авторефераты диссертаций БЕСПЛАТНАЯ БИБЛИОТЕКА РОССИИ



Pages:     | 1 |   ...   | 3 | 4 || 6 |


-- [ Страница 5 ] --

363. Park S.J., Cotter P.A., Gunsalus R.P. Regulation of malate dehydrogenase (mdh) gene expression in Escherichia coli in response to oxygen, carbon, and heme availability. J.

Bacteriol. 1995, 177, 22;


364. Jiang G.R., Nikolova S., Clark D.P. Regulation of the ldhA gene, encoding the fermentative lactate dehydrogenase of Escherichia coli. Microbiology. 2001, 147, 9;

2437 2446.

365. Chen Y.M., Lin E.C. Regulation of the adhE gene, which encodes ethanol dehydrogenase in Escherichia coli. J. Bacteriol. 1991, 173, 24;


366. Membrillo-Hernandez J., Lin E.C. Regulation of expression of the adhE gene, encoding ethanol oxidoreductase in Escherichia coli: transcription from a downstream promoter and regulation by fnr and RpoS. J. Bacteriol. 1999, 181, 24;


367. Rest M.E., Frank C., Molenaar D. Functions of the membrane-associated and cytoplasmic malate dehydrogenases in the citric acid cycle of Escherichia coli. J. Bacteriol. 2000, 182, 24;


368. Saier, M.H., Ramseier, T.M., and Reizer, J. Regulation of carbon utilization. In Neidhart F.C. (eds.) Escherichia coli and Salmonella. Cellular and Molecular Biology, (1996), ASM Press, Washington, pp. 1325-1333.

369. Sprenger G.A., Schorken U., Sprenger G., Sahm H. Transaldolase B of Escherichia coli K 12: cloning of its gene, talB, and characterization of the enzyme from recombinant strains. J. Bacteriol. 1995, 177, 20;


370. Xu J., Johnson R.C. aldB, an RpoS-dependent gene in Escherichia coli encoding an aldehyde dehydrogenase that is repressed by Fis and activated by Crp. J. Bacteriol. 1995, 177, 11;


371. Figge R.M., Ramseier T.M., Saier M.H. The mannitol repressor (MtlR) of Escherichia coli.

J. Bacteriol. 1994, 176, 3;


372. Plumbridge J.A., Cochet O., Souza J.M., Altamirano M.M., Calcagno M.L., Badet B.

Coordinated regulation of amino sugar-synthesizing and -degrading enzymes in Escherichia coli K-12. J. Bacteriol. 1993, 175, 16;


373. Yang H., Liu M.Y., Romeo T. Coordinate genetic regulation of glycogen catabolism and biosynthesis in Escherichia coli via the CsrA gene product. J. Bacteriol. 1996, 178, 4;


374. Clark, D.P. and Cronan, J.E. Two-carbon compounds and fatty acids as carbon sources. In Neidhart F.C. (eds.) Escherichia coli and Salmonella. Cellular and Molecular Biology, (1996), ASM Press, Washington, pp. 343-357.

375. Campbell J.W., Morgan-Kiss R.M., Cronan J.E. A new Escherichia coli metabolic competency: growth on fatty acids by a novel anaerobic beta-oxidation pathway. Mol.

Microbiol. 2003, 47, 3;


376. Weimar J.D., DiRusso C.C., Delio R., Black P.N. Functional role of fatty acyl-coenzyme A synthetase in the transmembrane movement and activation of exogenous long-chain fatty acids. Amino acid residues within the ATP/AMP signature motif of Escherichia coli FadD are required for enzyme activity and fatty acid transport. J. Biol. Chem. 2002, 277, 33;


377. Cronan, J.E. and Rock, C.O. Biosynthesis of membrane lipids. In Neidhardt F.C. (eds.) Escherichia coli and Salmonella. Cellular and molecular biology, (1996), ASM Press, Washington, pp. 612-636.

378. Lin, E.C.C. Amino acids as carbon sources. In Neidhardt F.C. (eds.) Escherichia coli and Salmonella. Cellular and molecular biology, (1996), ASM Press, Washington, pp. 358-379.

379. Hassan H.M., Sun H.C. Regulatory roles of Fnr, Fur, and Arc in expression of manganese-containing superoxide dismutase in Escherichia coli. Proc. Natl. Acad. Sci. U.

S. A. 1992, 89, 8;


380. Zientz E., Janausch I.G., Six S., Unden G. Functioning of DcuC as the C4-dicarboxylate carrier during glucose fermentation by Escherichia coli. J. Bacteriol. 1999, 181, 12;

3716 3720.

381. Ailion M., Bobik T.A., Roth J.R. Two global regulatory systems (Crp and Arc) control the cobalamin/propanediol regulon of Salmonella typhimurium. J. Bacteriol. 1993, 175, 22;


382. Kammler M., Schon C., Hantke K. Characterization of the ferrous iron uptake system of Escherichia coli. J. Bacteriol. 1993, 175, 19;


383. Porco A., Alonso G., Isturiz T. The gluconate high affinity transport of GntI in Escherichia coli involves a multicomponent complex system. J. Basic Microbiol. 1998, 38, 5-6;


384. Black P.N. Primary sequence of the Escherichia coli fadL gene encoding an outer membrane protein required for long-chain fatty acid transport. J. Bacteriol. 1991, 173, 2;


385. Lombardo M.J., Lee A.A., Knox T.M., Miller C.G. Regulation of the Salmonella typhimurium pepT gene by cyclic AMP receptor protein (CRP) and FNR acting at a hybrid CRP-FNR site. J. Bacteriol. 1997, 179, 6;


386. Strauch K.L., Lenk J.B., Gamble B.L., Miller C.G. Oxygen regulation in Salmonella typhimurium. J. Bacteriol. 1985, 161, 2;


387. Compan I., Touati D. Anaerobic activation of arcA transcription in Escherichia coli: roles of Fnr and ArcA. Mol. Microbiol. 1994, 11, 5;


388. Schneider R., Lurz R., Luder G., Tolksdorf C., Travers A., Muskhelishvili G. An architectural role of the Escherichia coli chromatin protein FIS in organising DNA.

Nucleic Acids Res. 2001, 29, 24;


389. Ninnemann O., Koch C., Kahmann R. The E.coli fis promoter is subject to stringent control and autoregulation. EMBO J. 1992, 11, 3;


390. Raivio T.L. Envelope stress responses and Gram-negative bacterial pathogenesis. Mol.

Microbiol. 2005, 56, 5;


391. Iuchi S., Furlong D., Lin E.C. Differentiation of arcA, arcB, and cpxA mutant phenotypes of Escherichia coli by sex pilus formation and enzyme regulation. J. Bacteriol. 1989, 171, 5;


392. Christman M.F., Storz G., Ames B.N. OxyR, a positive regulator of hydrogen peroxide inducible genes in Escherichia coli and Salmonella typhimurium, is homologous to a family of bacterial regulatory proteins. Proc. Natl. Acad. Sci. U. S. A. 1989, 86, 10;

3484 3488.

393. Bagg A., Neilands J.B. Ferric uptake regulation protein acts as a repressor, employing iron (II) as a cofactor to bind the operator of an iron transport operon in Escherichia coli. Biochemistry. 1987, 26, 17;


394. Sutton V.R., Mettert E.L., Beinert H., Kiley P.J. Kinetic analysis of the oxidative conversion of the [4Fe-4S]2+ cluster of FNR to a [2Fe-2S]2+ cluster. J. Bacteriol. 2004, 186, 23;


395. Georgellis D., Kwon O., Lin E.C., Wong S.M., Akerley B.J. Redox signal transduction by the ArcB sensor kinase of Haemophilus influenzae lacking the PAS domain. J. Bacteriol.

