авторефераты диссертаций БЕСПЛАТНАЯ БИБЛИОТЕКА РОССИИ

КОНФЕРЕНЦИИ, КНИГИ, ПОСОБИЯ, НАУЧНЫЕ ИЗДАНИЯ

<< ГЛАВНАЯ
АГРОИНЖЕНЕРИЯ
АСТРОНОМИЯ
БЕЗОПАСНОСТЬ
БИОЛОГИЯ
ЗЕМЛЯ
ИНФОРМАТИКА
ИСКУССТВОВЕДЕНИЕ
ИСТОРИЯ
КУЛЬТУРОЛОГИЯ
МАШИНОСТРОЕНИЕ
МЕДИЦИНА
МЕТАЛЛУРГИЯ
МЕХАНИКА
ПЕДАГОГИКА
ПОЛИТИКА
ПРИБОРОСТРОЕНИЕ
ПРОДОВОЛЬСТВИЕ
ПСИХОЛОГИЯ
РАДИОТЕХНИКА
СЕЛЬСКОЕ ХОЗЯЙСТВО
СОЦИОЛОГИЯ
СТРОИТЕЛЬСТВО
ТЕХНИЧЕСКИЕ НАУКИ
ТРАНСПОРТ
ФАРМАЦЕВТИКА
ФИЗИКА
ФИЗИОЛОГИЯ
ФИЛОЛОГИЯ
ФИЛОСОФИЯ
ХИМИЯ
ЭКОНОМИКА
ЭЛЕКТРОТЕХНИКА
ЭНЕРГЕТИКА
ЮРИСПРУДЕНЦИЯ
ЯЗЫКОЗНАНИЕ
РАЗНОЕ
КОНТАКТЫ


Pages:     | 1 || 3 | 4 |   ...   | 5 |

«Федеральное бюджетное учреждение науки «Санкт-Петербургский научно- исследовательский институт эпидемиологии и микробиологии им. Пастера» ...»

-- [ Страница 2 ] --

Экстракцию тотальной бактериальной ДНК методом фенол-хлороформной экстракции, ее рестрикцию эндонуклеазами EcoRI и EcoRV (Roche Diagnostics GmbH), разделение фрагментов рестрикции методом электрофореза в агарозном геле, их перенос с агарозного геля на нейлоновую мембрану HybondTM –N+ (Amersham) проводили, как описано ранее [129]. УФ-фиксацию ДНК на мембране выполняли в течение 10 минут с использованием прибора GS Gene Linker UV Chamber (Bio Rad) в режиме C2.

Далее проводили изучение полиморфизма длин рестрикционных фрагментов нуклеотидных последовательностей оперона рибосомной РНК методом риботипирования. Мечение зонда 16S+23S рРНК (Boehringer) пероксидазой для гибридизации с рестрицированной ДНК и детекцию гибридизованных фрагментов рестрикции осуществляли с использованием набора реагентов “ECL direct nucleic acid labelling and detection systems” (Amersham).

Мембрану экспонировали на светочувствительной пленке Kodak X OMAT AR, пленку проявляли, сканировали и сохраняли файл в формате TIFF для компъютерного анализа. После использования гибридизованные мембраны, не высушивая, запаивали в полиэтиленовые пакеты и хранили при -20 0С.

Для анализа распространенности IS-элементов в геноме Y..pseudotuberculosis методом использовали мембраны, полученные при IS-RFLP-типирования риботипировании, после дегибридизации зонда 16S+23S рРНК. Для этого мембраны инкубировали в 0,4 М растворе NaOH в течение 30 мин при 45 0С, затем в растворе, содержащем буфер SSC (0,1х), 0,1 % SDS и 0,2 М Tris-HCl, рН 7,5 в течение 15 мин при 45 0С. Для последующего гибридизационного анализа в качестве зондов использовали фрагменты последовательностей ДНК IS100, IS и IS1541 и набор реагентов ECL (Amersham). Зонды получали методом ПЦР в соответствии с методикой Torrea G. et al. [234]. Электрофорез продуктов ПЦР проводили в 0,7 % агарозном минигеле в ТВЕ буфере (1х) с окрашиванием этидий бромидом (конечная концентрация 0,5 мкг/мл) при постоянном напряжении 50 В в течение 1,5-2 ч. В качестве ДНК маркера молекулярного веса использовали маркер VI (Boehringer). Для очистки продуктов ПЦР от агарозы и примесей использовали набор реагентов «QIAquick gel extraction kit» (QIAGEN). Для определения концентрации очищенной ДНК проводили электрофорез в 2 % агарозном минигеле в ТАЕ буфере (1х) с окрашиванием этидий бромидом при постоянном напряжении 50 В в течение 30 мин. Для контроля использовали разведения рестрицированной ДНК известной концентрации (PBA 033, EcoRI).

Искомую концентрацию ДНК определяли, сопоставляя яркость свечения полос.

Выбор концентрации зонда для гибридизации проводили опытным путем.

Методом ПЦР исследовали материал от больных (испражнения;

моча;

мазки из зева;

операционный материал – синовиальную жидкость, биоптаты синовиальной оболочки, фрагменты ткани аппендицикулярных отростков, кист поджелудочной железы);

из внешней среды (смывы с поверхности оборудования, тары пищеблоков и овощехранилищ, овощей, фруктов;

пробы, собранные в ходе эпизоотологического обследования – тонкие кишечники грызунов);

изолированные культуры иерсиний. Правила взятия и подготовки материала для исследования приведены в МР 11-3/8-09 [48].

Для выделения ДНК из проб испражнений и проб из объектов окружающей среды, как наиболее загрязненных образцов, использовали метод, разработанный В.Т. Климовым и соавт. (2002) во ФКУЗ Иркутский НИПЧИ Сибири и Дальнего Востока Роспотребнадзора (патент № 2153671 от 27.07.2000) [24]. Описание метода включено в МР 11-3/8-09 [48]. Выделение ДНК из других видов материала проводили с применением комплектов реагентов «АмплиПрайм ДНК-сорб-АМ» и «АмплиПрайм ДНК-сорб-В» (ФБУН «ЦНИИЭ» Роспотребнадзора).

Для выявления ДНК иерсиний в материале от больных и из внешней среды применяли коммерческие наборы реагентов «АмплиСенс Yersinia pseudotuberculosis-ЕРh» и «АмплиСенс Yersinia enterocolitica-ЕРh» с визуальным учетом результатов после электрофореза продуктов амплификации в агарозном геле, а также набор реагентов «АмплиСенс Yersinia с гибридизационно-флуоресцентной enterocolitica/pseudotuberculosis-FL»

детекцией в режиме «реального времени» (ФБУН «ЦНИИЭ» Роспотребнадзора).

Постановку ПЦР и учет результатов проводили в соответствии с инструкциями по применению.

При исследовании изолированных культур иерсиний применяли пары праймеров производства ООО «Синтол» (Москва) к участкам хромосомных и плазмидных генов, кодирующих факторы вирулентности иерсиний (таблица 2).

Таблица 2. Праймеры, использованные в ПЦР для выявления генов вирулентности иерсиний Фактор Последовательности 5’-3’ Размер Ген вирулент- прямого F и обратного R продукта, Источник ности праймеров п.н.

гены, локализованные на плазмиде pYV основной адгезин F: CTTCAGATACTGGTGTCGCTGT yad A 849 [232] иерсиний R: ATGCCTGACTAGAGCGATATCC YadA гены, локализованные на хромосоме один из регуляторов irp системы F: AAGGATTCGCTGTTACCGGAC 280 [210] утилизации R: TCGTCGGGCAGCGTTTCTTCT железа в составе HPI ypmA/C суперантиген F: CACTTTTCTCTGGAGTAGCG 422 [91] R: ACAGGACATTTCGTCA YPMa/c аil белок адгезии/ F: TAATGTGTACGCTGCGAG 351 [232] инвазии Ail R: GACGTCTTACTTGCACTG Положительными контрольными образцами при постановке ПЦР являлись лизаты бактериальных клеток референс-штамммов Y. pseudotuberculosis IP 33156 и Y..enterocolitica IP 1105, полученных из Национального Yersinia референс-центра Парижского института Пастера [109, 232]. Для получения лизатов контрольных и исследуемых бактерий штаммы выращивали на агаре Хоттингера, готовили взвесь с концентрацией 108 м.к./мл в стерильной дистиллированной воде, 100 мкл взвеси кипятили 5 мин, центрифугировали при 10 тыс. об./мин 1 мин, использовали надосадок. В качестве ДНК маркера молекулярного веса использовали маркер VI (Boehringer). Реакционную смесь для проведения ПЦР в конечном объеме 25 мкл готовили с использованием стандартных реагентов производства «Fermentas» согласно прилагаемой инструкции. Праймеры использовали в финальной концентрации 0,4 мкМ/мкл, исследуемый образец ДНК вносили в объеме 4 мкл. ПЦР проводили в программируемом термостате ТП4-ПЦР-01-«Терцик» (ЗАО «НПФ ДНК-Технология»), используя программу: цикл 95 оС – 2 мин;

30 циклов 94 оС – 45 сек, 55 оС (для праймеров к ypmА/С, yad A, irp2) или 57 оС (для праймеров к ail) – 45 сек, 72 оС – 45 сек;

1 цикл 72 оС – мин. Для учета результатов ПЦР проводили электрофорез в 1,5 % агарозном геле при постоянном напряжении 75 В в ТВЕ буфере (1х) с окрашиванием этидий бромидом. Регистрацию продуктов амплификации ДНК проводили в трансиллюминаторе с использованием системы гель-документирования с программным обеспечением «Gel Imager-2» (Хеликон).

Иммунологические методы Для выявления антигенов Y. pseudotuberculosis в материале от больных и из внешней среды проводили ИФА с «Тест-системой иммуноферментной для выявления антигенов иерсиний псевдотуберкулеза cеротипа О:1» производства НИИ эпидемиологии и микробиологии имени Пастера. Подготовку материала, постановку и учет реакции выполняли в соответствии с инструкцией по применению.

Для определения антител в ОСК людей применяли РНГА с лиофилизированными эритроцитарными диагностикумами производства ФГУП СПбНИИВС ФМБА России: псевдотуберкулезным.- для выявления антител к Y..pseudotuberculosis серотипа 1 и кишечноиерсиниозным – для выявления антител к Y. enterocolitica серотипов О:3 и О:9. Методика постановки РНГА приведена в инструкции по применению.

Для выявления иммуноглобулинов A, M и G к Y. pseudotuberculosis и патогенным Y. enterocoliticа использовали лабораторные серии тест-систем «Иерсиниоз-ИФА-IgA», «Иерсиниоз-ИФА-IgM», «Иерсиниоз-ИФА-IgG», разработанные на основе рекомбинантных аналогов БНМ патогенных иерсиний в ходе настоящего исследования совместно с ООО «Омникс», в последующем – производственные серии ООО «Омникс» (Санкт-Петербург). В качестве тест систем для контроля использовали коммерческие тест-системы для ИФА «recomWell Yersinia IgА/IgM/IgG» (MIKROGEN, Германия). Постановку и учет реакций проводили в соответствии с инструкциями по применению.

Экспериментальные методы При выборе штамма для разработки технологии производства тест-систем «Иерсиниоз-ИФА-IgА/IgM/IgG» предварительно комплексом методов проводили оценку вирулентных свойств иерсиний из коллекции лаборатории бактериальных инфекций ФБУН НИИ эпидемиологии и микробиологии имени Пастера.

