авторефераты диссертаций БЕСПЛАТНАЯ БИБЛИОТЕКА РОССИИ

КОНФЕРЕНЦИИ, КНИГИ, ПОСОБИЯ, НАУЧНЫЕ ИЗДАНИЯ

<< ГЛАВНАЯ
АГРОИНЖЕНЕРИЯ
АСТРОНОМИЯ
БЕЗОПАСНОСТЬ
БИОЛОГИЯ
ЗЕМЛЯ
ИНФОРМАТИКА
ИСКУССТВОВЕДЕНИЕ
ИСТОРИЯ
КУЛЬТУРОЛОГИЯ
МАШИНОСТРОЕНИЕ
МЕДИЦИНА
МЕТАЛЛУРГИЯ
МЕХАНИКА
ПЕДАГОГИКА
ПОЛИТИКА
ПРИБОРОСТРОЕНИЕ
ПРОДОВОЛЬСТВИЕ
ПСИХОЛОГИЯ
РАДИОТЕХНИКА
СЕЛЬСКОЕ ХОЗЯЙСТВО
СОЦИОЛОГИЯ
СТРОИТЕЛЬСТВО
ТЕХНИЧЕСКИЕ НАУКИ
ТРАНСПОРТ
ФАРМАЦЕВТИКА
ФИЗИКА
ФИЗИОЛОГИЯ
ФИЛОЛОГИЯ
ФИЛОСОФИЯ
ХИМИЯ
ЭКОНОМИКА
ЭЛЕКТРОТЕХНИКА
ЭНЕРГЕТИКА
ЮРИСПРУДЕНЦИЯ
ЯЗЫКОЗНАНИЕ
РАЗНОЕ
КОНТАКТЫ


Pages:     | 1 || 3 | 4 |   ...   | 5 |

«mИркутский государственный университет путей сообщения Институт информационных технологий и моделирования ИНФОРМАЦИОННЫЕ ТЕХНОЛОГИИ И ПРОБЛЕМЫ МАТЕМАТИЧЕСКОГО ...»

-- [ Страница 2 ] --

В работах [137] авторы несколько расширяют интерпретацию авто матов Мили применительно к контролю правильности программного обеспечения. Контроль правильности функционирования верхних уровней управления РАУ с использованием программного обеспечения предложен в [113] Контроль операционных (функциональных, логических, арифмети ческих) подсистем АРУ проработан достаточно глубоко, имеются не толь ко обзоры, но и несколько отечественных и зарубежных монографий [39].

Алгоритмическое расширение моделей МПА.

Куртом Гёделем (1931 г.) была показана «неразрешимость некото рых математических задач с помощью некоторого класса алгоритмов, оп ределяемых некоторой формальной конкретизацией понятия алгоритма». В настоящее время предложено несколько эквивалентных понятий алгоритма (К. Гёдель, А. Чёрч, А. Тьюринг, А. Марков). Тезис Тьюринга-Черча отра жает уверенность в том, что формальные модели алгоритма (в частности, машина Тьюринга) достаточно полно отражают интуитивное понимание алгоритма.

Ю.Г. Карпов [41] считает, что «формальная модель вычислителя яв ляется результатом простого добавления потенциально большой памяти к конечному автомату». Покажем, что это не так.

Известны две основные структурные модели: модель «черного ящи ка» и двухблоковая (взаимодействующие операционный ОА и управляю щий УА автомат) модель В.М. Глушкова [22]. Интерпретация этой модели дана самим Глушковым В.М. и другими авторами [92]. Модель широко применяется при анализе и синтезе РАУ, при этом, как правило, ОУ изна чально задан, известен или спроектирован по какой-либо методике.