2001, 183, 24;


396. Sengupta N., Paul K., Chowdhury R. The global regulator ArcA modulates expression of virulence factors in Vibrio cholerae. Infect. Immun. 2003, 71, 10;


Приложение 1.

Множественное выравнивание для белков FruR. Участки, соответствующие последовательности HTH, показаны белым шрифтом на темном фоне. Условные обозначения: “*” – абсолютно консервативная позиция;

“:” – позиция с высокой степенью консервативности;

“.” – позиция с низкой степенью консервативности. Обозначения геномов: см. Табл. 2.




Приложение 2.

Последовательности потенциальных сайтов связывания белка FruR. Указано положение сайта относительно старта трансляции гена. Позиции сайта, совпадающие с консенсусом, показаны прописными буквами, несовпадающие – строчными.

Сайт Геном Оперон Положение Вес Последовательность ctTGAAaCGtTTCAGC -101 4, E. coli fruBKA GCTGAATCGtTTCAat -34 5, agTtAAcCGATTCAGt -124 4, mtlADR aaTtAATCGtTaCAGg -246 3, ptsHI-crr GCTGAATCGATTttat -220 4, tCTGAATCGATTCgat -83 3, manXYZ GCTGAAaCGATaaAGt -133 4, glk GCTGgcgCGATTCAcC -89 4, fbp GCTGAAgCGtTTCAGt -136 5, epd-pgk-fbaA aCTGAAaCGtTTttGC -112 4, edd-eda GtTGAAcCGATTaAGC -160 4, tpiA atTGAcaCGATTCcGC -88 3, gapA agaaAAcCGtTTCAcC 54 3, gpmA GgTGAATCGATaCttt -287 3, pckA GCTtgAaCGATTCAcC -101 4, ppsA cCTGAATCaATTCAGC -122 4, pfkA ctTGAATgGtTTCAGC -222 4, pykF agTGAATCGgTTCAat -252 4, pdhR-aceEF-lpdA GCTGAATCGcTTaAcC -247 4, icdA GCTGAAagGtgTCAGC -263 4, adhE cgTtAAgCGATTCAGC -251 4, aceBAK aCgGAcaCGATTCAaC -282 3, nuoABCDEFGHIJKLMN GCTGAATCGtTaagGt -48 3, nirBDC-cysG GCTGgAagGtTTaAcC -55 4, copA GCTGAAgCGAgaCAcC -221 4, crp GCTGAAgCctTTtAtg -224 3, S. typhi fruBKA ctTGAAaCGtTTCAGC -102 4, GCTGAATCGtTTCAat -36 5, agTtgAaCGATTCAGt -123 4, mtlADR aaTtAATCGtTaCAGg -244 3, ptsHI-crr GCTGAATCGATTttat -218 4, tCTGAATCGATTCgct -82 3, manXYZ GCTGgcgCGATTCAcC -88 4, fbp GCTGAAgCGtTTCAGt -136 5, epd-pgk-fbaA cCTGAAaCGATTttGC -114 4, edd-eda GtTGAAcCGATTaAGC -164 4, tpiA atTGAcaCGATTCcGC -86 3, gapA agaGAAcCGtTTCAcC 52 4, gpmA Сайт Геном Оперон Положение Вес Последовательность GgTGAATCGATattGt -286 4, S. typhi pckA GCTtgAaCGATTCAcC -104 4, ppsA cCTGAATCaATTCAGC -121 4, pfkA ctTGAATgGtTTCAGC -220 4, pykF GtTGAATCGgTTCAGa -254 4, pdhR-aceEF-lpdA GCTGAATCGcTTaAcg -245 4, icdA GCTGAAagGtgTCAGC -266 4, adhE cCTaAAgCGtTTCAGC -251 4, aceBAK aCgGAcaCGATTCAaC -282 3, nuoABCDEFGHIJKLMN GCTGAATCGtTaagGt -46 3, nirBDC-cysG GtTtAAatGcTTCtGC -245 3, copA GCTGAAgCGAgaCAcC -224 4, crp GCTGAAgCctTTtAtg -221 3, S. typhimurium fruBKA ctTGAAaCGtTTCAGC -100 4, GCTGAATCGtTTCAat -34 5, agTtgAaCGATTCAGt -125 4, mtlADR aaTtAATCGtTaCAGg -246 3, ptsHI-crr GCTGAATCGATTttat -220 4, tCTGAATCGATTCgct -84 3, manXYZ GCTGgcgCGATTCAcC -88 4, fbp GCTGAAgCGtTTCAGt -136 5, epd-pgk-fbaA cCTGAAaCGATTttGC -112 4, edd-eda GtTGAAcCGATTaAGC -162 4, tpiA atTGAcaCGATTCcGC -86 3, gapA agaGAAcCGtTTCAcC 54 4, gpmA GgTGAATCGATattGt -288 4, pckA GCTtgAaCGATTCAcC -104 4, ppsA cCTGAATCaATTCAGC -123 4, pfkA ctTGAATgGtTTCAGC -220 4, pykF GtTGAATCGgTTCAGa -254 4, pdhR-aceEF-lpdA GCTGAATCGcTTaAcg -247 4, icdA GCTGAAagGtgTCAGC -266 4, adhE cCTaAAgCGtTTCAGC -251 4, aceBAK aCgGAcaCGATTCAaC -282 3, nuoABCDEFGHIJKLMN GCTGAATCGtTaagGt -48 3, nirBDC-cysG GtTtAAatGcTTCtGC -243 3, copA GCTGgAagGtTTaAcC -85 4, GCTGAAgCGAgaCAcC -226 4, crp ttTGAAaCGtTTCAGC -103 4, P. carotovorum fruBKA GCTGAAaCGATTCAaC -36 5, GCTGAAgCGtTTCAGt -118 5, epd-pgk-fbaA GCTGAATCGAgTaAag -389 4, edd atTGAcaCGATTCcGC -94 3, gapA GCTGAAaCGgTaaAGC -149 4, gpmA GgTtgATCGATTCAcC -118 4, ppsA Сайт Геном Оперон Положение Вес Последовательность cCTGAATCaATTCAGC -135 4, P. carotovorum pfkA atTGAATgGtTTCAGC -240 4, pykF atTtAAaCGgTTCAGC -253 4, pdhR-aceEF-lpdA GCTGAATCGtTTaAct -175 4, icdA GCTGAATgGtgTCAGC -339 4, adhE aCTGAcTCGATTtAGC -257 4, nuoABCDEFGHIJKLMN GCTGAAgCGAgaCAaC -297 4, crp ttTGAAaCGtTTCAGC -105 4, P. chrysanthemium fruBKA GCTGAAaCGATTCAag -37 5, cCTGAATCGATTCAta -195 4, manXYZ GCTGAAatGATTCttg 47 3, aCTGAAgCtgTTtAGC -253 3, glk GCTGAAgCGtTTCAGt -154 5, epd-pgk-fbaA GtTGAAcCGATTaAGC -178 4, tpiA atTGAcaCGATTCcGC -88 3, gapA GCTGAAaCGATaaAGC -146 4, gpmA GgTtgATCGATTCAcC -109 4, ppsA cCTGAATCaATTCAGC -117 4, pfkA GgaagAaCGATTCAGC -144 4, pykA GgTtgAaCGgTTCAGC -254 4, pdhR-aceEF-lpdA GCTGAATCGtTTaAGt -174 5, icdA GCTGAATgGtgTCAGC -314 4, adhE GCTGAAgCGAgaCAaC -307 4, crp atTGAAaCGtTTCAGC -101 5, Y. pestis fruBKA