в условиях с закрытыми глазами (F(1,43)=8,316;

p0,006). Трехфакторная модель ANOVA показала значимое взаимодействие всех трех факторов: состояние (до и после когнитивной нагрузки), области мозга и полушарие (F(4,172)=3,034;

p0,02). Это говорит о том, что индекс утомления, во-первых, значимо увеличивается с утомлением, а во-вторых, он по-разному изменяется в разных областях мозга и в разных полушариях. В условиях с открытыми глазами трехфакторная показала значимое взаимодействие только двух факторов:

ANOVA состояние и области мозга (F(4,172)=20,72;

p0,000004). Это означает, что индекс утомления значимо возрастает с утомлением, но в разных областях мозга по-разному. При этом не наблюдается значимых различий в изменении индекса утомления в разных полушариях.

В условиях с закрытыми глазами правое полушарие характеризуется более высоким значением индекса утомления до и после когниитвной нагрузки, преимущественно в лобной и теменных областях. Это может говорить о доминировании медленных ритмов в правом полушарии. По данным многочисленных исследований показано, что увеличение мощности медленных ритмов связано с развитием когнитивного утомления (Cheng et al, 2011;

Boksem et al, 2006).

индекс утомления До утомления ОБЛ: ОБЛ:

2 4 2 После 1 3 5 1 3 утомления ЛЕВОЕ ПОЛУШАРИЕ ПРАВОЕ ПОЛУШАРИЕ Рисунок 20. Показатели индекса утомления при закрытых глазах до и после когнитивной нагрузки для левого и правого полушарий всех областей мозга (1 – лобная;

2 – центральная;

3 –теменная;

4 – височная;

–затылочная) в условиях с закрытыми и открытыми глазами.

индекс утомления До утомления После ОБЛ: ОБЛ:

2 4 2 1 3 5 1 3 утомления ЛЕВОЕ ПОЛУШАРИЕ ПРАВОЕ ПОЛУШАРИЕ Рисунок 21. Показатели индекса утомления при открытых глазах до и после когнитивной нагрузки для левого и правого полушарий всех областей мозга (1 – лобная;

2 – центральная;

3 –теменная;

4 – височная;

–затылочная) в условиях с закрытыми и открытыми глазами.

Г) Фронтальная асимметрия.

В таблице 7 представлены вычисленные показатели коэффициентов фронтальной асимметрии для условий с закрытыми и открытыми глазами в состояниях до и после длительной когнитивной нагрузки. Проведенный статистический анализ не выявил значимых изменений по показателям фронтальной асимметрии ни до, ни после когнитивной нагрузки.

Таблица Коэффициенты фронтальной асимметрии.

До утомления После утомления Закрытые глаза F3-F4 -0,014 (0,13) -0,040 (0,11) -0,011 (0,16) -0,054 (0,14) F7-F Открытые глаза F3-F4 0,035 (0,14) -0,050 (0,32) 0,036 (0,21) 0,056 (0,19) F7-F Сред.знач. (ст.откл.) 3.2. Результаты по субъективным, поведенческим и электрофизиологическим показателям у носителей различных полиморфизмов генов 5НТТ, DRD2, СОМТ.

В данном экспериментальном исследовании мы пытались обнаружить возможные связи между наличием определенных полиморфизмов генов и комплексом различных субъективных, поведенческих и психофизиологических параметров. Был проведен генетический анализ и определены полиморфизмы трех генов - 5HTT, COMT и DRD2.

В гене 5HTT (5-HT transporter gene, 5-НТТ) мы рассматривали полиморфизм 5HTTLPR (5-HTT gene-linked polymorphic region), представленный тремя вариантами - LL, LS и SS. Он играет важную роль в трансмиссии серотонина в головном мозге, а также во многих периферических тканях. Он удаляет серотонин из синаптической щели и определяет величину и продолжительность сигнала на постсинаптической мембране. При наличии одной или двух S аллелей транскрипция 5-HTT снижается на 60-70% в головном мозге и на 30-40% в лимфобластах по сравнению с гомозиготой по L аллели (Зинченко и др., 2011).