В работе [66] впервые показана недостаточность модели В.М. Глуш кова для описания обобщенного устройства преобразователя информации, в частности, вычислителя аналого-цифрового типа, т.к. модель должна быть общей и не зависеть от типа носителя информации. Дальнейшее раз витие идеи [61;

105] привело к появлению пятикомпонентной структурной модели в виде полного графа с пятью вершинами (Ф – функциональной, И – информационной, А – адресной, Л – логической и У – управляющей) В работе [92] определены свойства модели и доказана ее адекватность отра жения объективной реальности пяти информационных «потоков» в любой вычислительной или управляющей системе. В работах [114;

115] показано, что машина Тьюринга имеет все подсистемы Ф, И, А, Л, У. Вот почему это не только конечный автомат плюс бесконечная память. Современные «электронные диски» в виде ФЛЕШ памяти для практических применений являются достаточными. Но, добавляя к ней только конечный автомат (УА) получим всего лишь структурную (или функциональную, в зависи мости от уровня детализации) реализацию модели В.М. Глушкова, но не модели Ю.Ф. Мухопада. Общность модели подтверждают не только выде ленные автором свойства модели, но и многочисленные примеры анализа (конечные автоматы [92], ПЗУ с ультрафиолетовым и электрическим сти ранием информации [118], адаптивный дискретный фильтр [90], МПС пер вичной обработки навигационной информации [123], устройство выделе ния центра изображения на фотоматрице [72] и др.).

В работах [121] показаны модификации модели и ее иерархическое расширение для более сложных вычислительных систем. Примеров анали за и практического проектирования РАУ на базе модели достаточно: уст ройство вычисления функций [119], дискретная корелляцонная экстре мальная система [110], гибридные схемы [104;

171]. Необходима дальней шая разработка методики структурного синтеза по модели Ю.Ф. Мухопада более сложных систем взаимодействующих автоматов и вычислительных комплексов.

Следует отметить, что выход на вычислительные системы и ком плексы – это переход на более высокий уровень – т.е. переход к анализу сложных больших вычислительных и управляющих систем [17;

46;

129;

138]. Для сложных систем сохраняется метод подобия (аналогия - фрак тальность в смысле Мандельброта), т.е. могут быть выделены многочис ленные иерархические цепочки (Ф, И, А, Л, У).

Важным результатом является организация параллельной работы вычислителя при специальной процедуре организации вычислительного процесса [18;

161]. Cинтез блока управления алгоритма с параллельными ветвями можно представить, как синтез ведущего автомата, управляющего локальными автоматами, соответствующих параллельным ветвям [92]. Од нако распараллеливание в вычислительных системах и сетях эффективно осуществляется с помощью так называемых семафоров, конвееризации и др. [46] Тем не менее полный алгоритм вычислительного процесса [132] формируется на базе теории частично-упорядоченных систем В.А. Горба това [24], предложенной в 1976 г. Организация параллельных вычислений требует более сложных аппаратно-программных средств [21;

46;

129;

161].

Вопросы обеспечения надежности таких систем решается за счет встроенных комбинационных схем [21;

46;

61;

159] и автоматов.

Модель Ю.Ф. Мухопада действительно применима к анализу и син тезу МПС, но требуется ее информационное расширения для сложных сис тем.

В принципе, нет ограничений для применимости модели и для про стых устройств, относящихся к классу элементов. Однако целесообраз ность такого анализа простейших элементов вряд ли оправдана. Действи тельно, анализ функциональной схемы синхронного RS триггера позволяет выделить логическое устройство (вход синхронизации со схемами «И»), запоминающее (две схемы ИЛИ-НЕ), адресное – обратные связи и функ циональные элементы, которые совмещены с информационными. Однако такой анализ не дает конструктивного направления к синтезу, т.к. он дол жен производиться на электронном уровне и выполнен многими автора ми[42;

175;

143].

Анализ поведения сложных систем на определенном уровне детали зации успешно осуществляется с помощью сетей Петри [135]. Применение сетей Петри с разрешающими и запрещающими дугамиэффективно для анализа протоколов взаимодействия верхних уровней управления вычис лительных систем[101;

157]. В работах [92;

112] показано, что сеть Петри с запрещающими и разрешающими дугами эквивалентна двум взаимодейст вующим конечным автоматам. В работе [73] предложено оценивать слож ность протоколов взаимодействия вычислительных средств через число состояний двух взаимодействующих автоматов. Интерес к сетям Петри с разрешающими и запрещающими дугами возобновился в связи с развити ем параллельных вычислительных систем. В работе [164] такая модифика ция сети названа joinez-сетью. В работах [51;

130] приведены практические примеры применения.

Анализ и синтез аналого-цифровых систем.