GCTGAAaCGATTCAat -35 5, GCTGAATCGATTtAcC -331 5, ptsHI-crr cCTGAATCGATTCAtt -158 4, manXYZ GCTGAAatGATTttag 59 3, GCTGAAaCGtTTttat -126 4, glk GCTGAAgCGtTTCAGt -160 5, epd-pgk-fbaA GtTGAAcCGATTaAGC -165 4, tpiA atTGAcaCGATTCcGC -79 3, gapA GCaGAATCGATTCgGC -194 4, gpmA GgTtgATCGATTCAcC -194 4, ppsA ctTGAATCaATTCAGC -143 4, pfkA GtTGAATgGtTTCAGC -257 4, pykF aCTatAaCGcTTCAGC -201 4, pdhR-aceEF-lpdA GCTGAATCGgTTaAct -125 4, icdA GCTGAATgGtgTCAGC -308 4, adhE aCTGAcTCGATTtAGC -258 4, nuoABCDEFGHIJKLMN GCTGAtaCctTTCAGC -167 4, nirBDC-cysG GCTGgAagGtTTaAcC -182 4, copA GCTGAAgCGATaCAaC -254 4, crp agTGAAggGtTTCtat -155 3, Сайт Геном Оперон Положение Вес Последовательность ctTGAAaCGtTTCAGC -103 4, Y. enterocolitica fruBKA GCTGAAaCGATTCAat -37 5, GCTGAATCGATTtAtC -286 4, ptsHI-crr cCTGAATCGATTCAtt -221 4, manХYZ GCTGAAaCGtTTttat -131 4, glk GCTGAAgCGtTTCAGt -159 5, epd-pgk-fbaA GtTGAAcCGATTaAGC -162 4, tpiA atTGAcaCGATTCcGC -88 3, gapA atTaAATCGATTCgaC -212 3, gpmA GgTtgATCGATTCAcC -163 4, ppsA ctTGAATCaATTCAGC -145 4, pfkA GtTGAATgGtTTCAGC -258 4, pykF aCTatAaCGcTTCAGC -285 4, pdhR-aceEF-lpdA GCaGAgaCGATTCAct -49 4, GCTGAATCGgTTaAct -176 4, icdA GCTGAATgGtgTCAGC -310 4, adhE aCTGAcTCGATTtAGC -257 4, nuoABCDEFGHIJKLMN aCTGAAaCcATTCAGC -168 5, nirBDC-cysG GCTGtAagGtTTaAcC -141 4, copA GCTGAAgCGATaCAaC -255 4, crp agTGAAggGtTTCtat -156 3, atTGAAaCGtTTCAGC -103 5, Y. pseudotuberculosis fruBKA GCTGAAaCGATTCAat -37 5, GCTGAATCGATTtAcC -333 5, ptsHI-crr cCTGAATCGATTCAtt -156 4, manXYZ GCTGAAaCGtTTttat -127 4, glk GCTGAAgCGtTTCAGt -160 5, epd-pgk-fbaA GtTGAAcCGATTaAGC -163 4, tpiA atTGAcaCGATTCcGC -86 3, gapA GCaGAATCGATTCgGC -276 4, gpmA GgTtgATCGATTCAcC -230 4, ppsA ctTGAATCaATTCAGC -145 4, pfkA GtTGAATgGtTTCAGC -258 4, pykF aCTatAaCGcTTCAGC -273 4, pdhR-aceEF-lpdA GCaGAgaCGATTCAct -37 4, GCTGAATCGgTTaAct -174 4, icdA GCTGAATgGtgTCAGC -308 4, adhE aCTGAcTCGATTtAGC -256 4, nuoABCDEFGHIJKLMN GCTGAtaCctTTCAGC -169 4, nirBDC-cysG GCTGgAagGtTTaAcC -182 4, copA GCTGAAgCGATaCAaC -256 4, crp agTGAAggGtTTCtat -157 3, ctTGAAaCGtTTCAGC -99 4, S. marcescens fruBKA GCTGAAaCGATTCAat -33 5, GCTGAATCGATTtAct -254 4, ptsHI-crr GCTGAAaCGtTTtttg -125 4, glk Сайт Геном Оперон Положение Вес Последовательность GCTGAAgCGtTTCAGt -208 5, S. marcescens epd-pgk-fbaA GtTGAAcCGATTaAGC -164 4, tpiA atTGAcaCGATTCcGC -88 3, gapA GCctgAaCGATTCAGC -150 4, gpmA GgTtgATCGATTCAcC -132 4, ppsA ctTGAATCaATTCAGC -141 4, pfkA GtTGAATgGtTTCAGC -237 4, pykF GCTGAAagGtgTCAGC -306 4, adhE aCTGAcaCGATTtAGC -270 4, nuoABCDEFGHIJKLMN aCTGAcTCGcTTCAGC -167 4, nirBDC-cysG GCTGAAgCGAgaCAaC -301 4, crp GtTGAAaCGtTTCAGt -105 5, P. luminescens fruBA aCTGAAaCGATTCtat -39 4, aCTGAAaCGATTCAat -87 5, fruK GCTGAATCGtTTCAtt -140 5, epd-pgk-fbaA atTGAAcCGATTaAGC -177 4, tpiA atTGAcaCGATTCcGC -89 3, gapA agaGAAcCGtTTCAct 54 4, gpmA GgTtgATCGATTCAcC -113 4, ppsA GtTGAATCaATTCAGC -140 4, pfkA GtTGAATgGtTTCAGC -344 4, pykF GCTGAAagGAaTCAGC -163 4, adhE aCTGAcaCGtTTtAGC -253 4, nuoABCDEFGHIJKLMN GCTGAAaCaATaCAag -240 3, crp GCTtgATtGtTTCAGt -126 4, GCTGAATCGATTCAGt -386 5, V. vulnificus fruBKA GCTGAAagGATTCAGC -364 5, GCTGAATCGgTTCAGC -214 5, GCTGAAcCGATTCAGC -259 5, fruR GCTGAATCctTTCAGC -109 5, aCTGAATCGATTCAGC -87 5, GCTGAAcCGATTCAGt -293 5, V. parahaemolyticus fruBKA GCTGAAagGATTCAGC -271 5, GCTGAATCGATTCAGt -113 5, aCTGAATCGATTCAGC -267 5, fruR GCTGAATCctTTCAGC -109 5, aCTGAATCGgTTCAGC -87 5, GCTGAATCGATTCAGt -265 5, V. cholerae fruBKA GCTGAAagGATTCAGC -243 5, GCTGAAcCGATTCAGC -116 5, GCTGAATCGgTTCAGC -238 5, fruR GCTGAATCctTTCAGC -111 5, aCTGAATCGATTCAGC -89 5, GCTGAATCGATTCAGt -211 5, V. fischery fruBKA GCTGAAagGATTCAGC -189 5, GCTGAATCGATTCAGt -80 5, Сайт Геном Оперон Положение Вес Последовательность aCTGAATCGATTCAGC -221 5, V. fischery fruR GCTGAATCctTTCAGC -112 5, aCTGAATCGATTCAGC -90 5, GCTGAAaCGATTCAGt -241 5, P. profundum fruBKA GCTGAAagGtTTCAGC -219 5, GCTGAAaCGATTCAGC -152 5, GCTGAATCGtTTCAGC -204 5, fruR GCTGAAaCctTTCAGC -137 5, aCTGAATCGtTTCAGC -115 5, agTGAATCGATTCAGC -250 5, P. aeruginosa fruB/ptsI-fruKA GCTGAATCGATTCAct -93 5, fruR GaTtAAaCGtTTCAGC -130 4, P. putida fruB/ptsI-fruKA GCTGAAaCGtTTaAtC -170 4, fruR GaTtAAaCGtTTCAGC -163 4, P. fluorescens fruB/ptsI-fruKA GCTGAAaCGtTTaAtC -158 4, fruR aCaGAATCGAgTaAcg -198 3, P. syringae fruB/ptsI-fruKA GaTtAAaCGATTCAGC -167 4, GCTGAATCGtTTaAtC -203 4, fruR cgTtAcTCGATTCtGt -172 3, Приложение 3.