В гене СОМТ мы смотрели полиморфизм Val158Met, представленный тремя вариантами - MM, VV и MV. В литературе было показано, что частота встречаемости аллеля M варьирует в различных популяциях от 0.01 до 0.62, а для популяции русских приблизительно равна 0.5 (Palmatier, 1999).

В гене DRD2 мы смотрели полиморфизм TaqI A, который также представлен тремя различными вариантами - A1A1, A1A2 и A2A2. Известно, что аллель А1 встречает в популяции россиян с вероятностью 0,172, а аллель А2 – 0.828 (Kidd, 1998). Также было выяснено, что наличие аллеля А приводит к уменьшению плотности рецепторов на 30-40%, по сравнению с А2А2. Поэтому при анализе данных, мы будем объединять полиморфизмы А1А1 и А1А2 в одну группу. Статистический анализ проводился отдельно по каждому гену.

По гену 5НТТ выборка была разбита на 2 группы: первая группа характеризовалась наличием полиморфизма LL (16 человек), а вторая группа – наличием полиморфизмов LS и SS (23 человека). Такое решение было принято на основе литературных данных, показывающих, что LL полиморфизм ассоциирован с более высоким содержанием транспортера серотонина (Davis JM, 1995;

Weicker H, 2001;

Meeusen R, 2007).

По гену СОМТ мы разделили выборку на 3 группы: первая группа включала носителей ММ-полиморфизма (5 человек), вторая группа включала носителей MV-полиморфизма (22 человека), а третья группа включала носителей VV-полиморфизма (8 человек). Данное решение было основано на неравности групп, а также на опубликованных данных, показывающих, что ММ-полиморфизм ассоциирован с более медленной деградацией дофамина, который, в свою очередь, играет важную роль в когнитивных процессах (Chen, 2004).

По гену DRD2, как было сказано выше, выборка была поделена на группы: первая группа включала носителей полиморфизмов A1A1 и A1A2 ( человек), а вторая группа включала носителей полиморфизма A2A2 ( человек). Данное решение было также принято на основе литературных данных, которые показали, что полиморфизм A2A2 ассоциирован с большей плотностью дофаминовых рецепторов (Foley TE, 2008).

3.2.1. Субъективные и поведенческие показатели у носителей различных полиморфизмов генов 5НТТ, DRD2, СОМТ.

А) Методика САН В таблице 8 (а, б, в) представлены средние значения для каждой шкалы опросника САН для носителей различных полиморфизмов для обоих состояний: фонового состояния до утомления и состояния после утомления.

Результаты Т-теста показывают значимое снижение оценки по шкалам Самочувствие, Активность и Общему баллу у всех трех генов практически по всем полиморфизмам. Таким образом, видно, что изменения, происходящие на субъективном уровне после действия длительной когнитивной нагрузки, значимо не различаются у носителей различных полиморфизмов генов 5НТТ, DRD2 и СОМТ. Все испытуемые, независимо от наличия у них тех или иных полиморфизмов, одинаково ощущали на субъективном уровне ухудшение самачувствия и активности.


Таблицы 8 (а,б,в). Изменения субъективных ощущений по опроснику САН после утомления у носителей полиморфизмов генов 5НТТ (а), DRD2 (б) и COMT(в).

Таблица 8(а) Методика САН (ген 5НТТ).

Самочувствие Активность Настроение Общий балл LL 5.4/4.6** 5/4.2** 5.3/5.2 5.2/4.7* LS+SS 5.5/4.6** 5/4.2** 5.5/5.3 5.3/4.7** До утомления/после утомления Ср. значения, шкала: 1-7 баллов Таблица 8(б) Методика САН (ген DRD2).

Самочувствие Активность Настроение Общий балл A1A1+A 5.4/4.4** 5.1/4** 5.4/5.2 5.3/4.5** A A2A2 5.5/4.7** 5/4.3** 5.4/5.2 5.3/4.8** До утомления/после утомления Ср. значения, шкала: 1-7 баллов Таблица 8(в) Методика САН (ген СОМТ).