Определяли фенотипические признаки, связанные с плазмидным детерминированием (способность к аутоагглютинации, кальцийзависимость роста иерсиний). Состав используемых сред, способ их приготовления, методики постановки тестов приведены в МР 11-3/8-09 [48]. Для проверки антигенной активности штамма применяли реакцию агглютинации с сывороткой диагностической к вирулентным иерсиниям (СВИ) (производство ФБУН НИИ эпидемиологии и микробиологии имени Пастера). Постановку и учет реакции проводили в соответствии с инструкцией по применению. Методом ПЦР выявляли плазмидный ген yadА, как описано выше.

Степень вирулентности иерсиний оценивали на модели перевиваемой клеточной линии НЕр-2 на основании дифференциальлных критериев по методике, разработанной Г.Я. Ценевой (1987) [62].

В дальнейшем высоковирулентный штамм, отобранный в качестве производственного, использовали в технологии получения рекомбинантных аналогов белковых антигенов наружной мембраны патогенных иерсиний для клонирования генов yops. Рекомбинантные белки получены на базе ООО «Омникс» (Санкт-Петербург). В работе использовано четыре рекомбинантных белка, соответствующих природным факторам вирулентности иерсиний: YopE, YopН, YopM, YopD.

Методы математической обработки данных Анализ индивидуальных и комбинированных профилей гибридизации и построение дендрограмм кластеризации штаммов выполняли по алгоритму невзвешенного попарного среднего (Unweighted pair-group method using arithmetic averages, UPGMA), основанном на вычислении коэффициента сходства Дайса [106], с использованием программы BioNumerics 4.0 (Applied Maths, Бельгия).

Для определения дискриминирующей силы методов генотипирования вычисляли индекс дискриминации (D), основанный на индексе разнообразия Симпсона [141].

Для статистической обработки результатов применяли стандартные пакеты программ STATISTICA 6.0 с вычислением средней арифметической M, среднего квадратического отклонения, ошибки средней арифметической m, средней ошибки показателя, выраженного в процентах mp. Отличия между выборками оценивались по параметрическому критерию Стьюдента t. Различия считали статистически значимыми при доверительном интервале 95 % (р0,05).

Для расчета чувствительности и специфичности тест-систем «Иерсиниоз ИФА-IgА/IgM/IgG» использовали формулы 1 и 2, соответственно:

П Чувствительность 100 %, (1) П ЛО где П – число положительных проб, правильно распознанных тест системой;

ЛО – число ложноотрицательных результатов, соответствующее числу положительных проб, не распознанных тест-системой.

О Специфичность 100 %, (2) О ЛП где О – число отрицательных проб, правильно распознанных тест-системой;

ЛП – число ложноположительных результатов, соответствующее числу отрицательных проб, ошибочно распознанных тест-системой как положительные.

Положения, выносимые на защиту 1. Штаммы различного происхождения и Y. pseudotuberculosis географического распространения гетерогенны по локусам хромосомы, содержащим рРНК оперон, маркерам IS285 и IS1541. Сравнительная оценка разрешающей способности использованных методов генотипирования обосновывает целесообразность применения IS1541-RFLP-типирования для оценки генетического разнообразия популяций Y..pseudotuberculosis при проведении микробиологического мониторинга циркулирующих штаммов.

2. Представители российской популяции Y. pseudotuberculosis по результатам анализа полиморфизма длин рестрикционных фрагментов нуклеотидных последовательностей оперона рРНК, IS285 и IS1541 характеризуются относительной однородностью, в отличие от представителей глобальной популяции. При этом подавляющее большинство штаммов (93 %) выделенных в различных регионах страны, Y..pseudotuberculosis, представлены специфическими для России доминирующими и локальными генетическими вариантами.

3. Разработанная тест-система на основе рекомбинантных аналогов белков наружной мембраны патогенных иерсиний для выявления иммуноглобулинов M, G, A методом ИФА в сыворотке крови человека характеризуется высокой диагностической эффективностью и рекомендуется для выявления иерсиниозной этиологии заболеваний с острым и хроническим течением.

Разработанный научно-обоснованный алгоритм диагностических 4.

исследований при микробиологическом мониторинге циркуляции возбудителей иерсиниозов определяет дифференцированный подход к использованию комплекса методов выявления и внутривидовой дифференциации Y..pseudotuberculosis (ИФА-Ag, ПЦР, риботипирование, IS1541-RFLP-типирование, О-гено(серо)типирование), обнаружения специфических антител (РНГА, ИФА-Ig) и обосновывает целесообразность их внедрения в практику.

Степень достоверности и апробация результатов Штаммы Y. pseudotuberculosis, использованные в работе, выделены от больных людей, от животных, из продуктов питания во время 20-ти вспышек псевдотуберкулеза, при спорадических случаях заболевания и при плановом мониторинге возбудителя.

Больные включены в основную группу исследования на основании лабораторного подтверждения диагноза псевдотуберкулез или кишечный иерсиниоз при отрицательных результатах обследования на другие инфекции вирусной и/или бактериальной этиологии, а также при отсутствии соматической патологии. В одном из разделов работы в качестве контрольных исследованы также ОСК от клинически здоровых людей и от больных нозологическими формами, с которыми наиболее часто дифференцируют иерсиниозы: дизентерия, сальмонеллез, эшерихиоз, гепатит, клещевой боррелиоз, ОРВИ, инфекционный мононуклеоз. Диагноз у больных этой группы подтвержден сертифицированными специфическими диагностическими методами.

Статистическая обработка данных проведена методами статистического анализа при помощи стандартных пакетов программ STATISTICA 6.0. Для оценки достоверности различий между несколькими группами наблюдений использованы методы дисперсионного анализа. Достоверность различий оценивали по критерию Стьюдента t и величине вероятности p. За достоверность различий принимали значение р0,05, вероятность различий составляла 95% и более.

Основные результаты исследований доложены и обсуждены на российских и международных конгрессах и конференциях в 2002-2013 г.г.: 10th International Congress of Bacteriology and Applied Microbiology, Париж, Франция, 27.07 1.08.2002;

8th International Simposium on Yersinia, Турку, Финляндия, 4-8.09.2002;

Российской научно-практической конференции, посвященной 110–летию кафедры инфекционных болезней Военно-медицинской академии им. С.М.

Кирова «Инфекционные болезни: проблемы здравоохранения и военной медицины», СПб, 22-24.03.2006;

Второй Всероссийской научно-практической конференции с международным участием «Инфекции, обусловленные иерсиниями», СПб, 12-13.10.2006;

заседании Санкт-Петербургского отделения Всероссийского научно-практического общества эпидемиологов, микробиологов и паразитологов им. И.И. Мечникова, СПБ, 11.04.2006;

Четвертой международной конференции «Идеи Пастера в борьбе с инфекциями», СПб, 2-4.06.2008;

Российской научно-практической конференции «Инфекционные болезни:

современные проблемы диагностики и лечения», СПб, 3-4.12.2008;

научно практической конференции «Современные аспекты эпидемиологического надзора и профилактики особо опасных и природно-очаговых болезней», посвященной 75 летию ФГУЗ Иркутский НИПЧИ Сибири и Дальнего Востока, Иркутск, 22 24.09.09;

Международной конференции «Развитие научных исследований и надзор за инфекционными заболеваниями», СПб, 18-20.05.2010;

заседании отделения Всероссийского научно-практического общества эпидемиологов, микробиологов и паразитологов в Санкт-Петербурге и Ленинградской области, СПб, 20.04.2010;

Третьей Всероссийской научно-практической конференции с международным участием «Инфекции, обусловленные иерсиниями», СПб, 12 14.11.2011;

научно-практической конференции гастроэнтерологов и хирургов «Избранные вопросы неотложной хирургической и терапевтической гастроэнтерологии», СПб, 25-26.03.2013;

Международной конференции "Молекулярная эпидемиология актуальных инфекций", посвященной 90-летию Санкт-Петербургского Института имени Пастера, СПб, 5-7.06.2013.

Личный вклад автора Основные результаты получены лично автором. Выделение штаммов проведено в референс-центре по мониторингу за иерсиниозами (ФБУН НИИ эпидемиологии и микробиологии имени Пастера), в Национальном Yersinia референс-центре Парижского института Пастера, ГБОУ ВПО СПбГПМУ Минздрава России, ФКУЗ Иркутский НИПЧИ Сибири и Дальнего Востока Роспотребнадзора.

Исследования по генотипированию штаммов Y. pseudotuberculosis, проведены автором на базе Парижского института Пастера и ФБУН НИИ эпидемиологии и микробиологии имени Пастера в Санкт-Петербурге.

Микробиологические, молекулярно-генетические (ПЦР), иммунологические, экспериментальные исследования, систематизация и анализ полученных данных, статистическая обработка данных проведены автором в лаборатории бактериальных инфекций ФБУН НИИ эпидемиологии и микробиологии имени Пастера.

Часть диагностических исследований проведена совместно со специалистами ГБОУ ВПО СПбГПМУ Минздрава России, НИИ скорой помощи имени И.И. Джанелидзе, СПб ГБУЗ «КИБ им. С.П. Боткина», ОВКГ № (Санкт-Петербург), ИКБ № 2 (Москва).

Выбор производственного штамма из коллекции НИИ эпидемиологии и микробиологии имени Пастера при разработке тест-систем «Иерсиниоз-ИФА IgА/IgM/IgG» проведен лично автором при изучении вирулентных свойств иерсиний комплексом методов. Рекомбинантные аналоги БНМ патогенных иерсиний получены на базе ООО «Омникс» (Санкт-Петербург). На этапе получения лабораторных образцов тест-систем совместно с ООО «Омникс» были подобраны стандартные реагенты и условия проведения анализа, в последующем подготовлена техническая документация.

Микробиологические исследования материала из внешней среды и от животных проведены совместно со специалистами ЦГиЭ Вологодской области и республики Саха (Якутия) в ходе мониторинга иерсиниозов на территориях наблюдения.

Публикации. По теме диссертации опубликовано 48 научных работ, из них 17 – в изданиях, рекомендованных «Перечнем ведущих рецензируемых научных журналов и изданий, в которых должны быть опубликованы основные научные результаты диссертаций на соискание учёной степени доктора и кандидата наук»

ВАК.

Работа выполнялась в рамках тем Договора № 81-Д «Анализ движущих сил современного эпидемического процесса актуальных инфекций, совершенствование эпидемиологического надзора, обоснование эффективности эпидемиологических подходов в решении демографических проблем» (2006-2010 гг.): плановой НИР «Совершенствование технологий эпидемиологического надзора и контроля актуальных инфекций на основе молекулярно-генетических и иммунологических подходов»;

отраслевой научно-исследовательской программы «Совершенствование эпидемиологического мониторинга псевдотуберкулеза и кишечного иерсиниоза на основе внедрения молекулярно-генетических и современных иммунологических методов исследования» (2011-2015 гг.);

международного проекта ACIP «Молекулярная эпидемиология псевдотуберкулеза в России» (2004 2006 гг.).

Структура и объем диссертации Основной текст диссертации изложен на 239 страницах машинописного текста и состоит из введения, четырех глав собственных исследований, заключения, приложений.