Множественное выравнивание для белков FruB и PtsI из E. coli и химерного белка из Pasteurellales. Выделены последовательности, соответствующие белкам FruB и PtsI E. coli.

Обозначения геномов: см. Табл. 2.








Приложение 4.

Множественное выравнивание нуклеотидных последовательностей fruR-fruB/ptsI из Pasteurellales. Условные обозначения: кодинующие последовательности показаны заглавными буквами, некодирующие – строчными;

потенциальные сайты связывания FruR показаны белым на темном фоне;

консервативные позиции помечены звездочками.

Обозначения геномов: см. Табл. 2.

fruR PPU GGCGATATCGCTGAGTTTCAC----------------------------------------cgaattttccttgttattacc PFO CGCGATATCACTGAGTTTCAA--------------------------------------cccgggatttccttgttttttc PST TGCAATATCGCTCAGTTTCACcccgaaaattcctttagttggccaggcggctcaggaccgtcgaattgttttcgccgtggc PAE GGCGATATCACTGAGTTTCAA-------------------------------------aaccgatctctactggaggcgacg ** ***** ********** ** ** ** * PPU ggggctgcctgtaaggccggaccgggtagtttgacccggtacaggcatcacgcgcagacgaccattgtcgcaat-tgt-ccg PFO -gagcttgccgcgacatt---ttcgccaatcctacccgattcaggca---------ggcgaccattgtctcagcgcat-ccg PST ggcgatcattacaccagaccgtaggaaattcctaagtacttcaagtattt------taggaagtctcctacagc-gat-cgg PAE acaagttgggcttcaagg--atcaatcattatcgggtaacgtgccaatttaattaagtgaatcgattcagcaaaagattccg * ** * * * ** *** PPU ac-aggatggggctttttactgggcagattatcgagtaacgtg---gccgtctggt-ca-gattaaacgtttcagctg--cc PFO ac-aagttggacttcaaggatggg-acattatcgagtaacgtg---ccaatcaatc-ta-gattaaacgtttcagcaa--gc PST ac-cgactgggcttcaatga-acgcacagaatcgagtaacgtg---ccgggcaattgta-gattaaacgattcagcac--gc PAE gcgaagccggcgccccctgccccaggctgcctcgcgcagcccgaacgcggcgccgcctacgctatggcaggtcaatgacaac * ** *** * * * * * * ** * *** * PPU gaattttctgc------------ctcggctgccacccgcgcaa-ggttgctgaa-ctggccctttatgtgaatttcacaa-- PFO gtattttctacgttttagacgcctttggccggttctgccgtga-aaccgccaaaactgcctcctgaagggaagctgacaagcg PST ctgttgtctgc-tgcaatcgagatgaaactgatgtccg-atag-gatattcgatgggcatcactttcatcctcttagctgtcg PAE aagcggatcaccgcccctggctgtacggaaggctcccgcgagccgctttccgctaccgccggcacatcccgcgcccgcgcct * * * fruB/ptsI PPU -caatactccagta---cccgaacgggaact--gcaaaaggagaaggtc------------------ATGCTCGAGCTCGCCA PFO cctaagctgcaaccat-tcaaaacaatacct--ggcgtcacacgacgccaaaaaggagatcgca---ATGCTCGAGCTCACTG PST atcacatgtgatcgccattaaaacaagaatcaggtggcgccctggcgctgcacaggagtcaaggcaaATGCTCGAACTCACTC PAE -cggcgcggcgggacgatccggacgtgagacggggagccgttcgctcctgaggaggtttcc------ATGCTCGAACTCGATA ** * * ******** *** Приложение 5.

Множественное выравнивание нуклеотидных последовательностей fruR-fruB межгенных промежутков из Vibrionales. Условные обозначения: см. Приложение 4.

Обозначения геномов: см. Табл. 2.