На сегодня чисто аналоговые системы существуют разве лишь на уровне усилителей, генераторов и некоторых простых элементов. Но как только они становятся составной частью каких-либо систем или комплек сов появляются элементы автоматического управления для программного выбора частот, регулирования амплитуды, фазы и др. Объединение анало говых вычислителей и аппаратно-программных средств управления рас смотрено в [144;

158].

Аналого-цифровые преобразователи и аналоговые устройства ус ложняются за счет включения в них цифровых управляемых сопротивле ний, логических переключателей режимов, управляемых коммутаторов [57;

68;

71] и др. В работе [50] показано, что аналого-цифровые импульс но-временные преобразователи по своей структурной организации соот ветствуют многофункциональной модели автора. Вопросам организации и управления аналого-цифровых сред посвящены работы [103;

104], в кото рых впервые показана возможность решения полного набора задач теории графов на базе специализированных аналого-цифровых моделей [171] с микропрограммной реализацией управления.

С другой стороны сложные динамические структуры стали описы вать системой в виде так называемых «гибридных автоматов» [43;

168]с выделением глобальных состояний, в которых система находится длитель ное время, а поведение ее в этот период описывается дифференциальными уравнениями. Выделяются «простые» состояния предшествующие опера торам разветвления.

Впервые системы подобного типа исследовались в работах [131;

170] с более явным их отображением в виде автоматной модели.

Авторам работы [43] не потребовалось описание сетями Петри, т.к.

они используют типовые подпрограммы анализа процессов в глобальных состояниях и переходы от состояния к состоянию с ветвлением процесса (логические операторы распознаватели).

Если не рассматривать процессы внутри глобальных состояний, та кие сложные системы можно представить в виде конечного автомата без внешней синхронизации[18;

130;

161;

168]. «Плавающий» цикл синхропе реходов определяется достижением процессом определенной «отметки» из некоторого «поля» состояний процесса и формированием значения логиче ского уровня.

Теория таких «гибридных автоматов» находится в стадии становле ния.

Использование аналоговых принципов позволяет на другой основе построить элементы цифровой техники [42;

148;

150;

172] в частности по И2Л технологии, что открывает дополнительную возможность оптимиза ции логических преобразователей информации.

Перспективным направлением применения в аналого-цифровых РАУ является идея так называемых ассоциативных автоматов [102], требующая как практического, так и теоретического развития.

Интеллектуальное расширение РАУ.

Простейшим элементом интеллектуальных систем является ассоциа тивная память (АЗУ). В работах [40;

69] показана возможность реализации МПА на этом принципе с использованием как АЗУ, так и ПЗУ. Однако та кие МПА не имеют преимуществ перед традиционными аппаратными реа лизациями, в структурах не основанных на командном управлении.

Один из вариантов цифровых автоматов являются нейронные уст ройства и сети [12;

37]. Типовая задача двухуровневой классификации (выбора президента по анализу предыдущих выборов) решается с помо щью двухслойной нейроструктуры с предварительным обучением [175]. В работе [97] предложена структура так называемой комбинаторно нейронной среды, в которой первый слой есть реализация не полностью определенных булевых функций, а второй «слой», всего лишь два порого вых элемента.

В работе [50] показано, что нейросетевые преобразователи импульс но-аналоговой информации описываются моделью конечного автомата. Т.е отдельные устройства систем с искусственным интеллектом, действитель но можно описать и синтезировать методами теории автоматов.

В работах С. Кауфмана [146] сделана попытка представления про цессов генетической регуляторной системы живых клеток в виде автомат ной NK модели, состоящей из N логических элементов с K входами и од ним выходом каждый и цепями обратной связи без внешних входов. Авто мат функционирует в дискретном времени и каждое состояние, характери зуется совокупностью выходных сигналов всех элементов.

Тем не менее направление, связанное с так называемым интеллекту альным управлением (оптимальные системы, системы с искусственным зрением и искусственным интеллектом) требуют независимого подхода к анализу и синтезу так же как и большие сложные системы управления [128].