Диссертация иллюстрирована 36 таблицами и 22 рисунками. Список литературы содержит 250 источников, в том числе 78 источников отечественных авторов и 172 - зарубежных авторов.

Глава 1. Генетическая структура популяций Y. pseudotuberculosis различного географического происхождения. Выбор метода генотипирования Y. pseudotuberculosis для микробиологического мониторинга возбудителя Ограниченность данных о генетическом разнообразии Y. pseudotuberculosis, основанных на анализе геномного полиморфизма штаммов различного географического происхождения, необходимость выбора информативных молекулярных маркеров для целей мониторинга циркуляции возбудителя обусловили выполнение данного раздела работы.

Для внутривидовой дифференциации Y. pseudotuberculosis изучено штамма различного географического происхождения шести классических серотипов О:1-О:6. Использование метода О-гено(серо)типирования на основе мультиплексной ПЦР позволило субтипировать три серотипа, в результате проведенных исследований указанные штаммы отнесены к девяти серотипам:

О:1а, О:1b, О:2а, О:2b, О:3, О:4, О:5а, О:5b, О:6 (Приложения А, А1).

1.1. Характеристика Y. pseudotuberculosis на основе данных изучения полиморфизма рибосомной ДНК (рДНК) методом риботипирования 1.1.1. Риботипирование штаммов Y. pseudotuberculosis из различных стран мира а) EcoRI-рибопрофили При использовании эндонуклеазы EcoRI по данным RFLP-анализа последовательностей генов 16S и 23S рРНК у 80 изученных штаммов Y..pseudotuberculosis выделено 18 различных профилей (Рисунок 1.1). Так как в геноме Y. pseudotuberculosis присутствует семь рРНК оперонов, предполагалось выявить семь фрагментов после гибридизации EcoRI-рестрицированной геномной ДНК c рРНК зондом [93]. Однако большинство профилей характеризовались наличием шести фрагментов рестрикции хромосомной ДНК, содержащих рРНК опероны (Рисунок 1.2). Исключение составил штамм IP32614 (профиль 11), имеющий семь рестрикционных фрагментов (см. Рисунок 1.1).

a b Степень сходства, % Штамм Серотип Страна Источник EcoRI профиль 30 40 50 60 70 80 90 Япония Заяц. 33817.

IP 5b Франция Человек. 32950.

IP 1b Япония Заяц. 32816..

IP 5b А Франция Человек. 33109.

IP 1b Испания Неизвестен. 32889.

IP 3 Англия Человек. 31830..

IP 4 Испания Человек. 32984..

IP 3 Испания Человек. 32666..

IP 3 Швейцария Человек. 32590.

IP 1a Италия Человек. 32745.

IP 1a Италия Свинья. 32790.

IP 1a Англия Овца. 31833..

IP 4 Дания Заяц. 31411..

IP 4 Франция Человек. 33285.

IP 1b Франция Человек. 32777.

IP 1b Англия Свинья. 32670.

IP 1b Франция Человек. 32949.

IP 1b Новая Зеландия Олень. 32533.

IP 1b Голландия Человек. 32524.

IP 1b Франция Неизвестен. 32637.

IP 1b Австралия Сумчатое. 33038.

IP 1b Дания Морская свинка. 30215.

IP 2b Франция Обезьяна. 32934.

IP 2b Франция Заяц. 33098.

IP 2b Германия Обезьяна. 33061.

IP 5a Швейцария Морская свинка. 32463.

IP 5a Франция Человек. 32821.

IP 5a Франция Человек. 32952.

IP 5a Франция Человек. 32929.

IP 2b Франция Дикое животное. 32699.

IP 5a Франция Дикое животное. 32687..

IP 4 Югославия Заяц. 32665.

IP 1a Канада Бобр. 30437.

IP 1b Франция Заяц. 33291.

IP 1a Англия Птица. 32709.

IP 1b Чехословакия Человек. 31524.

IP 1a Украина Грызун. IP 1b Украина Человек. IP 1b Тунис Мышь. IP 1a Румыния Почва. 32939.

IP 1a D Франция Человек. 32954.

IP 1a Тунис Грызун. IP 1a Норвегия Вода. 32323.

IP 2 Югославия Заяц. 32614..

IP 1a Германия Обезьяна. 33005.

IP 1a Югославия Заяц. 32651.

IP 1b Италия Голубь. 30284.

IP 1a Франция Коза. 33051..

IP 3 Аргентина Олень. 33097..

IP 3 Болгария Человек. 33108..

С IP 3 Аргентина КРС. 32938..

IP 3 Италия Свинья. 32802..

IP 3 Австралия КРС. 32992..

IP 3 Аргентина КРС. 33105..

IP 3 Бельгия Человек. 32564..

IP 3 Аргентина КРС. 32887..

IP 3 Южная Африка Свинья. 32544..

IP 3 Швейцария Птица. 32879.

IP 1b Франция Человек. IP 2a Россия Человек. IP 1b Россия Человек. IP 1b Россия Человек. IP 1b В Бельгия Человек. 32581.

IP 2a Италия Заяц. 32721.

IP 2a Новая Зеландия Человек. 32589.

IP 2a Франция Человек. 33293.

IP 2a Испания Свинья. 32584.

IP 2a Франция Антилопа. 32585.

IP 2a Швейцария Обезьяна. 33023.

IP 2a Германия Обезьяна. 33012.

IP 2a Испания Человек. 33054.

IP 2a Япония Морская свинка. 31554.

IP 6 Япония Морская свинка. 31553.

IP 6 Франция Человек. 33088.

IP 2a Англия Плод овцы. 31829.

IP 3 Франция Человек. 32953.

IP 1b Голландия Заяц. 30911.

IP 2b Франция Заяц. 32921.

IP 2b Швейцария Обезьяна. 32881.

IP 2b Швеция Выдра. 30151.

IP 4 Рисунок 1.1. Дедндрограмма EcoRI-профилей риботипирования штаммов Y..pseudotuberculosis (n=80), выделенных в различных странах мира. а, b – гибридизационные фрагменты 20,5 и 4,7 kb, соответственно.

Рисунок 1.2. Варианты EcoRI- и EcoRV-профилей риботипирования штаммов Y. pseudotuberculosis. В качестве стандарта молекулярной массы использована ДНК штамма Xenorabdus sp. 278.

Анализ сиквенса хромосомных генов штамма Y. pseudotuberculosis IP (№ в базе NCBI NC 006155) выявил, что один EcoRI сайт расположен на 5’-конце каждого 16S рРНК гена, другой – за рРНК опероном на разном расстоянии справа [93]. Основываясь на данных секвенирования, ожидаемые размеры EcoRI фрагментов штамма IP 32953 были 4,46;

5,69;

7,29;

7,55;

12,61;

20,47;

20,59 kb.

Они соответствовали полученным размерам гибридизационных фрагментов.

Наличие только шести гибридизационных полос у профилей большинства штаммов можно объяснить совмещением двух EcoRI-фрагментов большого размера приблизительно 20,5 kb. Этот фрагмент 20,5 kb обнаружен у всех профилей. Фрагмент 4,7 kb также присутствует у всех профилей кроме двух (2 и 12), каждый из которых характеризует только один штамм. Таким образом, наблюдаемое разнообразие EcoRI-профилей складывается из расположения остальных четырех гибридизационных фрагментов из шести.

Преобладающими являются пять профилей – 9 (12 штаммов), 1 ( штаммов), 14 (10 штаммов), 17 (9 штаммов), 8 (8 штаммов). Они характеризуют 64 % штаммов (см. Рисунок 1.1). Шесть профилей (2, 4, 7, 11, 12, 13) были индивидуальны (т.е. не имели аналогов среди других штаммов). Индекс дискриминации D составил 0,91.

При анализе дендрограммы не отмечено прямой связи между серотипом и EcoRI-профилем: штаммы одного серотипа могут характеризоваться несколькими профилями, с другой стороны, один и тот же профиль обнаруживается у штаммов разных серотипов. Вместе с тем, некоторые EcoRI-профили связаны с определенными серотипами – 8-й с серотипом 1b, 10-й с серотипом 2b, 14-й с серотипом 3, 6-й с серотипом 6 (Таблица 1.1). В результате, с учетом индивидуальных профилей, можно выделить 10 серотип-специфических EcoRI профилей и восемь профилей, каждый из которых встречается у штаммов двух различных серотипов.

При сопоставлении EcoRI-профилей штаммов и их географического происхождения корреляции не выявлено (Таблица 1.2). Штаммы, имеющие один и тот же профиль, встречаются в разных странах и на разных континентах. Только европейские штаммы характеризуются несколькими специфическими профилями, но в целом они очень разнообразны – у них выявлено 17 из 18 профилей, за исключением 6-го, обнаруженного у штаммов из Японии.

Также не прослеживается выраженной корреляции между EcoRI-профилем и источником выделения штамма (Таблица 1.3). Однако некоторые ветви и кластеры объединяют штаммы, в основном, изолированные от людей (А и В), диких животных (D), в то время, как одна ветвь (С) состоит, преимущественно, из штаммов, выделенных от сельскохозяйственных животных (см. Рисунок 1.1.).

б) EcoRV-рибопрофили.

После ДНК у 80 зарубежных штаммов EcoRV-рестрикции выявлено 17 гибридизационных профилей (Рисунок 1.3).

Y..pseudotuberculosis При этом у десяти профилей отмечено семь гибридизационных фрагментов, еще Таблица 1.1. Риботипы штаммов Y..pseudotuberculosis (n=80) девяти серотипов из различных стран мира Риботип, Серотип всего/число типов, общих для штаммов разных серотипов* Риботип-EcoRI1 Риботип-EcoRV2 Риботип-EcoRI+EcoRV 18/8* 17/4 27/ 1a 3*, 5*, 9*, 11 3*, 7, 13, 16* 4, 6*, 8*, 9*, 12, 1b 1*, 2, 5*, 8, 9*, 3*, 4*, 5*, 8, 16*, 17 1, 2, 6*, 8*, 9*, 11, 19*, 15*, 16* 2a 1*, 13, 16* 5*, 9, 15 10, 14, 15, 2b 10, 17* 4*, 10, 11 13, 16, 17*, 3 7, 14, 18* 4*, 6, 12 18, 22, 25* 4 3*, 4, 12, 18* 1, 3*, 4*, 14 3, 7, 23, 25*, 5a 17* 4* 17* 5b 15* 4* 19* 6 6 2 Здесь и далее: 1,2 - риботипирование с использованием эндонуклеазы EcoRI, EcoRV, соответственно;

3 - сочетание полученных для каждого штамма EcoRI- и EcoRV-профилей рестрикции.

у семи – шесть. При секвенировании хромосомных генов штамма IP ожидаемые размеры EcoRV-фрагментов, содержащих рРНК оперон, были 8,7;

7,5;

7,3;

6,9;

5,8;

5,8;

5,5 kb [93]. Таким образом, как и при EcoRI-рестрикции, происходит совмещение двух фрагментов одного размера (5,8 kb). Полоса 7,3 kb характерна для всех профилей. Полоса 5,5 kb также присутствует у всех, кроме профиля 1, обнаруженного у одного штамма (см. Рисунок 1.2, 1.3).