Самочувствие Активность Настроение Общий балл MM 5.8/4.4* 5.3/4 5.6/5 5.6/4. MV 5.2/4.4** 5/4** 5.4/5.2 5.2/4.5* VV 5.9/5** 5.1/4.4** 5.3/5.4 5.4/5** До утомления/после утомления Ср. значения, шкала: 1-7 баллов Б) Простая зрительно-моторная реакция В таблице 9 (а, б, в) представлены показатели простой зрительно моторной реакции (ПЗМР) со стандартными отклонениями для ностилелей различных полиморфизмов трех генов до и после утомления.

Таблица 9(а) Простая зрительно-моторная реакция (ген 5НТТ).

5НТТ До утомления, мс После утомления, мс LL 233.8 (23.1) 244 (27.7) LS+SS 222.1 (17.4) 232.7 (26.8) Ср.знач.(ст.откл.) Двухфакторная модель ANOVA выявила, что в целом наблюдается значимое увеличение времени реакции после длительной когнитивной нагрузки (F(1,50)=9,420;

p0,004), но при этом значимых различий между полиморфизмами LL и LS+SS не наблюдается (рисунок 22). Следует отметить, что носители LL-полиморфизма характеризуются на уровне тенденции меньшей скоростью, по сравнению с LS+SS.

время реакции, мс LL LS+SS ПЗМР до утом-я ПЗМР после утом-я Рисунок 22. Статистический анализ ANOVA для показателей ПЗМР до и после утомления у носителей полиморфизов гена 5НТТ (LL и LS+SS).

Таблица 9(б) Простая зрительно-моторная реакция (ген DRD2).

До утомления, мс После утомления, мс DRD A1A1+A1A2 221.9 (16.4) 227.6 (14.4) A2A2 232.3 (21.1) 243.6 (30) Ср.знач.(ст.откл.) Двухфакторная модель ANOVA выявила, что в целом наблюдается значимое увеличение времени реакции после длительной когнитивной нагрузки (F(1,47)=6,479;

p0,01). Также было показано, что носители двух групп полиморфизмов A1A1+A1A2 и A2A2 значимо различаются между собой: F(1,47)=6,960;

p0,01. Носители полиморфизма A2A2 характеризуется значимо более высоким временем реакции, по сравнению с носителями A1A1+A1A2 полиморфизмов (рисунок 23).

время реакции, мс A1A1+A1A 205 A2A ПЗМР до утом-я ПЗМР после утом-я Рисунок 23. Статистический анализ ANOVA для показателей ПЗМР до и после утомления у носителей полиморфизов гена DRD (A1A1+A1A2 и A2A2).

Таблица 9(в) Простая зрительно-моторная реакция (ген СОМТ).

После утомления, До утомления, мс COMT мс MM 241.2 (27.1) 250 (20.3) MV 229.9 (20.2) 238.6 (29.9) VV 224.7 (16.6) 232.3 (19.6) Ср.знач. (ст.откл.) Двухфакторная модель ANOVA выявила, что в целом наблюдается значимое увеличение времени реакции после длительной когнитивной нагрузки (F(1,49)=5,829;

p0,02). Между собой носители полиморфизмов MM, MV и VV значимо не различаются в простой зрительно-моторной реакции. По полученным результатам видно, что носители ММ полиморфизма характеризовались самым большим временем реакции, хотя не значимым по сравнению с остальными генотипами (рисунок 24).

время реакции, мс ММ ПЗМР до утом-я ПЗМР после утом-я MV VV Рисунок 24. Статистический анализ ANOVA для показателей ПЗМР до и после утомления у носителей полиморфизов гена COMT (MM, MV и VV).

В) Реакция вывбора В таблице 10 (а,б,в) представлены средние значения и стандартные отклонения по времени реакции в Реакции выбора для трех генов до и после утомления. Статистический анализ показал, что, также как и для показателей ПЗМР, полиморфизмы LL, A2A2 и MM характеризуются самым медленным временем реакции по сравнению с другими полиморфизмами.

Таблица 10(а) Реакция выбора (ген 5НТТ).