fruR VPA ATCCAGTGTCAT---------------------tat--tctcaaccct--a---ttct--gtgcgcgcg-atcata----tt VVU ATCCAGTGTCAT---------------------tat--tacctaccct--a---atct--gtgcgcctg-atcataga--tt VFI ATCTAATGTCAT---------------------tggg-taaggatcctcaa---tttt--gtg-gttcggatcatagaaata VCH ATCCAGTGTCAT---------------------taa---gggggtctc--g---ttttatgtgcgtctg-atcatagaa-cg PPR ATCTAACGTCATgatgagttcttatcgtttgcttataatagagattaaaaagagattt--gtgcgcttg-atcatataatcg *** * ***** * * * *** * * ****** VPA --aatacatcaacgatc--ttac-g-ata-agttg-aattataagctgaaccgattcagtataaaagctgaaaggattcagc VVU cgaat---tcca-gatc--tt-c-gcgtc-tgttg-aattatacgctgaatcgattcagtataaaagctgaaaggattcagc VFI tagat---ccaatcagc--tta--g-gt---gttg-aattatacgctgaatcgattcagtataaaagctgaaaggattcagc VCH c-gat---ttt-tgatc--cta--gcctagtgttg-aattatacgctgaatcgattcagtattaaagctgaaaggattcagc PPR caaat--------gatcctttatagaaca--attgcaatcata-gctgaaacgattcagtatgtctgctgaaaggtttcagc ** ** * * *** *** *** ****** *********** ********* ****** VPA aaaa-t-ctaaaaattgaccaaaatcacc-aa---aat----ccggcaa--tg--cagtaagtcttcgt-ctaggct-t-ta VVU aaaa-t-ctgcaaatagacatacatcacctaattgaatgattttgtcgaattgaacagcat-tctcggtattgaact-cgtt VFI aaa--t-ttgaaaa---gcgtg-at-----------at----ttg-cg-------c--tat-tttt--------act-cata VCH aaaagtaccgttgatt--caca-atc----------------tcgtcca------ctacaaaggtc------agattgtgtc PPR aaagct-cta-aaat--gt-taagtggc---------t----tt----------actgaaactttt-------aatt---tc *** * * * * * * * VPA agcaata--ca-gct-caag---gggtgt--ttaacgttag-attttt--aaaacatttt--gctaagtc--tt----ttaa VVU ggccgtgtccacgttgtaaataaaagtgccgtt--tgctga-atttttttaaaccaatt---gctgaatcggttcagcttaa VFI a---atg--cgaatt-taa-------tgc-------gtaga-aat-----aaa----ttt--gttgaact--tt----tt- VCH ga--gtatcca-gcagcaag-----at-c-------gtgagtattc----gag--gtttt--gctgaat---tt----tt- PPR a---gca--aaagctgaaacgattcagc----------------------------ttttaggttgaag----------ta ** ** *** * VPA -------aaaattt--gc--cact-ta-----gctgaatcgattcagtatcgaaagaag-g--tttagcta-a-gacac-- VVU gttaagcaaaagttaagcaacgctgtgaaagtgcttaa-cgctccaa-atctaagggtgtgcttttaacca-aaggcgcttt VFI ------------ttgagt---gcttt------gctgaatcgattcagt--tt------g----ttttgc-a-a-ggca--- VCH ------------tt--gc---cctttg----tgctgaaccgattcagc--tcaaaggaa-------aacgagacgggatgaa PPR ------------tc-aac----ttata-----attaca-cgacgt-g--tcgatgggtatg---ttaactg---ggtatg- * ** * * ** * VPA --aacaaaactag-------agcaa----gact-----------gaatacatttt------ta-----at---ttga-ttgg VVU taggcaaagacagtctgttaagcaaagcagacttcttaaacaaagaagacctctcacaccgtagagaaacaggttgaaccga VFI ---ataaa--ta----------c------gatt-----------gatta--tc---------ag----------tga----a VCH t-gacaagg-tatt-------gcttc---aact-----------gaaaacctgcagcgatacat---cacatctcg--ccta PPR --aatagagattttt------acctc---ggtt------------attagtactaat----cag----acaaataga--aga * * * ** * * fruB VPA tacgaat----acctta-aggctggagaagcaccATGCTTAAGCTAAACAAGAACGACATTACCCTCTCGCAATCAGCGGCA VVU gagaaatgacgacgcgatacgctaagaaggcaacATGCTCAAATTAACTTCATCAGATATTACGCTCCAGCAGAGCGCCGAC VFI catagat----a-gcgagaggct---aagac-ccATGCTGACATTAACAAAGAATGACATTACGCTGCAGCAGTCAGCAGCG VCH tagaggc----agacagga-gtt---aaga----ATGTTAGAACTCACTACACAAGATATTCAATTGCAGCAACACTTTGCG PPR cagaaat------ccagtggagt--gaattca--ATGTTGTCACTATCTCAGAACGATATTCAGTTAAAGCAAACCGCTACC * * * *** * * ** *** * *** Приложение 6.

Множественное выравнивание для белков PurR и RbsR. Условные обозначения: см.

Приложение 1. Обозначения геномов: см. Табл. 2.




Приложение 7.

Последовательности потенциальных сайтов связывания белка RbsR. Указано положение сайта относительно старта трансляции гена. Позиции сайта, совпадающие с консенсусом, показаны прописными буквами, несовпадающие – строчными. 1) Сайты, обнаруженные в геномах, где отсутствует ген регулятора.

Сайт Геном Оперон Положение Вес Последовательность E. coli TCAGCGAAACGTTTCGcTGA -32 6, rbsDACBKR ctAGCGAAACGTTTCGAcGg -110 6, S. typhi rbsDACBKR cCAGCGAAACGTTTCGcTag -31 6, ctAGCGAAACGTTTCGAcGg -112 5, S. typhimurium rbsDACBKR cCAGCGAAACGTTTCGCTAg -33 6, TtAGCGAAACGTTTCGATGg -110 6, P. carotovorum rbsDACBKR TtAGCGAAACGTTTCGCTGg -33 6, TtATCGAAACGTTTCGATAg -111 6, P. luminescens rbsDACBKR atAGCGAAACGTTTCGCTAA -33 5, TCAtCGAAACGTTTCGATGA -45 6, P. multocida rbsDACBKR TtAtCGAAACGTTTCGATaA -38 6, H. influenzae rbsDACBKR TCAtCGAAACGTTTCGATGt -36 6, V. cholerae rbsDACBKR TtAcgcAAACGTTTCGATGA -72 5, V. fischeri rbsDACBKR cCATCGAAACGTTTCGATGA -225 6, V. parahaemolyticus rbsDACBKR gCATCGAAACGTTTCGATGA -95 6, TCATCGAAACGTTTCGATGA -73 6, V. vulnificus rbsDACBKR cCATCGAAACGTTTgcgTAA -119 5, P. profundum rbsDACBKR 1) TtAGCGAAACGTTTCGCTcT -32 6, rbsDK Y. pestis 1) TtAGCGAAACGTTTCGCTcT -32 6, rbsDK Y. pseudotuberculosis Приложение 8.

Последовательности потенциальных сайтов связывания белка PurR. Указано положение сайта относительно старта трансляции гена. Позиции сайта, совпадающие с консенсусом, показаны прописными буквами, несовпадающие – строчными.

Сайт Геном Оперон Положение Вес Последовательность AgGCAAACGTTTaCcT -61 4, E. coli purR gaGCAAACGTTTcCac 27 4, AaGaAAACGTTTtCGc -357 4, prsA ACGCAAACGTgTGCGT -168 4, purC AgGaAAACGaTTGgcT -122 4, purA AaGCAAACGgTgattT -23 3, ACGCAAACGTTTtCGT -54 5, purT ACGCAAACGgTTtCGT -91 4, purL ACGCAAtCGgTTaCcT 185 4, purB ACGCAAcCGTTTtCcT -86 4, purEK ACGCAAACGTTTtCtT -71 4, cvpA-purF tCGCAAACGTTTGCtT -80 4, purMN gCGCAAACGTTTtCGT -122 4, purHD AtGCAAtCGgTTaCGc -68 4, guaBA ACGCAAtCGTTaaCcT -76 3, yhhP ACGaAAACGaTTGCtT -83 4, codBA AaGCAAACGTTTGCGa -233 4, upp-uraA AgGaAAACGTTTcCGc -66 4, pyrC cgGaAAACGTTTGCGT -103 4, pyrD gCGCAAgCGTTTtCca -237 3, carAB AataAAcCGTTTGCGc -91 3, pyrLBI AaGaAAcCGgTTGCGc -133 4, speAB AtGCAAACGaTTtCaa -82 4, glnB AaGagAACGaTTGCGT -105 4, gcvTHP ggtaAAACGaTTGCGc 22 3, folD AgGtAAtCGTTTGCGT -133 4, glyA ACGCAAACGTTcataT -94 3, serA ACGCAAtCGaTTaCGT -153 4, tsx AaGCAAACGTTTGCca -226 4, gltS ACGCAAtCGTTgcCGT -114 4, yieG ACGatAACGTTTGCGc -273 4, yjcD AgctAAACGTTTGCtT -131 3, gtGCgAcCGTTTtCGT 28 3, rnt gCGtAAcCGaTTGCaT -109 3, xseA tgGCAAACGTTTGCtT -69 4, yicE AgGttAACGaTTGCGT -160 3, yhhQ ACGCAAACGaTTtacT -223 4, ydiJ AgGCAAACGTTTaCcT -57 4, S. typhi purR ggGCAAACGTTTcCac 29 4, AaGaAAACGTTTtCGc -472 4, prsA ACGCAAACGTgTGCGT -132 4, purC AgGaAAACGaTTGgcT -121 4, purA AaGCAAACGgTgattT -23 3, Сайт Геном Оперон Положение Вес Последовательность ACGCAAACGTTTtCGT -50 5, S. typhi purT ACGCAAACGgTTtCGT -91 4, purL ACGCAAACGgTTaCcT 183 4, purB ACGCAAcCGTTTtCcT -88 4, purEK ACGCAAACGTTTtCtT -73 4, cvpA-purF tCGCAAACGTTTGCtT -77 4, purMN gCGCAAACGTTTtCGT -124 4, purHD AtGCAAcCGaTTaCGT -63 4, guaBA ACGCAAtCGTTaaCcT -78 3, yhhP ACGaAAACGTTTGCtT -75 4, codBA AaGCAAACGTTTGCGa -351 4, upp-uraA ACGaAAACGTTTcCGc -66 4, pyrC AgGaAAACGaTTGCta -100 4, pyrD gCGCAAgCGTTTtCta -237 3, carAB AaGaAAcCGgTcGCGc -133 3, speAB AaGagAACGTTTGCGT -107 4, gcvTHP ggtaAAACGaTTGCGc 20 3, folD AgGtAAtCGTTTGCGT -133 4, glyA ACGCAAtCGaTTaCGT -155 4, tsx gCGCAAcCGgTTGCGc -273 4, gltS AaGCAAACGaTTGCGa -175 4, AaGCAAACGTTTGCta -186 4, yicE tCGCAAtCGTTTGCtT -67 4, ACGCAAACGTTTcCta 81 4, yieG ACGatAACGTTTGCGc -272 4, yjcD AgctAAACGTTTGCtT -129 3, gtGCgAcCGTTTtCGT 30 3, rnt ACGtAAtCGgTTGCaT -107 4, xseA AgGttAACGaTTGCGT -107 3, yhhQ ACGCAAACGaTTaaGc -101 4, ydiJ AgGCAAACGTTTaCcT -57 4, S.