Установлено, что 67 % штаммов характеризуются наиболее часто встречающимися EcoRV-профилями - 4-м (17 штаммов), 12-м (10 штаммов), 16-м (10 штаммов), 9-м (9 штаммов), 8-м (8 штаммов). Шесть штаммов имеют индивидуальные профили (1, 6, 10, 13, 14, 15). D = 0,90.

Таблица 1.2. Географическое происхождение штаммов Y. рseudotuberculosis (n=80) различных риботипов Риботип, Страна всего/число типов, общих для штаммов из различных стран* Риботип-EcoRI Риботип-EcoRV Риботип-EcoRI+EcoRV 18/5* 17/6* 27/6* Страны 1*, 2, 3 - 5, 7, 8*, 1, 3*, 4*, 5 – 7, 1, 2, 3, 4, 6, 7, 8*, 9*, 10, Европы 9*, 10 – 13, 14*, 8*, 9*, 10, 11, 11*, 12, 13, 14*, 15, 16, 15*, 16 - 18 12*, 13 -15, 16*, 17, 18*, 19*, 20, 21, 22, 17 23, 24, 25, 26, Канада 9* 16* 8* Тунис 9* 3*, 16* 8*, 9* ЮАР 14* 12* 18* Аргентина 14* 12* 18* Австралия 8*, 14* 8*, 12* 11*, 18* Новая Зеландия 1*, 8* 8*, 9* 11*, 14* Япония 6, 15* 2, 4* 5, 19* Также как и для EcoRI-профилей, не выявлено четкой связи между серотипом и EcoRV-профилем, но, с учетом индивидуальных профилей, показано, что 13 EcoRV-профилей связаны со специфическими серотипами, например, 2-й с серотипом 6, 7-й - c cеротипом 1а, 9-й - с серотипом 2а, 11-й - с серотипом 2b, 12-й - с серотипом 3. Четыре профиля не являются серотип-специфическими (см.

Таблицу 1.1).

Не установлено корреляции между EcoRV-профилем и географическим происхождением штаммов (см. Таблица 1.2), как и при анализе EcoRI-профилей.

Однако сохраняется тенденция кластеризации штаммов, выделенных, преимущественно, из одноименных источников - от людей (кластер В), сельскохозяйственных животных (ветвь С), диких животных и окружающей среды (кластер D) (см. Рисунок 1.3).

Таблица 1.3. Риботипы штаммов Y. рseudotuberculosis (n=80), выделенных их разных источников в различных странах мира Риботип, Источник всего/число типов, общих для штаммов выделения из разных источников* штамма Риботип-EcoRI Риботип-EcoRV Риботип-EcoRI+EcoRV 18/8* 17/6* 27/8* Человек 1*, 2, 3*, 8*, 4, 3*, 7*, 8*, 9*, 2, 4*, 9*, 11*, 14*, 15, 9*, 13, 14*, 12*, 15, 16*, 17 18*, 19*, 24, 25, 15*, 16*, 17*, Дикие животные 1*, 3*, 5, 6, 8*, 1, 2, 3*, 4, 5, 8*, 1, 5, 6, 7, 8*, 9*, 10, 13, 9*, 10, 11, 12, 9*, 10, 11, 12*, 11*, 14*, 17*, 16, 17*, 14*, 15*, 16*, 13, 16* 19*, 20, 21, 17* С/х животные 1*, 3*, 7, 8*, 3*, 6, 7*, 8*, 9*, 3, 4*, 11*, 14*, 18*, 14* 12* Окружающая 9* 7, 16* 8*, среда Наблюдаемые различия в размере гибридизационных фрагментов EcoRI и EcoRV-рибопрофилей могут быть обусловлены либо точечной мутацией (или короткой делецией или инсерцией), которая создает или убирает сайт рестрикции, либо большой хромосомной перестройкой, что изменяет регион, фланкирующий рРНК локус. Так как один EcoRI и EcoRV-сайт находится в каждом рРНК локусе на 5’-конце гена 16S рРНК, разнообразие размеров фрагментов создается вариабельностью 3’ фланкирующего региона. Фрагменты гибридизации 20,5 kb EcoRI-профилей и 7,3 kb EcoRV-профилей, присутствующие у 80 изученных штаммов из различных стран мира, соответствуют одному региону, несущему Степень сходства, % Штамм Серотип Страна Источник EcoRV a b профиль 50 60 70 80 90 Япония Морская свинка. 31554..

IP 6 Япония Морская свинка. 31553..

IP 6 Швейцария Птица. 32879..

IP 1b Италия Заяц. 32721...

IP 2a Франция Коза. 33051..

IP 3 Аргентина Олень. 33097..

IP 3 Болгария Человек. 33108..

IP 3 С Аргентина КРС. 32938..

IP 3 Италия Свинья. 32802..

IP 3 Австралия КРС. 32992..

IP 3 Аргентина КРС. 33105..

IP 3 Бельгия Человек. 32564..

IP 3 Аргентина КРС. 32887..

IP 3 Южная Африка Свинья. 32544..

IP 3 Дания Морская свинка. 30215..

IP 2b Франция Заяц. 32921..

IP 2b Швейцария Обезьяна. 32881..

IP 2b Голландия Заяц. 30911..

IP 2b Франция Обезьяна. 32934...

IP 2b Франция Заяц. 33098...

IP 2b Испания Неизвестен. 32889...

IP 3 Испания Человек. 32984...

IP 3 Испания Человек. 32666...

IP 3 Дания Заяц. 31411...

IP 4 Германия Обезьяна. 33061...

IP 5a Швейцария Морская свинка. 32463...

IP 5a Франция Человек. 32821...

IP 5a Япония Заяц. 33817..

IP 5b Франция Человек. 32950..

IP 1b Франция Человек. 32952...

IP 5a Франция Заяц. 32929...

IP 2b Япония Заяц. 32816..

IP 5b Франция Человек. 33109..

IP 1b Франция Дикое животное. 32699...

IP 5a Англия Человек. 31830...

IP 4 Франция Дикое животное. 32687..

IP 4 Франция Человек. 33285..

IP 1b Франция Человек. 32777..

IP 1b Англия Свинья. 32670..

IP 1b Франция Человек. 32949..

IP 1b Новая Зеландия Олень. 32533..

IP 1b Голландия Человек. 32524..

IP 1b Франция Неизвестен. 32637..

IP 1b Австралия Сумчатое. 33038..

IP 1b Чехословакия Человек. 31524.

IP 1a Украина Грызун. 33161.

IP 1b Украина Человек. 33162.

IP 1b Тунис Мышь. 30642.

IP 1a Франция Человек. 32954..

IP 1a Англия Овца. 31833...

IP 4 Югославия Заяц. 32665.

IP 1a D Канада Бобр. 30437.

IP 1b Германия Обезьяна. 33005.

IP 1a Югославия Заяц. 32651.

IP 1b Франция Заяц. 33291.

IP 1a Англия Птица. 32709.

IP 1b Франция Человек. 32953.

IP 1b Тунис Грызун. IP 1a Италия Голубь. 30284.

IP 1a Норвегия Вода. 32323..

IP 2 Швейцария Человек. 32590.

IP 1a Румыния Почва. 32939.

IP 1a Италия Свинья. 32790.

IP 1a Италия Человек. 32745.

IP 1a Югославия Заяц. 32614.

IP 1a Бельгия Человек. 32581...

IP 2a Франция Человек. 32951...

IP 2a В Новая Зеландия Человек. 32589...

IP 2a Франция Человек. 33293...

IP 2a Испания Свинья. 32584...

IP 2a Франция Антилопа. 32585...

IP 2a Швейцария Обезьяна. 33023...

IP 2a Германия Обезьяна. 33012...

IP 2a Испания Человек. 33054...

IP 2a Франция Человек. 33088..

IP 2a Россия Человек. 33156.

IP 1b Россия Человек. 33157.

IP 1b Россия Человек. 33158.

IP 1b Англия Плод овцы. 31829...

IP 3 Швеция Выдра. 30151..

IP 4 Рисунок 1.3. Дендрограмма EcoRV-профилей риботипирования штаммов Y..pseudotuberculosis (n=80), выделенных в различных странах мира. а, b – гибридизационные фрагменты 7,3 и 5,5 kb, соответственно.

рРНК локус, находящемуся в позиции от 150833 до 155951 на хромосоме Стабильность размеров этих фрагментов Y..pseudotuberculosis IP32953.

свидетельствует о том, что регион, соседний с 3’-концом этого рРНК локуса, менее подвержен мутациям или перестройкам, по сравнению с хромосомными регионами, фланкирующими другие рРНК локусы. Фрагменты 4,7 (EcoRI) и 5, kb (EcoRV) также были обнаружены почти у всех, за исключением четырех и одного штаммов, соответственно. Эти EcoRI- и EcoRV- фрагменты соответствуют другому рРНК локусу, находящемуся в позиции от 320391 до 325633 на хромосоме Y. pseudotuberculosis. Постоянство их размеров, надо полагать, обусловлено расположением фланкирующих EcoRI- и EcoRV-сайтов близко к 3’ концу этого рРНК локуса, т.к. возникновение точечных мутаций или перестроек статистически менее вероятно для коротких участков ДНК. Уникальные сочетания EcoRI и EcoRV-профилей, выявленные у пяти из шести зарубежных штаммов, имеющих по одному индивидуальному профилю (IP33088, IP32687, IP30151, IP32614, IP31829), вероятно, свидетельствуют о крупной хромосомной перестройке, вовлекающей два сайта рестрикции.

в) Риботипы Риботип был определен как сочетание полученных для каждого штамма EcoRI- и EcoRV-профилей рестрикции, гибридизованных с зондом 16S+23S рРНК [129]. Для 80 проанализированных штаммов Y..pseudotuberculosis из различных стран мира определено 27 риботипов (Таблица1.4, Рисунок 1.4). Доминантным риботипом является 18-й (10 штаммов);

каждый из трех риботипов - 11, 14, 17 характеризует восемь штаммов. Таким образом, 42,5 % штаммов относится к этим четырем риботипам. 14 штаммов имеют индивидуальный риботип. Видно также, что, за исключением индивидуальных риботипов 22 и 23, формирующих внешние ветви, все остальные риботипы связаны (коэффициент сходства в среднем 70 %) без выделения главного кластера.