5НТТ До утомления, мс После утомления, мс Ошибки до Ошибки после LL 440.2 (43.9) 423.3 (50) 5.6 6. LS+SS 400.2 (51.1) 385.5 (57.1) 6.2 7. Ср.знач.(ст.откл.) Двухфакторная модель ANOVA выявила, что в целом наблюдается значимое уменьшение времени реакции после длительной когнитивной нагрузки (F(1,50)=11,233;

Также показано, что носители p0,002).

полиморфизмов LL и LS+SS значимо различаются между собой по времени реакции (F(1,50)=5,146;

p0,03) (рисунок 25, а). ANOVA показала, что количество ошибок значимо возрастает с утомлением (F(1,50)=8,5256;

p0,006), но между собой носители полиморфизмов значимо не различаются по данному параметру (рисунок 25, б).

9, 460 8, 450 8, 7, время реакции, мс 7, количество ошибок 6, 6, 5, 5, 370 4, 5НТТ 4, LL 5НТТ LL LS+SS 3, РВ до утом-я РВ после утом-я LS+SS РВ ошибки до ут. РВ ошибки после ут.

(а) (б) Рисунок 25. Статистический анализ ANOVA для показателей РВ (время реакции (а), количество ошибок (б)) до и после утомления у носителей полиморфизов гена 5НТТ (LL и LS+SS).

Таблица 10(б) Реакция выбора (ген DRD2).

До утомления, После утомления, Ошибки Ошибки до DRD мс мс после A1A1+A1A2 400.2 (43.9) 377.9 (44.9) 6.1 7. A2A2 430.1 (60.1) 413.6 (59.5) 6.1 7. Ср.знач.(ст.откл.) Двухфакторная модель ANOVA выявила, что в целом наблюдается значимое уменьшение времени реакции после длительной когнитивной нагрузки (F(1,47)=12,869;

Также показано, что носители p0,0008).

полиморфизмов A1A1+A1A2 и A2A2 значимо различаются между собой (F(1,47)=5,643;

p0,02) (рисунок 26, а). ANOVA показала, что количество ошибок значимо возрастает с утомлением (F(1,47)=9,6754;

p0,004), но между собой носители полиморфизмов значимо не различаются по данному параметру (рисунок 26, б).

10, 9, 9, 8, 8, время реакции, мс количество ошибок 7, 7, 6, 6, 5, 360 5, 4, 340 DRD 4,0 A1A1+A1A DRD A1A1+A1A 3, 320 A2A A2A РВ ошибки до ут. РВ ошибки после ут.

РВ до утом-я РВ после утом-я (а) (б) Рисунок 26. Статистический анализ ANOVA для показателей РВ (время реакции (а), количество ошибок (б)) до и после утомления у носителей полиморфизов гена DRD2 (A1A1+A1A2 и A2A2).

Таблица 10(в) Реакция выбора (ген СОМТ).

До утомления, После утомления, Ошибки Ошибки до COMT мс мс после MM 440.7 (59.9) 439 (66.7) 6.7 MV 412.3 (59) 393.3 (56.3) 5.4 6. VV 416 (61) 418.5 (72.4) 7.1 7. Ср.знач. (ст.откл.) Двухфакторная модель ANOVA не выявила значимых изменений показателей реакции выбора у носителей различных полиморфизмов в гене СОМТ (рисунок 27, а). По количеству ошибок также не наблюдается значимых изменений, отмечается лишь общая тенденция к росту ошибок (рисунок 27, б).

количество ошибок время реакции, мс СОМТ ММ 380 COMT MV ММ COMT MV 360 VV VV РВ ошибки до ут. РВ ошибки после ут.

РВ до утом-я РВ после утом-я (а) (б) Рисунок 27. Статистический анализ ANOVA для показателей РВ (время реакции (а), количество ошибок (б)) до и после утомления у носителей полиморфизов гена COMT (MM, MV и VV).

Г) Теппинг-тесты В таблице 11 (а, б, в) представлены данные теппинг-тестов для трех генов до и после утомления. Как мы видим, основные изменения наблюдаются в комфортном теппинге. В гене 5НТТ наблюдается значимое замедление скорости теппинга у обеих групп. В гене DRD2 значимое замедление скорости наблюдается только у полиморфизма А2А2, а в гене СОМТ – только у полиморфизма MV.