В этом кратком обзоре кроме основной литературы для оценки со стояния РАУ, автор использовал достаточно много собственных публика ций в связи с тем, что многие из них являются принципиально новыми для инженерной практики и прикладной науки (структурная модель, метод де композиции автоматов на уровне ГСА, метод синтеза сложных автоматов, ассоциативные автоматы, самоконтроль автоматов, комбинаторно нейронные сети, таблично-алгоритмические модели вычисления функции одной и нескольких переменных, принципы объемного конструирования пневмоструктур и др.).

В связи с недооценкой важности и значимости научных исследова ний многие конструктивные научно-инженерные решения не находят практического применения. Поэтому даже краткий обзор будет способст вовать как внедрению «ноу-хау», так и развитию прикладной теории. Тем более что из-за трудности публикации материалов в центральной печати большинство идей научной школы автора изложено в малоизвестных для научной общественности трудах Сибирских Вузов. Автор считает, что найдутся исследователи которые смогут подвергнуть серьезной критике изложенные идеи и методы и, тем самым, натолкнуть на дополнительные исследования в другом ракурсе. Но основная надежда на соратников, ко торым предстоит развивать обозначенные направления.

Заключение В статье приведен аналитический обзор основных публикаций по вопросам развития аппаратных средств автоматизации на базе дискретных устройств. Большинству работ сопоставлены работы автора, имеющие оригинальный характер (изобретения) или значительный научный резуль тат с целью привлечь внимание как инженеров-проектировщиков, так и исследователей-прикладников.

Литература 1. Автоматизированное проектирование цифровых устройств/ ред. С.С. Бадулин М.:

Радио и связь, 1981. – 238 с.

2. Амосов В.В. Схемотехника и средства проектирования цифровых устройств. СПб:

БХВ – Петербург, 2007. – 542 с.

3. Артюхов В.Л., Копейкин Г.А., Шалыто А.А Настраиваемые модули для управ ляющих логических устройств. Л.: Энергоатомиздат, 1981, - 165 с.

4. Ачасова С.М., Алгоритмы синтеза автоматов на ПЛМ. М.: Сов. радио, 1987. – с.

5. Бадмаева Т.С, Проектирование системы управления коммутацией сигналов в АСУ ТП// Информ. системы контроля и управл. на транспорте. Иркутск: ИрГУПС, 2004. вып. 11. – с. 127-136.

6. Базилевский Ю.Я. Вопросы теории матем. машин. М,: Физматлит, вып. 1, 2, 1962.

7. Байков В.Д., Смолов В.Б. Специализированные процессоры. М.: Радио и связь, 1985. – 288 с.

8. Балакин В.Н., Барашенков В.В. Проектирование самопроверяемых управляющих устройств по тестопригодным схемам алгоритмов.// Автоматика и телемеханика, 1988, №11. – с. 161-168.

9. Баранов С.И., Наумов В.В. Минимизация конечных автоматов (аналитический об зор). Многофункциональные регулярные вычислительные структуры. Л.: ЛГУ, 1978, вып. 7, с. 70-81.

10. Баранов С.И., Синев. В.Н., Янцен Н.Я. Синтез автоматов на элементах с матрич ной структурой.// Проектирование функционально-ориентированных вычисли тельных систем. Л.: ЛГУ, 1990. – с. 90-108.

11. Баранов С.И., Скляров В.А. Цифровые устройства на программируемых БИС с матричной структурой. М.: Радио и связь, 1986. – 270 с.

12. Барский А.Б. Логические нейронные сети. М.: Бином, 2007. – 351 с.

13. Бибило П.Н, Синтез логических схем на VHDL. М.: СОЛОН – Р. – 2002.

14. Болдырев В.Г., Чебоксарова Т.Н.. Об использовании четверичных кодов для авто матизации синтеза комбинационных схем. Л.: Известия ЛЭТИ, 1977, выпю 217, с. 87-92.

15. Брауэр В. Введение в теорию конечных автоматов М.: Радио и связь, 1987. – 392 с.

16. Вавилов Е.Н., Портной Г.П. Синтез схем ЭВМ. М.: Сов. Радио, 1963.

17. Вальков В.М. Микроэлектронные управляющие вычислительные комплексы.

(системное проектирование и конструирование) Л.: Машиностроение, 1990. – с.