typhimurium purR ggGCAAACGTTTcCac 29 4, AaGaAAACGTTTtCGc -474 4, prsA ACGCAAACGTgTGCGT -130 4, purC AgGaAAACGaTTGgcT -121 4, purA AaGCAAACGgTgattT -23 3, ACGCAAACGTTTtCGT -38 5, purT ACGCAAACGgTTtCGT -89 4, purL ACGCAAACGgTTaCcT 185 4, purB ACGCAAcCGTTTtCcT -86 4, purEK ACGCAAACGTTTtCtT -71 4, cvpA-purF tCGCAAACGTTTGCtT -15 4, purMN gCGCAAACGTTTtCGT -122 4, purHD AgGCAAcCGaTTaCGT -79 4, guaBA ACGCAAtCGTTaaCcT -76 3, yhhP AaGCAAACGTTTGCcT -77 4, codBA AaGCAAACGTTTGCGa -350 4, upp-uraA ACGaAAACGTTTcCGc -64 4, pyrC Сайт Геном Оперон Положение Вес Последовательность AgGaAAACGaTTGCta -102 4, S. typhimurium pyrD gCGCAAgCGTTTtCta -237 3, carAB AaGaAAcCGgTcGCGc -133 3, speAB AaGagAACGTTTGCGT -107 4, gcvTHP taGCAAACGTTTtCtT -40 4, folD AtGCAAtCGTTTGCGT -125 4, glyA gCGCAAcCGgTTGCGc -272 4, gltS AaGCAAtCGTTTGCGT -191 4, tCGCAAtCGTTTGCtT -69 4, yicE ACGCAAtCGTTgcCGT -117 4, yieG ACGatAACGTTTGCGc -272 4, yjcD AgctAAACGTTTGCtT -129 3, gtGCgAcCGTTTtCGT 30 3, rnt ACGtAAtCGgTTGCaT -109 4, xseA AgGttAACGaTTGCGT -109 3, yhhQ ACGCAAACGaTTaaGc -101 4, ydiJ AgGCAAACGaTTaaca -61 3, Y. pestis purR ACGCAAtCGTTTtCGT -86 4, purT ACGCAAACGgTTtCGT -131 4, purL ACGCAAACGcTTaCcT 194 4, purB ACGCAAcCGTTTtCcT -115 4, purEK ACGCAAACGTTTtCtT -75 4, cvpA-purF tCGCAAACGTTTGCcT -241 4, purMN ACGCAAtCGTTTtCGc -110 4, purHD AgGCAAtCGaTTaCGc -90 4, guaBA ACGCAAACGaTTaaGg -30 3, yhhP AgGCAAACGTTTGCGa -138 4, upp-uraA tCGCAAACGTTTaCtT -253 4, pyrD tCGCAAcCGTTTaCtc -212 3, carAB AgGtAAtCGTTTGCta -323 3, pyrBI AaGgtAtCGTTTGCGT -97 3, gcvTHP ggtaAAACGaTTGCGc 22 3, folD AgcCAAtCGTTTGCGT -324 4, glyA AgGCAAtCGTTTGtaT -9 4, serA AaGCAAtCGTTTGCGc -183 4, gltS gCGCAAACGaTTGCtT -19 4, yicE AgatAAtCGTTTGCcT -205 3, yjcD ACGgAAACGaTTaCGT -72 4, gCGtAAtCGaTTGCcT -107 3, xseA AgGCAAACGaTTaaca -63 3, Y. pseudotuberculosis purR ACGCAAtCGTTTtCGT -84 4, purT ACGCAAACGgTTtCGT -129 4, purL ACGCAAACGcTTaCcT 183 4, purB ACGCAAcCGTTTtCcT -115 4, purEK ACGCAAACGTTTtCtT -73 4, cvpA-purF tCGCAAACGTTTGCcT -281 4, purMN ACGCAAtCGTTTtCGc -179 4, purHD AgGCAAtCGaTTaCGc 8 4, guaBA Сайт Геном Оперон Положение Вес Последовательность ACGCAAACGaTTaaGg -171 3, Y. pseudotuberculosis yhhP AgGCAAACGTTTGCGa -169 4, upp-uraA tCGCAAACGTTTaCtT -255 4, pyrD tCGCAAcCGTTTaCtc -241 3, carAB AgGtAAtCGTTTGCta -323 3, pyrBI AaGgtAtCGTTTGCGT -97 3, gcvTHP ggtaAAACGaTTGCGc 22 3, folD AgcCAAtCGTTTGCGT -322 4, glyA AgGCAAtCGTTTGtaT -111 4, serA AaGCAAtCGTTTGCGc -185 4, gltS gCGCAAACGaTTGCtT -68 4, yicE AgatAAtCGTTTGCcT -205 3, yjcD ACGgAAACGaTTaCGT -72 4, gCGtAAtCGaTTGCcT -109 3, xseA AgGCAAACGaTTaaca -68 3, P. carotovorum purR AaGaAAACGTTTtCGT -353 4, prsA ACGCAAACGTTTtCGT -60 5, purT ACGCAAACGgTTtCGT -112 4, purL ACGCAAACGcTTtCcT 183 4, purB ACGCAAcCGTTTtCcT -131 4, purEK ACGCAAACGTTTtCtT -89 4, cvpA-purF tCGCAAACGaTTGCcT -128 4, purMN ACGCAAACGTTTtCGc -158 4, purHD AgGCAAtCGaTTaCGc -78 4, guaBA gCGCAAACGTTgtCGT -81 4, yhhP AgGCAAtCGTTTGCGa -241 4, upp-uraA cCGCAAACGTTTtacT -125 3, pyrD taGCAAcCGTTTaCtT -238 4, carAB AaGCAAcCGaTTGCGa -288 4, pyrBI AaGatAtCGTTTGCGc -63 3, gcvTHP ggtaAAACGaTTGCGc 20 3, folD AgctAAtCGTTTGCGT -151 3, glyA AaGCAAtCGTTTGtaT -97 4, serA AgGCAAcCGTTTtCGT -130 4, tsx taGCAAACGTTTGCtT -73 4, yicE ACGCAAACGTTTaCtT -85 4, yjcD gCGtAAtCGaTTGCcT -110 3, xseA ACGacAACGTTTGCGc -151 4, yhhQ gCGCAcACGaTTGCGa -238 3, ydiJ AaGaAAACGTTTcCGT -294 4, P. luminescens prsA ACGCAAACGgTTtCGT -90 4, purL ACGCAAACGcTTaCcT 197 4, purB ACGCAAtCGTTTtCcT -85 4, purEK ACGCAAACGTTTtCGT -71 5, cvpA-purF tCGCAAACGTTTGCtT -81 4, purMN ACGCAAACGTTTtCGT -282 5, purHD AgGCAAcCGaTTaCGT -79 4, guaBA AaGCAAACGTTTGCGa -161 4, upp-uraA Сайт Геном Оперон Положение Вес Последовательность ttGCAAACGTTTttcT -98 3, P. luminescens speAB AaGatAtCGTTTGCGT -107 4, gcvTHP ggGaAAACGaTTGCGc 22 4, folD AtGCAAtCGTTTGCGT -125 4, glyA AaGCAAtCGTTTGCGT -191 4, gltS ACGCAAACGaTTGCtT -67 4, yicE AgctAAtCGTTTGCGT -132 3, yjcD ACGtAAtCGgTTGCcT -109 4, xseA AgGtAAACGcTTGCcT -128 3, ydiJ AtGCAAACGaTTGtGa -310 3, P. multocida prsA AtGCAAACGTTTGCtT -84 4, purC ACGCAAACGTTTtCGT -84 5, purL AgGCAAACGaTTaCtT 183 4, purB AgGCAAtCGTTTGCtT -77 4, purEK ACGCAAACGTTTtCtT -68 4, cvpA-purF tCGCAAACGTTTGCtT -73 4, purMN gCGCAAACGTTTGCGT -74 4, purHD-glyA AaGCAAACGTTTGCcT -77 4, codBA ttGCAAACGTTTttcT -98 3, speAB taGCAAACGTTTtCtT -40 4, folD gCGCAAACGaTTaCGc -103 4, rpiA-serA AgcCAAACGaTTGCtT -113 4, yjcD AaGtAAACGTTTGCGT -127 4, deoD AaGaAAtCGTTTataa 59 3, pckA ACGCAAtCGTTTGCta -65 4, glpX taGCAAACGaTTGCGT -166 4, yiiU ttGCAAcCGTTTGCtT -101 4, HD AtaaAAACGaTTGCGa -283 3, H. influenzae prsA taGCAAACGTTTGCtT -31 4, purC AtGCAAACGTTTGCtT -1 4, purL taGCAAACGTTTGCcT -77 4, purEK ACGCAAACGTTTtCtT -84 4, cvpA-purF tCGCAAACGTTTGCtT -62 4, purMN AaGCAAACGTTTGCGT -65 5, purHD taGCAAACGcTTtCtT -44 3, folD ACGagAAaGTTTtCtT -333 3, glyA ACGCAAtCGTTTaCtT -36 4, rpiA ACGCAAACGTTTaCtT -85 4, yjcD AtGCAAACGaTTaCtc -75 4, glpX gaGtAAtCGTTTGCaT -102 3, yiiU ttGCAAACGgTTGCtT -94 4, HD ggGgAAACGaTTGCGa -271 3, H. ducreyi prsA taGCAAtCGTTTGCtT -91 4, purC ACGCAAACGTTTGCtT -40 4, purT AtGCAAtCGTTTGCtT -1 