Таблица 11(а) Теппинг-тесты (ген 5НТТ).

Комфортный (мс) Максимальный (мс) 5НТТ До утомления После утомления До утомления После утомления LL 658 (392) 1120 (1280) 178(18) 171(17) LS+SS 866(580) 1069(713) 164(16) 173(17) Сред. время реакции (ст. откл) Статистический анализ ANOVA не выявил значимых различий между носителями различных полиморфизмов в удобном теппинге в гене 5HTT (рисунок 28, а). Замедление комфортного теппинга наблюдается как у носителей LL полиморфизма (F(1,19)=4,62;

p0.05), так и у носителей LS+SS полиморфизмов (F(1,22)=4,62;

p0.05). В максимальном же теппинге двухфакторный ANOVA показал значимую интеракции между факторами время (до и после утомления) и типом полиморфизма (LL или LS+SS):

F(1,27)=10,408;

p0,004 (рисунок 28, б). Это говорит о том, что у разных типов полиморфизмов наблюдается разная динамика скорости максимального теппинга при утомлении. Полиморфизм LL характеризуется повышением скорости при утомлении, но не значимым, а носители S-аллеля, 5HTT 5HTT LL LL наоборот, значимым снижением скорости (F(1,11)=10,828;

p0,007).

5HTT 5HTT LS+SS LS+SS 1800 1600 1400 время реакции, мс время реакции, мс 1200 1000 800 600 400 200 удоб.ДО удоб.После макс.ДО макс.ПОСЛЕ (а) (б) Рисунок 28. Статистический анализ ANOVA для показателей комфортного (а) и максимального (б) теппингов до и после утомления у носителей полиморфизов гена 5НТТ (LL и LS+SS). Синий сплош. – полиморфизм LL, красный пунктир – полиморфизмы LS+SS.

Таблица 11(б) Теппинг-тесты (ген DRD2).

Комфортный (мс) Максимальный (мс) До После До После DRD утомления утомления утомления утомления A1A1+A1A2 673(281) 830(621) 170(16) 175(12) A2A2 832(542) 1229 (1133) 175(18) 172(19) Сред.время реакции (ст.откл) Статистический анализ ANOVA не выявил значимых различий между носителями различных полиморфизмов в максимальном теппинге в гене DRD2 (рисунок 29, а,б). По показателям удобного теппинга двухфакторная модель ANOVA выявила значимое замедление скорости теппинга после утомления (F(1,40)=4,97;

p0,04). При этом у носителей полиморфизма A2A наблюдается значимое снижение скорости (F(1,28)=6,30;

p0,02), тогда как у группы A1A1+A1A2 – не наблюдается.

1800 1600 время реакции, мс время реакции, мс DRD A1A1+A1A DRD A1A1+A1A DRD DRD A2A2 0 A2A макс.ДО макс.ПОСЛЕ удоб.ДО удоб.После (а) (б) Рисунок 29. Статистический анализ ANOVA для показателей комфортного (а) и максимального (б) теппингов до и после утомления у носителей полиморфизов гена DRD2 (A1A1+A1A2 и A2A2) после длительной когнитивной нагрузки.

Таблица 11(в) Теппинг-тесты (ген СОМТ).

Комфортный (мс) Максимальный (мс) После До После COMT До утомления утомления утомления утомления MM 743 (356) 1431(1705) 162(15) 162(24) MV 760(525) 970(647) 174(20) 175(17) VV 861(568) 1243(1329) 172(12) 170(13) Сред.время реакции (ст.откл) В удобном теппинге ANOVA выявил значимое замедление скорости теппинга после утомления (F(1,39)=9,73;

(рисунок 30, а).

p0,004) Статистический анализ ANOVA не выявил значимых различий между полиморфизмами после утомления в гене СОМТ.