18. Варшавский В.И., Кишиневский М.А., Мараховский В.Б. Автоматное управление асинхронными процессами в ЭВМ и дискретных системах. М.: Наука, 1986. – с.

19. Васькин П.И., А.Ф. Губкин, А.В. Плотников и др. Автоматизация проектирования средств ВТ. Л.: ЛЭТИ, 1979. – 94 с.

20. Вильвер П.Ю. Метод диагностирования отказов сложных техн. систем с ипольз.

сетей Петри./ Информационные и матем. технологии в науке, технике и образова нии. Тр. Х Байкальской Всерос. Конф. ч. I, Иркутск, ИСЭ СОРАН, 2005. – с. 329 333.

21. Водяхо А.И., Емелин В.П., Липецкая Н.Д. и др. Интеллектуальный сервис для вы числительных систем с нетрадиционными архитектурами: Ярославль, 1990. – 43 с.

/Научный центр ИПВТ АН СССР препринт 13/.

22. Глушков В.М. Автоматно-алгебраические аспекты оптимизации МПА// Тр. межд.

матем. конгресса, М.: 1968. с. 53-55.

23. Глушков В.М. Синтез цифровых автоматов М.: ФМиздат, 1962. – 476 с.

24. Горбатов А.В. Фундаментальные основы дискретной математики. М.: Наука – Физматлит, 2000, - 544 с.

25. Горбатов А.В. Характеризационная теория синтеза функциональных декомпози ций в К-значных логиках. М.: Физматлитература, 2000, - 336 с.

26. Горбатов А.В., Смирнов М.И., Хлытчиев И.С. Логическое управление распреде ленными системами. М.: Энергоатомиздат, 1991. – 288 с.

27. Горохов В., Сидоренко А. Нанотехнаука./ Высшее образование России, № 10, 2008, с 130-143.

28. Горшков В.Н. Надежность ОЗУ ЭВМ. Л.: Машиностроение, 1990. – 234 с.

29. Горяшко А.П. Синтез диагностируемых систем вычислительных устройств. М.:

Наука, -287 с.

30. Григорян А.К. Метод декомпозиции конечных автоматов.// Автоматика и телеме ханика. – 1968. - №10.

31. Гурвиц Е.А. Синтез полисинхронных и дискретных устройств. М.: Связь, 1969 – 172 с.

32. Дмитриев Ю.К. Самодиагностика систем из однотипных блоков.// Вопросы тео рии вычислительных систем. Новосибирск. СОАН СССР, 1978. – с. 107 – 121.

33. Жиратков В.И. Отказоустойчивые вычислительные системы// Микропроцессор ные системы контроля и управления. Новосибирск. РНТО Приборостроителей, НЭТИ, 1992. с. 9-13.

34. Жофрен И. Кодирование внутренних состояний и декомпозиция последовательно стных синхронных устройств./ булева алгебра и конечные автоматы, М.: Мир, 1969, с.114 – 152.

35. Журавлев Ю.П. Геллер С.И. Основы логического проектирования ЦВМ. М.: Ра диосвязь. – 1969. – 271 с.).

36. Закревский А.Д. Анализ и синтез каскадных схем. М.: Наука, 1981. – 386 с.

37. Закревский А.Д. Логика распознавания. М.: УРСС. 2003. – 64 с.

38. Информационные системы. Табличная обработка информации/ ред. Е.П. Балашов, В.Б. Смолов. Л.: Энергоатомиздат 1985. – 39. Иыуду К.А. Надежность, контроль и диагностика вычислительных машин и сис тем. М.: Высшая школа, 1984. – 214 с.

40. Казак А.Ф., Кокаев О.Г., Петров Г.А. Микропрограммные системы ЭВМ. Л.: ЛЭ ТИ, 1981. – 100 с.

41. Карпов Ю.Г. Теория автоматов, СПб.: Питер, 2003. – 208 с.

42. Кметь А.Б. Четырехзначная логика. М.: Радио и связь, 1991. – 97 с.

43. Колесов Ю.Б., Сениченков Ю.Б. Моделирование систем. Диагностические и гиб ридные системы. СПб: БХВ – Петербург, 2006. - 220 с.

44. Кондратьев В.В., Махалин Б.Н. Автоматизация контроля цифровых функциональ ных модулей. М.: Радио и связь, 1990. – 156 с.