4, purL AgGCAAACGaTTaCtT 185 4, purB AaaCAAtCGTTTGttT -68 3, purE Сайт Геном Оперон Положение Вес Последовательность ACGCAAACGTTTtCtT -56 4, H. ducreyi cvpA-purF AaGCAAACGTTTGCGT -180 5, purHD cCGCAAcCGTTTGCtT -73 4, purM AaGCAAtCGgTTGCca -42 4, fhs AaGCAAACGTTTGCtT -89 4, deoC ACGCAAACGaTTaCGa -135 4, yhhQ ACGCAAACcTTTGCtT -85 4, HD ACGaAAACGaTTGCGa -294 4, V. cholerae prsA AaGCAAACGTTTGCtT -9 4, purC AaGCAAACGTTTtCtT -79 4, purT ACGCAAACGgTTGCtT -171 4, purL AgtaAAACGaTTGCGT 52 4, purB AaGCAAACGTTTGCtT -88 4, purEK AaGaAAACGTTTGCGT -65 4, cvpA-purF ACGCAAACGTTTtCcT -80 4, purMN tgcCAAACGaTTGCGc -186 3, purHD AgtCAAcCGaTTGCcT -113 3, guaBA gtGCAAACGTTTGCtT -94 4, gsk ggGCAAtCGaTTGttc -316 3, guaC AgtCAAACGTTTGCcT -261 4, ushA AgGaAAACGTTTGCGT -102 4, upp-uraA AtGtAAtCGcTTGCGc -155 3, pyrBI AaGCAAACGTTTGCcT -11 4, folD ACGaAAACGTTTGCGT -15 5, glyA AgGaAAACGTTTGCtT -98 4, serA gCGCAAACGTTTtCcT 3 4, fhs AaGCAAACGTTTGCtT -274 4, yicE gCGCAAACGTTTaCcT -217 4, ACGCAAcCGTTTaCtT -38 4, yieG AgGCAAtCGgTTGacT -104 3, xseA AgtgAAtCGTTTtCGT -151 3, cytR gCGCAAAgGTTTGCGc -193 3, pckA AgGCAAACGTTTaCtT -74 4, glpX AgGCAAACGTTTaCtT -74 4, ppsA tgGCAAtCGTTTGCtT -139 4, ydiA taGCAAACGTTTtCtT -71 4, VC ACGCcAtCGTTTGCtc -160 3, yhhQ cattAAACGTTTGCGT -289 3, HD ACGtAAACGaTTGCGa -243 4, V. fischeri prsA taGCAAtCGTTTGCtT -91 4, purC taGCAAACGTTTGCGT -73 4, purT ACGCAAACGgTTGCtT -183 4, purL ACGCAAACGaTTGCGg 146 4, purB ACGCAAACGTTTtCcT -87 4, purEK AaGaAAACGTTTGCGT -62 4, cvpA-purF ACGCAAACGTTTcCcT -81 4, purMN AtGCAAtCGaTTGCGc -207 4, purHD AgcCAAgCGTTTGCGc -121 3, guaBA Сайт Геном Оперон Положение Вес Последовательность gaGCAAACGTTTGCta -106 4, V. fischeri gsk taGCAAACGTTTaCtT -342 4, guaC ACGtAAACGgTTGCGT -221 4, ushA AgGgAAACGTTTGCGT -142 4, upp-uraA AaGCAAACGaTTaacT -62 3, pyrC AgcCAAACGTTTGCtc -246 4, pyrD AtGCAAACGcTTGCtT -227 4, pyrBI ACGCAAACGTTTGCtc -87 4, folD ACGtAAACGTTTGCGT -65 4, glyA cCGaAAcCGTTTGCtT -133 4, rpiA-serA AtGaAAACGaTTGCGT 44 4, fhs AaGCAAACGaTTGCtT -187 4, yicE ACGCAAcCGTTTaCtT -38 4, yieG ACGgtAACGaTTGCtT -104 3, yjcD AaaaAAcCGTTTtCGT 33 3, rnt gCGCAAACGcTTGgcT -103 3, xseA gaGCAAtCGTTTaCtT -47 4, cytR gCGCAAtCGaTTttaT -193 3, pckA AaGCAAACGTTTcCcT -75 4, glpX AgGgAAACGTTTGCtT -308 4, yiiU gCGtAAACGaTTGCGa -290 3, V. parahaemolyticus prsA AgGCAAACGTTTGCtT -133 4, purC AaGCAAACGTTTGCtT -82 4, purT ACGCAAACGgTTGCtT -160 4, purL gCGCAAACGTTTGCGc -88 4, purB ACGCAAACGTTTGCtT -89 4, purEK AaGaAAACGTTTGCGT -62 4, cvpA-purF ACGCAAACGTTTGCta -83 4, purMN tgcCAAACGaTTGCGc -197 3, purHD AgtCAAgCGaTTGCGT -138 3, guaBA caGCAAACGTTTGCta -95 4, gsk ACGCAAAgGTTTGCGc -299 4, guaC taGCAAACGTTTGCGT -113 4, upp-uraA gCGCAAgCGTTTGCtc -76 3, pyrC ctGaAAtCGaTTGCtT -193 3, pyrD AtGtAAtCGcTTGCGc -252 3, pyrBI ACGCAgACGTTgtgGT 95 3, speAB AgGCAAACGTTTGCGT -86 5, folD ACGaAAACGTTTGCGT -75 5, glyA AaGgAAACGTTTGtcc -107 3, serA gCGCAAACGTTTGCGc -84 4, fhs ACGCAAtCGgaTGCGT -296 4, gltS taGCAAACGaTTGCtT -165 4, yicE ACGCAAACGTTTagaT -45 4, yieG ACGgtAACGaTTGCtT -104 3, yjcD taGCAAACGTTTaacT -334 3, cytR gCGCAAAgGaTTGCGc -190 3, pck Сайт Геном Оперон Положение Вес Последовательность AgGCAAACGTTTaacT -74 4, V. parahaemolyticus glpX ACGtAAtCGTTTGCcT -76,00 4, pps AgGCAAACGaTTaCGT -138 4, ydiA taGCAAACGTTTGCtT -194,00 4, VC AaGaAcACtTTTtCGT -62,00 3, AgttAAACGTTTGCcT -287 3, yiiU ggatAAACGTTTGCGT -189 3, yhhQ V. vulnificus ACGgAAACGaTTGCGa -302 4, prsA AgGCAAACGTTTGCtT -135 4, purC AaGCAAACGTTTGCtT -82 4, purT ACGCAAACGgTTGCtT -158 4, purL gCGCAAACGTTTGCGc -90 4, purB AaGCAAACGTTTGCtT -88 4, purEK AaGaAAACGTTTGCGT -64 4, cvpA-purF gCGCAAACGTTTGCtc -80 4, purMN tgcCAAACGaTTGCGc -200 3, purHD gCGCAAgCGTTTGCGa -288 3, guaC taGCAAACGTTTGCta -92 4, gsk AgtCAAACGTTTGCcT -243 4, ushA gaGCAAACGTTTGCGc -108 4, upp taGCAAtCGTTTGCaa -66 3, uraA ACGgAAgCGTTTGCcT -49 3, pyrC AaGCAAACGTTTGCGT -85 5, folD ACGaAAACGTTTGCGT -72 5, glyA AaGgAAACGTTTGtcc -104 3, serA taGCAAACGaTTGCtT -185 4, yicE ACGCAAcCGTTTaCtT -39 4, yieG taGCAAACGTTTaCca -230 3, cytR gCGCAAAgGTTTGCGT -189 4, pck gCGtAAtCGTTTGCcT -33 4, pps AgGCAAACGaTTaCGc -138 4, ydiA taGCAAtCGTTTGCta -151 3, VC taGCAAACGTTTaCca -230 3, yiiU gttCAAtCGTTTGCGT -186 3, yhhQ ACGaAAACGaTTGCGa -287 4, P. profundum prsA AgGCAAACGTTTGCtT -142 4, purC AgGCAAACGTTTGCGT -72 5, purT gCGCAAACGgTTGCGT -199 4, purL taGCAAACGaTTGCGc -192 4, purB ACGCAAtCGaTTaCGT 61 4, purE AgGtAAACGTTTGCGT -62 4, cvpA-purF ACGCAAACGTTTcCcT -80 4, purMN gaGCAAACGTTTGCGT -169 4, purHD AgcCAAACGaTTGCtT -83 4, guaBA taGCAAAgGTTTGCGT -125 3, gsk ACGaAAACGaTTaCcT -64 4, guaC AgGgAAACGTTTGCGT -125 4, upp AgGtAAtCGaTTGCtT -65 4, uraA Сайт Геном Оперон Положение Вес Последовательность AgcCAAACGaTTGCGT -113 4, P. profundum pyrC ACGgAAtCGTTTGCGT -185 4, pyrD AaGCAAACGTTTGCGc -87 4, folD ACGaAAACGTTTGCGT -95 5, glyA gCGCAAACGaTTGCGT -97 4, fhs gCGCAAACGaTTGCtT -68 4, yicE taGCAAACGaTTaCGc -94 4, yjcD ACGCAAACGTTTaCtc -82 4, AaGCAAtCGTTTGgcT -191 4, xseA ACGCAAACGTTTcacT -22 4, glpX AtGCAAtCGTTTcCGT -66 4, pps ACGgAAACGaTTGCaT -134 4, ydiA AgGCAAACGaTTGCtT -155 4, yhhQ Приложение 9.