2600 2400 2200 2000 время реакции, мс 1800 время реакции, мс 1600 1400 1200 1000 800 COMT MM COMT MM макс.ДО макс.ПОСЛЕ COMT MV COMT MV COMT VV COMT VV удоб.ДО удоб.После (а) (б) Рисунок 30. Статистический анализ ANOVA для показателей комфортного (а) и максимального (б) теппингов до и после утомления у носителей полиморфизов гена COMT (MM, MV и VV) после длительной когнитивной нагрузки.

3.2.2. ЭЭГ результаты у носителей различных полиморфизмов генов 5НТТ, DRD2, СОМТ.

Проведенный статистический анализ выявил значимые изменения показателей ЭЭГ после длительной когнитивной нагрузки для всех трех генов. Ген 5НТТ ассоциирован с серотониновым транспортером. Носители LL-полиморфизма имеют на клеточных мембранах больше транспортера серотонина по сравнению с остальными полиморфизмами. Это означает, что серотонин у них удаляется гораздо быстрее из синаптической щели, чем у остальных полиморфизмов. Ген DRD2 определяет плотность рецепторов к дофамину. Наличие А1-аллеля ведет к уменьшению плотностью рецепторов на 30-40%, что приводит к менее эффективной работе системы положительного подкрепления. СОМТ играет важную роль в деградации дофамина в префронтальной коре (Apud, 2007). Носители VV-полиморфизма характеризуются наибольшей скоростью распада дофамина.

А) Частота индивидуального альфа ритма (ИАР) В таблице 12 (а) представлены результаты по параметру индивидуального альфа ритма (ИАР) для носителей различных полиморфизмов гена 5НТТ - LL и LS+SS до и после когнитивной нагрузки.

Результаты Т-теста показали, что носители LL-полиморфизма характеризуются незначительным изменением данного показателя. Носители же S-аллеля (LS и SS) характеризуются значимым уменьшением ИАР в теменной области правого полушария.

Таблица 12(а) ИАР до и после утомления у гена 5НТТ.

LL полиморфизм LS+SS полиморфизмы Области До После После До утомления утомления утомления утомления мозга Лобная левая 9,83 (1,05) 9,74 (0,99) 9,71 (0,91) 9,49 (1,04) Лобная правая 10,00 (0,90) 9,83 (1,14) 9,70 (0,95) 9,44 (0,98) Центральная левая 10,04 (0,87) 9,84 (1,12) 9,49 (0,98) 9,49 (1,14) Центральная правая 9,92 (0,98) 9,76 (1,06) 9,61 (0,90) 9,39 (1,07) Теменная левая 10,14 (0,92) 10,12 (0,92) 9,73 (0,97) 9,75 (1,06) Теменная правая 10,23 (0,91) 10,06 (0,83) 10,10 (0,85) 9,74 (1,04)* Височная левая 9,98 (0,84) 9,85 (0,93) 9,72 (1,01) 9,60 (1,06) Височная правая 9,98 (0,89) 9,93 (0,83) 9,94 (0,80) 9,58 (0,97) Затылочная левая 10,28 (1,07) 10,07 (0,86) 9,85 (0,85) 9,58 (0,89) Затылочная правая 10,22 (0,92) 10,07 (0,78) 10,05 (0,82) 9,64 (0,89) Ср.знач. (ст.откл.) Статистический анализ ANOVA не выявил значимых различий между группами LL и LS+SS (рисунок 31, а, б). При этом носители S-аллеля (LS+SS) характеризуются значимым уменьшением ИАР в правом полушарии после когнитивной нагрузки (F(1,23)=5,097;

p0,04), чего не наблюдается у носителей LL полиморфизма.

11, 10, 10, частота альфа ритма, Гц 10, 10, 10, 9, 9, 9, 9, 9, 8, 8, REG: 2 4 REG: 2 4 До 1 3 5 1 3 5 утомления После Область Область утомления ЛЕВОЕ ПОЛУШАРИЕ ПРАВОЕ ПОЛУШАРИЕ (а) 11, 10, 10, частота альфа ритма, Гц 10, 10, 10, 9, 9, 9, 9, 9, 8, 8, REG: 2 4 REG: 2 4 До 1 3 5 1 3 5 утомления После Область Область утомления ЛЕВОЕ ПОЛУШАРИЕ ПРАВОЕ ПОЛУШАРИЕ (б) Рисунок 31. Частота индивидуального альфа ритма у полиморфизмов гена 5НТТ – LL (а) и LS+SS (б) до и после когнитивной нагрузки в правом и левом полушариях для 5 областей (1 – лобная;

2 – центральная;

3 –теменная;

4 – височная;

5 –затылочная).