Таблица 1.4. Риботипы штаммов Y. pseudotuberculosis (n=80) из различных стран мира Профили Риботип Кол-во Серотип штаммов EcoRI EcoRV 16 5 1 1 1b 2 16 2 1 1b 3 3 3 1 3 7 4 3 1a 6 2 5 2 1а, 1b 5 16 6 3 4 7 1 1а, 1b, 9 16 8 1а, 1b 9 3 9 1 5 10 1 2a 8 8 11 8 1b 9 7 12 1 1a 10 10 13 1 2b 1 9 14 8 2a 13 15 15 1 2a 17 11 16 1 2b 17 4 17 8 2b, 5a 14 12 18 10 15 4 19 4 1b, 5b 10 11 20 2 2b 11 13 21 1 1a 7 6 22 1 12 1 23 1 16 9 24 1 2a 18 4 25 4 3, 4 14 26 1 1 17 27 3 1b Степень сходства, % Штамм Серотип Страна Источник Риботип 40 50 60 70 80 90 Япония Заяц IP32817 5b Франция Человек IP32950 1b Япония Заяц IP32816 5b A Франция Человек 1b IP33109 Испания Неизвестен IP32889 3 Испания Человек IP32984 Испания Человек IP32666 Англия Человек IP31830 Дания Заяц IP31411 4 Франция Обезьяна 2b IP32934 Франция Заяц 2b IP33098 Германия Обезьяна IP33061 5a Швейцария Морская свинка IP32463 5a Франция Человек IP32821 5a Франция Человек IP32952 5a Франция Заяц IP32929 2b Франция Дикое животное IP32699 5a Дания Морская свинка IP30215 2b Франция Дикое животное IP32687 4 Франция Человек IP33285 1b Франция Человек IP32777 1b Англия Свинья IP32670 1b Франция Человек IP32949 1b Новая Зеландия Олень IP32533 1b Голландия Человек IP32524 1b Франция Неизвестен IP32637 1b Австралия Сумчатое IP33038 1b Чехословакия Человек IP31524 1a Украина Грызун 1b IP33161 Украина Человек 1b IP33162 Тунис Мышь 1a IP30642 Франция Человек 1a IP32954 Англия Овца IP31833 4 Германия Обезьяна IP33005 1a Югославия Заяц IP32651 1b Италия Голубь IP30284 1a Югославия Заяц IP32665 1a D Канада Бобр IP30437 1b Франция Заяц IP33291 1a Англия Птица IP32709 1b Тунис Грызун 1a IP31878 Норвегия Вода IP32323 2 Швейцария Человек 1a IP32590 Италия Свинья IP32790 1a Италия Человек IP32745 1a Югославия Заяц IP32614 1a Румыния Почва IP32939 1a Франция Человек IP32953 1b Франция Заяц IP32921 2b Швейцария Обезьяна IP32881 2b Голландия Заяц IP30911 2b Бельгия Человек IP32581 2a Новая Зеландия Человек 2a IP32589 Франция Человек IP33293 2a Испания Свинья IP32584 2a B Франция Антилопа IP32585 2a Швейцария Обезьяна IP33023 2a Германия Обезьяна IP33012 2a Испания Человек IP33054 2a Франция Человек IP32951 2a Франция Человек IP33088 2a Россия Человек IP33156 1b Россия Человек IP33157 1b Россия Человек IP33158 1b Швейцария Птица IP32879 1b Италия Заяц IP32721 2a Япония Морская свинка IP31554 Япония Морская свинка IP31553 6 Франция Коза IP33051 3 Аргентина Олень IP33097 3 Болгария Человек IP33108 3 Аргентина КРС C IP32938 Италия Свинья IP32802 3 Австралия КРС IP32992 3 Аргентина КРС IP33105 3 Бельгия Человек IP32564 3 КРС IP32887 3 Aргентина Южная Африка Свинья IP32544 3 Англия Плод овцы IP31829 3 Швеция Выдра IP30151 4 Рисунок 1.4. Дендрограмма риботипов штаммов Y. pseudotuberculosis (n=80), выделенных в различных странах мира.

Индекс дискриминации риботипирования при комбинировании двух профилей составил 0,94, превосходя его значения при анализе индивидуальных EcoRI- и EcoRV-профилей и при серотипировании (D=0,72), что свидетельствует о высоком дискриминирующем потенциале метода.

Анализ связи между риботипом и серотипом показывает, что в шести случаях (риботипы 6, 8, 9, 17, 19, 25) один и тот же риботип выявляется у штаммов двух разных серотипов либо подсеротипов (см. Таблица 1.1). Однако для большинства риботипов (n=21) установлена корреляция с серотипами. Таким образом, риботипирование позволило субтипировать штаммы внутри данных серотипов. Например, 13 штаммов серотипа 1а могут быть подразделены на шесть риботипов, 20 штаммов серотипа 1b – на восемь, 14 штаммов серотипа 3 - на три, 11 штаммов серо типа 2а – на четыре.

При изучении распространения штаммов 27-ми выявленных риботипов в различных географических регионах установлено, что наибольшей гетерогенностью отличаются европейские штаммы – из 27 выявленных риботипов 26 встречаются у штаммов, изолированных в Европе, 20 из них при этом не обнаружены у штаммов из других континентов, включая другой доминантный риботипт – 17 (см. Рисунок1.4, Таблица 1.2). Но при этом 28 % европейских штаммов относятся к трем из четырех превалирующих риботипов (11, 14, 18), характеризующих штаммы также из других континентов. Выявлен риботип, характерный только для Японии (5-й);

штаммы, циркулирующие в Австралии и Новой Зеландии, т.е. территориально близких странах, входящих в регион Австралазии, характеризуются одним риботипом (11-ый). Вместе с тем, проведенный кластерный анализ зарубежных штаммов показал, что штаммы определенных риботипов, выделенных в одной стране или на одном континенте, распределяются между различными кластерами. С другой стороны, штаммы из различных континентов образуют один кластер или относятся к одному риботипу.

Также не происходит четкой кластеризации штаммов в зависимости от источника их выделения (см. Рисунок 1.4), что согласуется с положением об убиквитарном распространении псевдотуберкулезного микроба в природе, циркулирующего в объектах окружающей среды и среди широкого круга животных, формирующих резервуары возбудителя инфекции для человека.

Исключение составляют штаммы доминантного риботипа 18 (кластер С), выделенные от людей и от сельскохозяйственных животных, но не из объектов окружающей среды, на различных континентах (в Африке, Южной Америке, Австралии, Европе). Вместе с тем, отдельные кластеры также сформированы, в основном, штаммами, отличающимися источниками выделения – это люди (кластеры А, В), дикие животные и окружающая среда (кластер D).

1.1.2. Риботипирование штаммов Y. pseudotuberculosis из различных регионов России а) EcoRI-рибопрофили Установлено, что российские штаммы, по сравнению со штаммами из других стран, отличаются меньшим разнообразием. У 193 штаммов серотипа О: (7 штаммов подсеротипа О:1а и 186 - О:1b), выделенных в трех ФО страны, выявлено шесть гибридизационных профилей (D=0,34) (Рисунок 1.5), характеризующихся наличием шести фрагментов рестрикции хромосомной ДНК.

Пять профилей (1, 2, 3, 5, 9) по размеру фрагментов идентичны EcoRI-профилям европейских штаммов. Соответственно, у всех профилей российских штаммов также обнаружены полосы 20,5 и 4,7 kb (последняя отсутствует у двух штаммов профиля 2), общие с профилями зарубежных штаммов. Между тем, один профиль (19-й) является специфическим для штаммов из России, и не встречается в других странах мира. Он характеризует российские штаммы, выделенные в Сибири и на Дальнем Востоке, доля которых составляет 14 % от всех изученных штаммов.

Самым распространенным является профиль 1, выявленный у 79 % штаммов из всех трех регионов России. Он также является одним из преобладающих у штаммов из Европы (п. 1.1.1). Штаммы, имеющие профили 1 и 19, разнообразны по происхождению: их изолировали при спорадических заболеваниях, во время 18-ти вспышек, а также из разных источников при проведении планового Рисунок 1.5. Дендрограмма EcoRI-профилей риботипирования штаммов выделенных в трех ФО России. а, b – Y..pseudotuberculosis (n=193), гибридизационные фрагменты 20,5 и 4,7 kb, соответственно.

мониторинга циркуляции возбудителя (см. Приложение А1). Эти штаммы образуют главный кластер R1 (n=180), между ними наблюдается выраженное родство – коэффициент сходства 84 %. Остальные четыре профиля (2, 3, 5, 9) относятся к 13 штаммам (7 %), формирующим кластер R2 (коэффициент сходства между штаммами - 73-87 %). Интересно отметить, что все эти четыре профиля идентичны профилям европейских штаммов. Из них профиль 9, являющийся одним из преобладающих у штаммов из Европы, относится почти к половине штаммов кластера R2 (6 из 13), профиль 2 на территории России встречается только у штаммов северо-западного региона, 5-ый – у дальневосточного. При этом штаммы профиля 5, также как и европейские штаммы, не вызывают заболеваний человека. В целом, штаммы кластера R2 были изолированы от больных во время двух групповых заболеваний (4 штамма) и при проведении планового мониторинга циркуляции возбудителя (7 штаммов - от грызунов, у двух - источник неизвестен) в трех регионах страны (см. Приложение А1).

Соотношение серотип для российских штаммов - EcoRI-профиль показывает, что три из шести EcoRI-профилей (1, 2, 19) встречаются только у штаммов серотипа 1b (см. Рисунок 1.5). Профили 3, 5, 9 характеризуют только штаммы кластера R2 - как все семь изученных штаммов серотипа О:1а, так и пять штаммов серотипа 1b. Таким образом, также как и у штаммов из других стран, эти три профиля связаны с разными серотипами.

Учитывая расположение 13 российских штаммов вне основного кластера и сходство характеризующих их профилей рестрикции с таковыми для штаммов из других регионов мира, был проведен анализ EcoRI-профилей одновременно всех 273 изученных штаммов. Дендрограмма на Рисунке 1.6 показывает, что эти штаммы из России кластеризуются со штаммами из других стран, для которых источниками выделения также были люди (кластер А на Рисунке 1.1), дикие животные и окружающая среда (кластер D на Рисунке 1.1), формируя кластеры А+R2 и D+R2, соответственно (коэффициент сходства 76 % ). В свою очередь, штаммы главного кластера R1, имеющие профиль 1, объединяются с зарубежны Рисунок 1.6.Дендрограмма EcoRI-профилей риботипирования изученных штаммов Y. pseudotuberculosis (n=273). а, b – гибридизационные фрагменты 20,5 и 4,7 kb, соответственно.

ми штаммами, которые при построении дендрограммы EcoRI-профилей штаммов из различных стран мира входили в кластер В (см. Рисунок 1.1) и были выделены от людей и животных (кластер В+R1).

б) EcoRV-рибопрофили.

У российских штаммов идентифицировано семь EcoRV-профилей рестрикции, гибридизованных с зондом 16S+23S рРНК (D=0,44) (Рисунок 1.7). Из них шесть профилей характеризуются шестью рестрикционными фрагментами, и Рисунок 1.7. Дендрограмма EcoRV-профилей риботипирования штаммов выделенных в трех ФО России. а, b – Y..pseudotuberculosis (n=193), гибридизационные фрагменты 7,3 и 5,5 kb, соответственно.

один индивидуальный профиль 20 имеет семь фрагментов. Три профиля (3, 7, 16) по количеству и молекулярной массе фрагментов рестрикции идентичны профилям зарубежных штаммов. Соответственно, у всех профилей российских штаммов также обнаружены полосы 7,3 и 5,5 kb. Четыре профиля (17, 18, 19, 20) встречаются только у штаммов, циркулирующих на территории России.

Аналогично результатам определения EcoRI-профилей, большинство российских штаммов различного происхождения имеют специфические профили 17 и 18 (72 и 21 % штаммов, соответственно;

n=180). Они образуют главный кластер R1 и имеют высокую степень родства (коэффициент сходства 85 %). У более гетерогенных 13 штаммов, формирующих кластер R2 (коэффициент сходства 78 93 %), выявлено пять профилей, включающих три идентичных для зарубежных штаммов (3, 7, 16) и два - специфических для российских (19 и 20). Профили 16 и 20 характерны для штаммов северо-западного региона, при этом профиль является одним из преобладающих у европейских штаммов;

профиль характерен для штаммов из дальневосточного региона.