45. Конопелько В.К., Лосев В.В. Надежное хранение информации в ЗУ. М.: Радио и связь, 1986. – 237 с.

46. Корнеев В.В. Параллельные вычислительные системы. М.: Нолидж, 1999. – 311 с.

47. Кузнецов А.П. О программной реализации логических функций и автоматов. Ав томатика и телемеханика. 1977. - №4.

48. Лазарев В.Г., Пийль Е.И., Турута Е.Н. Построение программируемых управляю щих устройств. М.: Энергоатомиздат, 1984. – 193 с.

49. Литиков И.П. Кольцевое тестирование цифровых устройств. М: Энергоатомиздат, 1990. – 156 с.

50. Локтюхин В.Н., С.В. Челебаев. Нейросетевые преобразователи импульсно аналоговой информации. М.: Гл-Телеком, 2008. – 144 с.

51. Лялин А.С. Возможности асинхронного взаимодействия процессов при проекти ровании цифровой аппаратуры./ Информационные и матем. технологии в науке, технике и образовании. Тр. Х Байкальской Всерос. Конф. ч. I, Иркутск, ИСЭ СО РАН, 2005. – с. 249-252.

52. Марюхненко В.С., Мухопад Ю.Ф. Алгоритмизация первичной обработки радио сигналов// Системный анализ в проектировании и управлении: Тр. Х межд. конф.

Ч.З. СПб: Политехн. ун-т, 2006., с. 98-101.

53. Мачикенас Э.К. Применение спектральных методов для проектирования логиче ских схем в базисе программируемых логических структур./ Архитектура и про ектирование вычислительных систем. Рига, Рижский полит. ин-т., 1985, с. 119 – 130.

54. Мелихов С.В., Ненахов А.В., Колесов И.А. и др. Микропроцессорные аналого цифровые устройства СВЧ на основе матричного кристалла// Тр. Научн-техню конфю – Томская ТУСУР, 200, с. 70-74.

55. Методы построения безопасных микроэлектронных систем ж.д. автоматики/ ред.

Вл.В. Сапожников. М.: Транспорт, 1995. - 273 с.

56. Микропроцессорные средства производственных систем/ ред. Колосов В.Г. Л..:

Машиностроение, 1988. – 247 с.

57. Молодкин В.А., Мухопад Ю.Ф. Однородная среда на матрицах двухноминальных резисторов// Информ. системы контроля и управления на трансп. 2000, вып. № 8, с.83-86 Мордасов Д.М., Мордасов М.М., Трофимов А.В. Пневматические элемен ты и узлы в устройствах контроля. Тамбов, Тамб. ГТУ, 2001, 88 с.

58. Мухопад А.Ю. Структурная организация автоматов с контролем. Новосибирск:

Научн. вестн. НГТУ №4(33), 2008. – с. 52-56.

59. Мухопад А.Ю., Мухопад Ю.Ф. Микропрограммный автомат. Пол. реш. на патент.

пол. модель №2008 149344/22 (064785) 15.12.2008.

60. Мухопад А.Ю., Мухопад Ю.Ф., Антошкин Б.Н. Устройство криптографической защиты информации. Пол. реш. полезн. модель №2008150879/22 (066842) от 22.12.2008;

№ 2008149331/22 (064772) от 15.12.2008.

61. Мухопад Ю.Ф. Formal transformation on the system model. Компьютерная алгебра.

Труды Международного конгресса. 1993. Nova Science Publisheers, Inc, New York.

62. Мухопад Ю.Ф. Анализ и синтез информационно-управляющих систем.// Информ.

технологии и проблемы мат. моделир. глобальных систем. Иркутск, ИрГУПС, 2007, вып 5, с 33-46.

63. Мухопад Ю.Ф. Многофункциональное запоминающее устройство. Сб. Транс портные проблемы Сибирского региона. Иркутск, 1999. – С. 124-130.

64. Мухопад Ю.Ф. Накопитель для радиочастотного ПЗУ.// Информ. технол. контроля и управл. трансп. системами. Иркутск: ИрИИТ, 2000, вып. 6 с 129-135. А.С.

1410101 СССР, 1988 БИ № 26.