В таблице 12 (б) представлены результаты по параметру индивидуального альфа ритма (ИАР) для носителей различных полиморфизмов гена DRD2 (A2A2 и А1А1+А1А2) до и после длительной когнитвной нагрузки. Генотип А2А2 характеризуется в целом большим значением ИАР, по сравнению с носителями А1-полиморфизма (А1А1+А1А2). Проведенный статистический анализ Т-тест выявил, что у носителей А1-аллеля (А1А1+А1А2 полиморфизмы) наблюдается значимое снижение частоты ИАР во фронтальной, теменной, затылочной областях, а также в среднем по всему скальпу. У носителей А2А2 полиморфизма значимых изменений не наблюдается.

Таблица 12(б) ИАР до и после утомления у гена DRD2.

Области A1A1+A1A A2A2 полиморфизм полиморфизмы мозга До После До После утомления утомления утомления утомления Лобная левая 9,63 (0,96) 10,10 (0,88) 9,53 (1,02)* 9,69 (1,01) Лобная правая 10,06 (0,87) 9,77 (0,96) 9,43 (1,06) 9,72 (1,08) Центральная левая 9,84 (0,70) 9,75 (0,98) 9,45 (1,10) 9,77 (1,10) Центральная правая 9,73 (1,03) 9,77 (0,79) 9,68 (1,03) 9,30 (1,07)* Теменная левая 9,89 (0,85) 9,96 (0,99) 9,68 (0,97) 10,04 (1,04) Теменная правая 10,23 (0,43) 10,10 (1,02) 9,73 (0,74) 10,01 (0,99) Височная левая 9,81 (0,95) 9,96 (0,92) 9,73 (0,96) 9,69 (1,14)* Височная правая 9,89 (0,93) 10,18 (0,51) 9,60 (0,91)* 9,80 (0,96) Затылочная левая 9,97 (1,05) 10,14 (0,82) 9,57 (0,77)* 9,90 (0,97) Затылочная правая 10,01 (0,98) 10,35 (0,53) 9,69 (0,70)* 9,69 (1,01) Ср.знач. (ст.откл.) *значимые изменения (p0.05) Статистический анализ ANOVA не выявил значимых различий между группами носителей полиморфизмов A2A2 и A1A1+A1A2. При этом у носителей А1-аллеля (A1A1+A1A2 полиморфизмы) наблюдается значимое уменьшение ИАР в обоих полушариях (F(1,11)=7,678;

p0,02) (рисунок 32, а), чего не наблюдается у носителей А2А2 полиморфизма (рисунок 32, б).

11, 11, частота альфа ритма, Гц 10, 10, 9, 9, 8, До 8, REG: 2 4 REG: 2 4 утомления 1 3 5 1 3 5 После утомления Область Область ЛЕВОЕ ПОЛУШАРИЕ ПРАВОЕ ПОЛУШАРИЕ (а) 11, 11, частота альфа ритма, Гц 10, 10, 9, 9, 8, До 8, утомления REG: 2 4 REG: 2 После 1 3 5 1 3 утомления ЛЕВОЕ ПОЛУШАРИЕ ПРАВОЕ ПОЛУШАРИЕ (б) Рисунок 32. Частота индивидуального альфа ритма у полиморфизмов гена DRD2 - A1A1+A1A2 (а) и A2A2 (б) до и после когнитивной нагрузки в правом и левом полушариях для 5 областей (1 – лобная;

2 – центральная;

3 –теменная;

4 – височная;

5 –затылочная).