Четыре EcoRV-профиля - 16, 17, 18, 20 - связаны только с серотипом 1b.

Серотипу 1а, как и у европейских штаммов, соответствует профиль 7, а также 19.

Таким образом, за исключением профиля 3, характеризующего один штамм серотипа 1а (IP 33163) и три штамма серотипа 1b, для шести из семи EcoRV профилей показана корреляция с серотипами.


Сопоставление результатов определения EcoRI- и EcoRV-рибопрофилей показало, что российские штаммы кластера R2 на дендрограмме EcoRV-профилей всех изученных 273 штаммов (Рисунок 1.8) также входят в один кластер D+R2 со штаммами из Европы, Туниса, Канады (кластер D на Рисунке 1.3). Штаммы кластера R1 имеют специфические EcoRV-профили, вследствие чего на дендрограмме они не кластеризуются со штаммами из других стран, но отличаются близким расположением с европейскими штаммами из кластера В (коэффициент сходства 68 %).

Рисунок 1.8. Дендрограмма EcoRV-профилей риботипирования изученных штаммов Y. pseudotuberculosis (n=273). а, b – гибридизационные фрагменты 7,3 и 5,5 kb, соответственно.

в) Риботипы.

В результате сочетания шести EcoRI- и семи EcoRV-профилей рестрикции, определенных для штаммов, распространенных на территории России, выявлено 11 риботипов, что свидетельствует об относительной гомогенности российской популяции (Рисунок 1.9, Таблица 1.5). Три из 11-ти риботипов индивидуальны Рисунок 1.9. Дендрограмма риботипов штаммов Y..pseudotuberculosis (n=193), выделенных в трех ФО России.

Таблица 1.5. Риботипы штаммов Y. pseudotuberculosis (n=193), распространенных в трех ФО России Профили Риботип Кол-во Серотип штаммов EcoRI EcoRV 2 16 2 2 1b 3 3 3 1 1b 1а 3 7 4 1а, 1b 9 3 1, 1а 9 7 12 1 17 27 137 1b 9 20 28 1 1b 19 17 29 2 1b 19 18 30 25 1b 1а 5 19 31 1 18 32 16 1b (D=0,47). В наших исследованиях пять из 11 риботипов (2, 3, 4, 9, 12) идентичны риботипам, встречающимся у штаммов из европейских стран, шесть (27-32) являются специфическими для России. При этом частота встречаемости штаммов различных риботипов значительно варьирует. Большинство изученных российских штаммов относится к трем риботипам, входящим в состав главного кластера R1 (n=180): 27-му (71 % штаммов), 30-му (13 %) и 32-му (8 %).

Четвертый риботип в этом кластере (29-й) характеризует только два штамма (1%).

При этом у штаммов, выделенных на территориях всех трех ФО, выявлены доминирующий риботип 27 и также 32. Определены штаммы локальных риботипов, характерных для определенных территорий: например, 29-й риботип встречается у штаммов в Дальневосточном ФО, 30-й – в Сибирском.

Для 13 штаммов кластера R2 при комбинировании четырех EcoRI- и пяти EcoRV-профилей рестрикции получено семь риботипов, среди которых все пять, идентичных европейским штаммам, а также 28-й и 31-й.

При рассмотрении корреляции риботип – серотип установлено, что из риботипов три дифференцируют серотип 1а, семь -1b. Единственный риботип характеризует два серотипа - один штамм серотипа 1а (IP33163) и два штамма серотипа 1b, что согласуется с результатами для EcoRV-рибопрофилей.

Анализ риботипов всех 273 изученных штаммов (Рисунок 1.10) показывает, что, в соответствии с определением EcoRI- EcoRV-рибопрофилей, штаммы редких для России генетических вариантов (кластер R2), идентичных или близкородственных выявленным у штаммов из других стран мира, входят в состав кластера D+R2, включающего также зарубежные штаммы из европейских стран, Туниса и Канады. Большая часть штаммов этого кластера (22 штамма из 34 – 65 %) изолирована от диких животных и из окружающей среды. При этом российские и зарубежные штаммы обладают выраженным родством (коэффициент сходства 82 %).

Российским штаммам основного кластера R1 наиболее близки зарубежные штаммы кластера B (коэффициент сходства 80 %), выделенные, в основном от людей. За исключением индивидуального риботипа 23, находящегося во внешней ветви дендрограммы, все остальные риботипы изученных штаммов Y..pseudotuberculosis, распространенных на различных континентах, связаны между собой (коэффициент сходства не менее 61 %).

Таким образом, в результате изучения штаммов Y. pseudotuberculosis (n=273) из различных регионов мира методом риботипирования, показано, что данный метод молекулярного типирования, по сравнению с серотипированием, обладает более высокой дискриминационной силой и может быть использован для внутривидового дифференцирования Высокий Y. pseudotuberculosis.

дискриминационный потенциал метода достигнут в результате комбинирования для каждого штамма индивидуальных EcoRI- и EcoRV-профилей рестрикции.

Показано, что представители глобальной популяции Y. pseudotuberculosis характеризуются более выраженным генетическим полиморфизмом по локусам хромосомы, содержащим рРНК опероны, в сравнении с российской популяцией.

У 80 проанализированных штаммов Y. pseudotuberculosis из различных стран мира определено 27 риботипов (D=0,94). Напротив, у 193 исследованных штаммов из трех регионов России выявлено 11 риботипов (D=0,47), что указывает Рисунок 1.10. Дендрограмма риботипов изученных штаммов Y..pseudotuberculosis (n=273).

на относительную гомогенность российской популяции по указанному маркеру.

Установлено также отличие генетических вариантов российских штаммов от штаммов, выделенных в других странах мира, определены риботипы, характерные только для штаммов, распространенных на территории России, как доминирующие, так и регион-специфические. В то же время, небольшая часть российских штаммов (7 %) характеризуется выраженным сходством с зарубежными. Они относятся к редким генетическим вариантам, которые идентичны или близкородственны выявленным у штаммов из других стран.

Таким образом, представленные данные свидетельствуют о том, что риботипирование является достаточно эффективным методом внутривидового дифференцирования Y. pseudotuberculosis, который может быть рекомендован для контроля за циркуляцией возбудителя. Однако он обладает некоторыми ограничениями: 1) рестрикционные профили характеризуются малым числом полос (6-7), что лимитирует дискриминационную силу метода;

2) размеры отдельных полос различаются незначительно, что иногда затрудняет анализ профилей.

1.2. Оценка геномного полиморфизма Y. pseudotuberculosis по маркерам IS1541 и IS285 методом RFLP 1.2.1. Выбор зонда для гибридизации Учитывая, что в геноме Y. pseudotuberculosis присутствуют вставки IS100, IS285 и IS1541, необходимо было определить, какой из трех зондов следует использовать для гибридизации с фрагментами рестрикции ДНК определенной эндонуклеазой для достижения оптимальных результатов гибридизации (количество, четкость и интенсивность полос). Однако ранее было проказано, что IS100 встречается в геноме не у всех штаммов Y. pseudotuberculosis [109, 171].

Также при анализе сиквенса хромосомных генов штамма Y. pseudotuberculosis IP32953 (№ NC 006155 в базе NCBI) [93] в ходе настоящей работы выявлено, что два сайта узнавания для рестриктазы EcoRV находятся внутри самой последовательности IS285. Таким образом, зонд IS285 можно использовать только для гибридизации с мембранами, несущими EcoRI-профили рестрикции ДНК. С целью выбора зонда для гибридизации с мембранами, несущими EcoRI-, рестрикции, были отобраны мембраны с различными EcoRV-профили рибопрофилями штаммов нескольких серотипов.

Y. pseudotuberculosis Контрольными образцами на каждой мембране являлись профили рестрикции ДНК Y. pestis (штамм 6/69). В соответствии с полученными результатами (Таблица 1.6), для увеличения дискриминирующей силы метода использовали комбинацию двух зондов и профилей рестрикции ДНК двумя эндонуклеазами:

ДНК, рестрицированную EcoRI, гибридизовали с зондом IS285, EcoRV – с зондом IS1541.

При проведении IS-RFLP-типирования анализ профилей и построение дендрограмм кластеризации штаммов осуществляли для индивидуальных IS285 и IS1541-профилей и их сочетаний (2IS-RFLP). Для оценки результатов внутривидового типирования полученные данные Y. pseudotuberculosis сопоставляли с данными риботипирования, представленными в п. 1.1.

1.2.2. IS-RFLP-типирование штаммов Y. pseudotuberculosis из различных стран мира а) IS285-RFLP-профили.

RFLP-анализ при использовании зонда IS285 позволил идентифицировать у 80 штаммов 43 профиля, различающихся количеством (1-11) и молекулярной массой рестрикционных фрагментов ДНК, содержащих данный IS-элемент (Рисунок 1.11, 1.12). У 60 % штаммов на хромосоме присутствует от одной до четырех копий IS285. При этом, в соответствии с количеством копий IS285 в геноме, происходит внутрикластерная дифференциация штаммов большинства EcoRI-рибопрофилей (восьми из 12 не индивидуальных) и, соответственно, Таблица 1.6. Результаты гибридизации мембран, несущих EcoRI-, EcoRV профили рестрикции, с различными IS-зондами Характеристика Результат гибридизации с IS-зондом мембран IS100 IS285 IS EcoRI- рибопрофили серотип О:1b Y. pestis 6/69 имеет профили 1, 2, 9, 19 четкий IS-профиль.

В профилях рестрикции ДНК серотипы O:1b, O:2b, Все штаммы Все штаммы Y.pseudotuberculosis O:3, O:4c, O:5a полос нет. характеризуются характеризуются профили 2, 3, 14, определенными IS- определенными IS серотип О:1b Y. pestis 6/69 имеет профилями, профилями, профили 1, 2, 3, 9 четкий IS-профиль.


большинство полос интенсивность В нескольких профилях четкие с хорошей и четкость полос рестрикции ДНК интенсивностью разная Y.pseudotuberculosis есть 1-5 полос, большинство - слабой интенсивности.

В остальных - полос нет.

EcoRV-рибопрофили серотип О:1b Y. pestis 6/69 имеет профили 17, 18 четкий IS-профиль.

В профилях рестрикции cеротипы O:3, O:4c, ДНК O:5a, O: Все штаммы профили 2, 4, 12, 14 Y.pseudotuberculosis полос нет. характеризуются cеротипы O:2a, O:5a определенными IS профили 4, 5, Полос нет профилями, серотипы О:1а, О:1b Y. pestis 6/69 имеет большинство полос профили 3, 4, 16, 17, 18, четкий IS-профиль.

четкие с хорошей В нескольких профилях интенсивностью рестрикции ДНК Y.pseudotuberculosis есть 1-5 полос, большинство - слабой интенсивности.