Множественное выравнивание для белков Fnr. Участки,соответствующие последовательности HTH, показаны белым шрифтом на темном фоне. Критически важные цистеиновые остатки показаны на голубом фоне. Условные обозначения: “*” – абсолютно консервативная позиция;

“:” – позиция с высокой степенью консервативности;

“.” – позиция с низкой степенью консервативности. Обозначения геномов: см. Табл. 2.



Приложение 10.

Множественное выравнивание для белков ArcA. Участки,соответствующие последовательности HTH, показаны белым шрифтом на темном фоне. Условные обозначения: “*” – абсолютно консервативная позиция;

“:” – позиция с высокой степенью консервативности;

“.” – позиция с низкой степенью консервативности. Обозначения геномов: см. Табл. 2.


Приложение 11.

Множественное выравнивание для белков ArcB. Участки,соответствующие последовательности HTH, показаны белым шрифтом на темном фоне. Критически важные цистеиновые остатки показаны на голубом фоне. Условные обозначения: “*” – абсолютно консервативная позиция;

“:” – позиция с высокой степенью консервативности;

“.” – позиция с низкой степенью консервативности. Обозначения геномов: см. Табл. 2.




Pages:     | 1 |   ...   | 3 | 4 || 6 |

Похожие работы:

© 2013 www.libed.ru - «Бесплатная библиотека научно-практических конференций»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.