В таблице 12 (в) представлены результаты по параметру индивидуального альфа ритма (ИАР) для носителей различных полиморфизмов гена СОМТ (ММ, MV и VV) до и после длительной когнитвной нагрузки. Статистический анализ выявил значимое уменьшение ИАР после когнитивной нагрузки только у полиморфизма MМ в лобной области обоих полушарий.

У полиморфизма VV и MV также наблюдается уменьшение частоты ИАР, но не значимое. Интересно отметить, что полиморфизм ММ характеризуется изначально самым высоким значением ИАР (среднее значение по всем областям 10,28 Гц), а также самым сильным относительным сниженим – до 9,82 Гц. VV полиморфизм характеризуется самым низким значением ИАР – 9,63 Гц, а также самым маленьким его уменьшением – до 9,45 Гц. Таким образом, получается, что полиморфизм ММ характеризуется самым высоким ИАР и до и после утомления.

Таблица 12(в) ИАР до и после утомления у гена СОМТ.

MM полиморфизм MV полиморфизм Области До После После После утомления утомления утомления утомления мозга Лобная левая 9,73 (0,91) 10,38 (0,50) 9,67 (0,97) 9,32 (1,45)* Лобная правая 9,83 (0,91) 10,26 (0,53) 9,69 (1,06) 9,57 (1,19)* Центральная левая 10,14 (0,72) 9,70 (0,97) 9,57 (1,34) 9,72 (1,15) Центральная правая 10,09 (0,62) 9,83 (0,94) 9,67 (1,35) 9,62 (1,05) Теменная левая 10,27 (0,60) 9,93 (0,97) 10,09 (0,74) 9,98 (1,07) Теменная правая 10,51 (0,46) 10,17 (0,85) 10,19 (0,56) 9,87 (1,07) Височная левая 10,27 (0,57) 9,87 (0,98) 9,73 (1,24) 9,82 (0,97) Височная правая 10,04 (0,57) 10,05 (0,80) 9,80 (1,07) 9,80 (0,94) Затылочная левая 10,48 (0,75) 10,05 (1,00) 10,08 (0,91) 9,79 (0,96) Затылочная правая 10,41 (0,60) 9,73 (0,91) 10,16 (0,87) 9,67 (0,97) Ср.знач. (ст.откл.) VV полиморфизм Области До утомления После утомления мозга Лобная левая 9,45 (1,20) 9,43 (0,86) Лобная правая 9,54 (1,15) 9,25 (1,00) Центральная левая 9,71 (0,97) 9,51 (0,96) Центральная правая 9,43 (0,96) 9,20 (0,99) Теменная левая 9,70 (1,00) 9,63 (0,92) Теменная правая 9,81 (1,10) 9,54 (0,78) Височная левая 9,46 (0,91) 9,29 (0,94) Височная правая 9,60 (1,03) 9,44 (0,79) Затылочная левая 9,71 (0,91) 9,55 (0,74) Затылочная правая 9,83 (1,05) 9,63 (0,66) Статистический анализ ANOVA не выявил значимых изменений у полиморфизмов гена СОМТ после утомления.

Б) Спектральный анализ данных ЭЭГ у носителей различных полиморфизмов генов 5НТТ, DRD2 и СОМТ.

Спектральный анализ, как было описано выше, подсчитывался двумя различными способами, отражающими разные спектральные параметры.

Первый способ характеризовал относительную мощность данного диапазона по сравнению с остальными. Второй же способ отражал усредненную мощность данного диапазона. Спектральный анализ вычислялся отдельно для каждой мозговой области.

Проведенный дисперсионный анализ ANOVA выявил, что наибольшие изменения после длительной когнитивной нагрузки наблюдаются в диапазоне нижнего альфа ритма в обоих условиях (закрытыми и открытыми глазами), а также в диапазоне бета ритма в условиях с закрытыми глазами.

Дисперсионный анализ ANOVA был также проведен отдельно для носителей различных полиморфизмов генов 5НТТ, DRD2 и COMT.



Pages:     | 1 || 3 | 4 |   ...   | 6 |
 





 
© 2013 www.libed.ru - «Бесплатная библиотека научно-практических конференций»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.