В остальных - полос нет.

a b Степень сходства, % Штамм Серотип Страна Источник IS285 профиль 20 40 60 80 Югославия Заяц IP 32651 1b Грызун Тунис IP 31878 1a Голубь Италия IP 30284 1a Англия Птица IP 32709 1b Италия Свинья IP 32790 1a Италия Человек IP 32745 1a Франция Человек IP 32953 1b Югославия Заяц IP 32665 1a Швейцария Человек IP 32590 1a Дания Заяц IP 31411 4 D2 Канада Бобр IP 30437 1b Франция Заяц IP 33291 1a Норвегия Вода IP 32323 2 Германия Обезьяна IP 33005 1a Чехословакия Человек IP 31524 1a Тунис IP 30642 1a Mышь Франция Человек IP 32954 1a Англия Овца IP 31833 4 Румыния Почва IP 32939 1a Югославия Заяц IP 32614 1a Япония Заяц IP 32816 5b Япония Морская свинка IP 31554 6 Морская свинка Япония IP 31553 6 Человек Россия IP 33156 1b Россия Человек IP 33157 1b Россия Человек IP 33158 1b Швейцария Птица IP 32879 1b Бельгия Человек IP 32581 2a Заяц Италия IP 32721 2a Человек Франция IP 32951 2a Новая Зеландия Человек IP 32589 2a Франция Человек IP 33088 2a Франция Человек IP 33293 2a Испания Свинья IP 32584 2a B1 Антилопа Франция IP 32585 2a Обезьяна Швейцария IP 33023 2a Германия Обезьяна IP 33012 2a Испания Человек IP 33054 2a Япония Заяц IP 32817 5b Испания Неизвестен IP 32889 3 Испания Человек IP 32984 3 Франция Заяц IP 33098 2b Человек Франция IP 32952 5a Дания Морская свинка IP 30215 2b Испания Человек IP 32666 3 Франция Обезьяна IP 32934 2b D1 Франция Заяц IP 32921 2b Швейцария Обезьяна IP 32881 2b Германия Обезьяна IP 33061 5a Швейцария Морская свинка IP 32463 5a Франция Человек IP 32821 5a Франция Заяц IP 32929 2b Франция Дикое животное IP 32699 5a Голландия Заяц IP 30911 2b Франция Коза IP 33051 3 Аргентина Олень IP 33097 3 Болгария Человек IP 33108 3 Аргентина КРС IP 32938 3 C Италия Свинья IP 32802 3 КРС Австралия IP 32992 3 Аргентина КРС IP 33105 3 Плод овцы Англия IP 31829 3 Человек Бельгия IP 32564 3 Аргентина КРС IP 32887 3 Южная Африка Свинья IP 32544 3 Франция Человек IP 32950 1b Франция Человек IP 33109 1b Человек Франция IP 32777 1b Человек Франция IP 32949 1b В Англия Свинья IP 32670 1b Франция Человек IP 33285 1b Новая Зеландия Олень IP 32533 1b Франция Неизвестен IP 32637 1b Сумчатое Австралия IP 33038 1b Украина Грызун IP 33161 1b Человек Украина IP 33162 1b Англия Человек IP 31830 4 Голландия Человек IP 32524 1b Франция Дикое животное IP 32687 4 Выдра Швеция IP 30151 4 Рисунок 1.11. Дендрограмма IS285-RFLP-профилей штаммов Y..pseudotuberculosis (n=80), выделенных в различных странах мира. а, b – наиболее распространенные гибридизационные фрагменты, присутствующие у 80 и 50 % профилей, соответственно.

IS285-профили IS1541-профили 1 8 9 22 25 31 1 2 9 10 38 Рисунок 1.12. Варианты рестрикционных штаммов IS-профилей Y..pseudotuberculosis.

риботипов (см. Рисунок 1.1). Она наиболее выражена у штаммов, характеризующихся двумя EcoRI-профилями 8 и 9, которые подразделяются соответственно, на семь и девять IS285-типов. Остальные шесть EcoRI-профилей разделены на два-пять IS285-профилей.

Шесть IS285-профилей (3, 10, 20, 24, 31, 41) характеризуют по два штамма каждый. 34 профиля являются индивидуальными.

Вместе с тем, три IS285-профиля выявлены почти у половины штаммов (42,5 %) (D=0,94). Практически равные значения индекса дискриминации для риботипирования и IS285-RFLP обусловлены тем, что значительная часть штаммов (42,5 %) характеризуется как доминирующими риботипами (11, 14, 17, 18), так и доминирующими IS285-профилями (1, 22, 30). При этом наблюдается четкая взаимосвязь определенных риботипов и IS285-типов: риботипу соответствует IS285-профиль 1, риботипу 17 – 30-й, риботипу 18 – 22-й. На IS285-RFLP дендрограмме эти штаммы формируют ветви В1, С и основную ветвь кластера D1, входящие в состав одного крупного кластера (показан рамкой), и отличаются малым числом копий IS285 на хромосоме – характеризующие их профили рестрикции имеют 1-3 гибридизационных фрагмента (см. Рисунок 1.11).

При этом один фрагмент (а) является общим как для IS285-профилей 1, 22, 30, так и в целом присутствует у 64 из 80 изученных штаммов (80 %). Анализ сиквенса хромосомных генов штамма Y. pseudotuberculosis IP32953 показал, что только один IS-элемент, IS285 (YPTB0012) расположен сразу за рРНК опероном [93]. Этому региону, находящемуся в позиции от 12923 до 33518 на бактериальной хромосоме, соответствует фрагмент гибридизации 20,5 kb, присутствующий у всех рестрикции, полученных при EcoRI-профилей риботипировании. Надо полагать, что наличие у большинства IS285-профилей этого консервативного фрагмента связано именно с транспозицией IS непосредственно за рРНК опероном в позиции от 17956 до 19143 и отсутствием мутаций в сайтах рестрикции EcoRI или хромосомных перестроек в этом регионе.

Некоторые другие IS285-типы также связаны с определенными риботипами, например, IS-типам 20 и 41 cоответствует 9-й риботип, IS-типу 31 – 5-й, IS-типу 24 – 19-й и т.д. (см. Приложение А). Это, вероятно, можно объяснить тем, что при определенном расположении рРНК оперонов, характризующем данный риботип, в различных участках хромосомы наблюдаются стабильные инсерции IS285 при отсутствии модификаций в EcoRI-сайтах рестрикции. Нельзя исключить также, что встраивание IS285 может происходить непосредственно в регионах, фланкирующих 3’-конец рРНК локуса, подобно YPTB0012.

Еще одна консервативная вставка IS285 (b) присутствует в геноме у 50 % штаммов (см. Рисунок 1.11).

Установлено, что доминантные IS285-профили связаны со следующими серотипами: 1-й – с 1b и 2а, 22-й – только с 3-м, 30-й – с 2b и 5а. Пять из шести профилей, относящихся к парам штаммов, связаны со своими специфическими серотипами. Таким образом, большинство IS285-профилей (40 из 43) дифференцируют штаммы внутри серотипов. Наиболее гетерогенными являются широко распространенные серотипы 1а и 1b (Таблица 1.7). При этом 8 из профилей серотипа 1b входят в состав одного кластера В2 (см. Рисунок 1.11).

Четкой корреляции между и географическим IS285-профилями происхождением штаммов не обнаружено, не происходит строгого выделения штаммов из одной страны или одного континента в единый кластер, однако, за исключением трех профилей, остальные 40 связаны со штаммами в зависимости от места их выделения. Эти результаты отличаются от выявленных EcoRI рибопрофилей и риботипов. Доминантные профили 1 и 30 встречаются только у европейских штаммов (исключение составляет один штамм из Новой Зеландии).

С другой стороны, именно штаммы из Европы отличает наибольшее разнообразие по присутствию IS285 в геноме. Штаммы из Японии (профили 31, 38) входят в один кластер. Аналогичная закономерность прослеживается для штаммов из Таблица 1.7. IS-типы штаммов Y..pseudotuberculosis (n=80) девяти серотипов из различных стран мира IS-тип, всего/число типов, общих для штаммов разных серотипов* Серотип IS285-тип IS1541-тип 2IS-тип 43/3* 61/0 73/ 1a 6, 9, 13, 15, 18-20, 23, 4, 18, 56, 22 2, 3, 7, 9, 10, 12 - 14, 33, 34, 37, 40 16, 20, 22 - 1b 1*, 3, 4, 12, 14, 16, 17, 1, 3, 6, 17, 21, 1, 4, 5, 6, 8, 11, 15, 26, 24, 27- 29, 41, 43 23 - 27, 57 - 61 17-19, 21, 25, 26, 71- 29, 34 – 41, 43, 2a 1*, 21 2, 10, 31 - 34, 43, 47- 2b 7, 8, 10*, 30* 19, 20, 44 - 46 27, 28, 30, 31, 32, 45 – 54, 55, 3 2, 22, 25, 35 5, 7, 8, 28, 35 - 41, 4 5, 11, 36, 39, 42 9, 11, 29, 42, 54 57, 58, 59, 60, 5a 10*, 30* 12 - 14, 30, 53 63, 65 - 5b 32, 38 51, 52 62, 6 31 15, 16 69, соседних территорий Австралии и Новой Зеландии (профили 12, 43). Повсеместно распространены штаммы, характеризующиеся IS285-профилем 22 (см. Рисунок 1.11, Таблица 1.8).

Сравнительный анализ показал, что на дендрограмме IS285-профилей, как и на дендрограммах EcoRI-рибопрофилей и, соответственно, риботипов, можно выделить отдельные ветви и кластеры, включающие штаммы, для которых Таблица 1.8. Географическое происхождение штаммов Y. рseudotuberculosis (n=80) различных IS-типов IS-тип, Страна всего/ число типов, общих для штаммов из различных стран* IS285-тип IS1541-тип 2IS-тип 43/3* 61/3* 73/2* Страны 1*, 2, 3, 5 - 11, 1 – 3, 4*, 5*, 6, 8 - 1 - 7, 12 - 14, 16 Европы 13 - 18, 20*, 21, 14, 17 - 22, 24 - 36, 43, 45*, 46, 48, 22*, 21--30, 38*, 40 - 46, 48 - 50, - 52, 54*, 56 - 61, 33 - 37, 39-42 53, 54, 57 - 59 63, 65 - 68, 71 - Канада 4 61 Тунис 19, 20* 4*, 56 9, ЮАР 22* 55 Аргентина 22* 5*, 7, 38*, 39 45*, 49, 54*, Австралия 22*, 43 23, 37 15, Новая Зеландия 1*, 12 47, 60 11, Япония 31, 32, 38 15, 16, 51, 52 60, 64, 69, источниками выделения были, преимущественно, больные псевдотуберкулезом люди (В1, В2), домашний скот (С), дикие животные и окружающая среда (D1, D2) (см. Рисунок 1.11). При этом на дендрограмме риботипов (см. Рисунок 1.4) штаммы кластера В (типы 14, 15, 24, 27), изолированные от людей, соответственно, идентичны штаммам IS285-профиля 1 ветви В1 (см. Рисунок 1.11), кластеризованные штаммы риботипа 11 – штаммам кластера В2;

штаммы серотпа О:3 риботипа 18 ветви С, изолированные от сельскохозяйственных животных, идентичны штаммам, характеризующимся доминантным IS285 профилем 22, формирующим подобную ветвь. Штаммы, изолированные от диких животных распределены следующим образом: кластеризованным штаммам риботипов 16 и 17 соответствуют штаммы кластера в котором D1, преобладающим профилем является 30-й, штаммам кластера D – штаммы кластера D2. В целом, 37 из 43 IS285-профилей характеризуют штаммы в зависимости от источника их выделения (Таблица 1.9). Однако и в этом случае оказалось невозможным четко распределить штаммы из одноименных источников по отдельным кластерам.

б) IS1541-RFLP-профили.

У 80 изученных штаммов идентифицирован 61 IS1541-профиль. Показано, что количество копий IS1541 на хромосоме Y. pseudotuberculosis отличается выраженной вариабельностью - от 1-й до 33-х. 56 % гибридизационных профилей характеризуется наличием 5-14 полос (Рисунок 1.12). Таким образом, частота транспозиции IS1541 в геноме выше, по сравнению с IS285. Вероятно, это можно объяснить разницей в размерах IS элементов: длина IS285 составляет п.н., IS1541 – 459 п.н. Наиболее часто встречающиеся вставки IS присутствуют в геноме у 50 и 55 % штаммов, соответственно (Рисунок 1.13.).

Только один профиль (4-й) является доминантным (11 штаммов), 9 пар штаммов характеризуются каждая своим профилем, остальные IS1541-профили (51 тип) определены как индивидуальные, что обусловило высокую дискриминирующую способность метода (D = 0,98).

Разнообразие IS1541-профилей позволяет субтипировать штаммы всех девяти изученных подсеротипов Y. pseudotuberculosis. Серотипу 1b соответствует наибольшее число профилей (15) (см. Таблица 1.7). Штаммы разных IS профилей, относящиеся к одному серотипу, на дендрограмме часто входят в состав одного кластера.

Таблица 1.9. IS-типы штаммов Y. рseudotuberculosis (n=80), выделенных их разных источников в различных странах мира IS-тип, Источник всего/ число типов, общих для штаммов выделения из разных источников* штамма IS285-тип IS1541-тип 2IS-тип 43/6* 61/3* 73/2* Человек 1*, 3, 10*, 14, 1-3, 4*, 5*, 6, 8, 14, 1, 3, 5, 6, 19, 20, 15, 18, 20*, 22*, 18, 22, 26, 27, 30, 31, 22, 23, 26, 29, 34, 24-26, 28, 30*, 34, 36, 40, 43, 47, 48, 36, 41, 43, 44, 45*, 35, 37, 41*, 42 54, 57*, 58, 59 46, 52, 56, 60, 63, 65, 71, 72, 73* Дикие животные 1*, 4-9, 10*, 12, 4*, 9- 13, 15- 17, 19- 7-12, 14-17, 21, 16, 19, 20*, 29, 21, 23, 25, 32, 33, 42, 24, 25, 27, 28, 30 30*, 31-34, 36, 44-46, 50-53, 56, 57*, 32, 35, 38- 40, 42, 38, 39, 41*, 43 60, 61 57, 59, 61, 62, 64, 66-70, 73* С/х животные 1*, 11, 22, 27, 40 4*, 5*, 7, 24, 28, 29, 2, 18, 37, 45*, 47 37-39, 41, 49, 55 49, 51, 53-55, Окружающая 21, 23 4* 13, среда В ряде случаев штаммы, формирующие отдельные ветви и кластеры на дендрограммах и риботипов также IS1541-профилей, EcoRV-профилей идентичны по своему географическому происхождению и источнику выделения.

При этом, по сравнению с IS285-типированием, происходит более выраженная внутрикластерная дифференциация штаммов, в зависимости от количества копий IS1541. Так, штаммам кластера В риботипа 14 серотипа 2а, изолированным в соседних странах Испании, Франции, Германии (см. Рисунок - 1.4), соответствуют штаммы кластера В1, в отличие от единого IS285-профиля 1, a Степень сходства, % Штамм Серотип Страна Источник IS1541- ST профиль 20 40 60 80 Франция Человек IP 33088 2a 43 Франция Человек IP 33293 2a В1 Германия Обезьяна IP 33012 2a 33 Франция Антилопа IP 32585 2a 50 Испания Свинья IP 32584 2a 49 Франция Человек IP 32951 2a 31 Англия Плод овцы IP 31829 3 41 Франция Коза IP 33051 3 38 Аргентина Олень IP 33097 3 38 Болгария Человек IP 33108 3 40 С Аргентина КРС IP 33105 3 39 КРС Австралия IP 32992 3 37 Бельгия Человек IP 32564 3 5 Аргентина КРС IP 32887 3 5 Аргентина КРС IP 32938 3 7 Италия Свинья IP 32802 3 28 Южная Африка Свинья IP 32544 3 55 Япония Заяц IP 32817 5b Япония Заяц IP 32816 5b 51 Тунис Мышь IP 30642 1a 56 Франция Человек IP 32954 1a d2 Чехословакия Человек IP 31524 1a 22 Англия Овца IP 31833 4 29 Дания Заяц IP 31411 4 9 Япония Морская свинка IP 31554 6 15 Япония Морская свинка IP 31553 6 16 Испания Человек IP 32666 3 Франция Дикое животное IP 32687 4 Англия Человек IP 31830 4 54 Испания Неизвестен IP 32889 3 35 Испания Человек IP 32984 3 Франция Человек IP 32950 1b Франция Человек IP 33109 1b 6 Россия Человек IP 33157 1b Россия Человек IP 33158 1b Россия Человек IP 33156 1b Швейцария Птица IP 32879 1b 25 Италия Заяц IP 32721 2a 10 Бельгия Человек IP 32581 2a 2 Новая Зеландия Человек IP 32589 2a 47 Швейцария Обезьяна IP 33023 2a 32 Испания Человек IP 33054 2a 34 Англия Свинья IP 32670 1b 24 Австралия Сумчатое IP 33038 1b 23 Новая Зеландия Олень IP 32533 1b 60 В2 Франция Человек IP 32777 1b 27 Франция Человек IP 32949 1b Голландия Человек IP 32524 1b 26 Франция Неизвестен IP 32637 1b Франция Человек IP 33285 1b Украина Грызун IP 33161 1b 57 Украина Человек IP 33162 1b 57 Дания Морская свинка IP 30215 2b 20 Франция Заяц IP 32929 2b Франция Заяц IP 32921 2b 45 Швейцария Обезьяна IP 32881 2b 45 Франция Обезьяна IP 32934 2b 44 D1 Франция Заяц IP 33098 2b 44 Германия Обезьяна IP 33061 5a 12 Франция Человек IP 32821 5a 14 Швейцария Морская свинка IP 32463 5a 13 Человек Франция IP 32952 5a 30 Франция Дикое животное IP 32699 5a Голландия Заяц IP 30911 2b 19 Югославия Заяц IP 32651 1b 21 Франция Человек IP 32953 1b 1 Югославия Заяц IP 32665 1a 4 Германия Обезьяна IP 33005 1a 4 Заяц Франция IP 33291 1a 4 Швейцария Человек IP 32590 1a 4 Румыния Почва IP 32939 1a 4 Италия Свинья IP 32790 1a 4 D2 Италия Человек IP 32745 1a 4 Югославия Заяц IP 32614 1a 4 Тунис Грызун IP 31878 1a 4 Италия Голубь IP 30284 1a 4 Норвегия Вода IP 32323 2 4 Англия Птица IP 32709 1b 17 Канада Бобр IP 30437 1b 61 Швеция Выдра IP 30151 4 42 b Рисунок Дендрограмма штаммов 1.13. IS1541-RFLP-профилей Y..pseudotuberculosis (n=80), выделенных в различных странах мира. а, b – наиболее распространенные гибридизационные фрагменты, присутствующие у и 55 % профилей, соответственно.

характеризующиеся индивидуальными с наибольшим IS1541-профилями количеством рестрикционных фрагментов (20, 24, 33) (см. Рисунок 1.13). Штаммы кластера С, выделенные, в основном, от сельскохозяйственных животных, циркулирующие на разных континентах, имеют восемь IS1541-профилей по сравнению с одним риботипом (18) и одним IS285-профилем 22. Штаммы кластера D, выделенные, главным образом, от диких животных и из окружающей среды в европейских странах, а также Тунисе (два штамма) и Канаде (один штамм) (см. Рисунок 1.4), распределяются по разным кластерам: часть входит в кластер в котором доминантным является 4, D2, IS1541-профиль характеризующийся двумя фрагментами рестрикции, другая часть штаммов имеет в геноме большее количество копий IS1541 (8-12) и входит в подкластер d2.

В целом, в трех случаях один и тот же IS1541-профиль выявляется у штаммов, различающихся происхождением (4, 5, 57) или регионом выделения (4, 5, 38), но из 58 профилей каждый характеризует штаммы, выделенные от одного источника (например, от диких животных) или в одном регионе (см. Таблица 1.8, 1.9). Таким образом, при IS1541-RFLP-типировании происходит дифференциация кластеризованных штаммов отдельных на большее EcoRV-рибопрофилей количество IS1541-профилей - это отностится к 10 из 11 не индивидуальных EcoRV-профилей. Наибольшее число IS1541-профилей соответствует штаммам EcoRV-рибопрофилей 4 и 9, которые подразделяются на 15 и 9 IS1541-типов, соответственно. Другие восемь EcoRV-рибопрофилей подразделены на 2- IS1541-профилей.

Соответственно, есть корреляция между некоторыми IS1541-типами и риботипами, например, IS-типам 26, 27 соответствует риботип 11;

IS-типам 5, 38 риботп 18 и т.д. (см. Приложение А). Поэтому также можно предположить, что при определенном расположении рРНК оперонов, характризующем данный риботип, в различных участках хромосомы, возможно, включая непосредственно фланкирующие 3’-конец рРНК локуса, наблюдаются стабильные транспозиции IS1541 при отсутствии мутаций в EcoRV-сайтах рестрикции.

в) Сочетание IS285- и IS1541- RFLP-профилей (2IS-RFLP).

Дендрограмма, полученная при комбинировании двух IS-профилей, показывает, что штаммы, циркулирующие в различных регионах мира, характеризуются высокой гетерогенностью: у 80 штаммов выявлено 73 2IS-RFLP типа. При этом один 2IS-RFLP-тип характеризует не более двух штаммов.

Определено семь таких пар штаммов. Большинство 2IS-RFLP-типов (n=66) индивидуальны (Рисунок 1.14). В результате дискриминирующая сила 2IS-RFLP метода (D = 0, 99), была наибольшей, по сравнению с методами IS285-, IS1541 RFLP и риботипирования, для которых D составил, соответственно, 0,94;

0,98 и 0,94.

Сравнительный анализ дендрограмм IS-RFLP-типирования показал, что выраженная внутрикластерная дифференциация штаммов при IS1541-RFLP типировании приводит к разделению кластеризованных штаммов IS285-типов 1, 22, 30, которые формируют ветви В1, С и основную ветвь кластера D1, входящие в состав одного крупного кластера (показаны рамкой на Рисунке 1.11), на индивидуальные 2IS-типы (показаны рамкой на Рисунке 1.14) Эффективность метода 2IS-RFLP выше, чем IS1541-RFLP, так как он полностью дифференцирует 11 штаммов 1а серотипа, имеющих доминантный IS1541-профиль 4, на индивидуальные 2IS-типы. В таблице 1.7 представлены выявленные 2IS-RFLP-типы, относящиеся к различным серотипам Важно отметить, что на 2IS-RFLP дендрограмме Y..pseudotuberculosis.

большинство подветвей сгруппированы в соответствии с определенными серотипами. Исключение составляют штаммы серотипов 1b, 5b, находящиеся в разных кластерах.



Pages:     | 1 || 3 | 4 |   ...   | 5 |
 





 
© 2013 www.libed.ru - «Бесплатная библиотека научно-практических конференций»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.