65. Мухопад Ю.Ф. Теория дискретных устройств. Иркутск ИрГУПС, 2009 – 162 с.

66. Мухопад Ю.Ф., Анализ и синтез структурных схем вычислителей по автоматным моделям. Труды конгресса IFАС Рига, 1974. Т. 5. Сб. Дискретные системы. С. 195 203.

67. Мухопад Ю.Ф., Антошкин Б.Н. Применение RISC-контролеров в устройствах дистанционного управления. Информационные системы контроля и управления в промышленности и на транспорте: устройства систем контроля и диагностики. – Иркутск: ИрГУПС. – 2005. – Вып. 12. – C. 3-6.

68. Мухопад Ю.Ф., Антошкин С.Б. Двухступенчатый АЦП с коррекцией погрешно стей. Патент РФ на полезную модель № 44436, 2005.

69. Мухопад Ю.Ф., Бабкин П.А. Синтез МПА с ассоциативной памятью..// сб Микро процессорные системы контроля и управления. тр. Сибирск. научно-технич. кон фер. Новосибирск, НЭТИ, Томск ТИАСУР. – 1992, - с. 90-99.

70. Мухопад Ю.Ф., Бадмаева Т.С. Синтез автоматов управления по декомпозирован ной схеме алгоритма. Сб. Информационные системы контроля и управления на транспорте – Иркутск: ИрИИТ, 2002. – С. 14-25.

71. Мухопад Ю.Ф., Бадмаева Т.С. Устройство для программного управления с приме нением коммутаторов. А.с. 1087996. БИ, 15, 1984.

72. Мухопад Ю.Ф., Бадмаева Т.С., Кругликов С.В. Устройство для определения коор динат центра изображения. А.с. 991452. БИ, 3, 1983.

73. Мухопад Ю.Ф., Бадмаева Т.С., Солдатенков Е.Г. Выбор алгоритмов управления для анализа протоколов информационно-управляющих систем. Сб. Информаци онные системы контроля и управления на транспорте – Иркутск: ИрГУПС, 2002. – Вып. 9. – С. 132-137.

74. Мухопад Ю.Ф., Березков Л.О., Скосырский Г.С. Микропроцессорные системы контроля ПЗУ. Иркутск: ИГУ, 1984. – 114 с.

75. Мухопад Ю.Ф., Бовкун А.Ф. Перепрограммируемые матрицы для пневматических систем программного управления. Автоматизированные системы контроля и упр.

на трансп. Вып. 4. – Иркутск: ИрИИТ, 1998. – С. 122-125.

76. Мухопад Ю.Ф., Бовкун А.Ф. Программируемые матрицы для пневматических систем управления дискретного действия. Микропроцессорные системы контроля и управления: материалы Сиб. науч.-техн. конф. 10-11 сент. 1992 г. – Новоси бирск, 1992. – С. 186-188.

77. Мухопад Ю.Ф., Буинов А.И. Устройство поиска неисправных блоков и элементов.

А.с.1309042. БИ, 1987. № 17.

78. Мухопад Ю.Ф., Буинов А.Н. Устройства поиска неисправных блоков и элементов.

А.с. 1309042. БИ, № 17, 1987.

79. Мухопад Ю.Ф., Буинов А.Н., Ламбаева И.А., Скибинский В.Л. Устройство поиска неисправных блоков и элементов. А.с. №1709351 СССР БИ №4.

80. Мухопад Ю.Ф., Гардер В.М. Таблично-алгоритмические функциональные преоб разователи. Сб. Автоматика и вычислительная техника, Рига, 1977. № 5.

81. Мухопад Ю.Ф., Гардер В.М. Устройство для вычисления функции. А.с. 696472.

БИ, 41, 1979.

82. Мухопад Ю.Ф., Гардер В.М. Цифровое устройство воспроизведения функций. А.с.

579622. БИ, 1979.

83. Мухопад Ю.Ф., Григоров В.А. Концепция построения квазисогласованного опти ческого фильтра волоконно-оптических систем передачи информации. Люминес центия и лазерная физика: X Междунар. школа-семинар (Россия, Иркутск, 2-6 окт.

2006 г.): Рос. Акад. Наук, Сиб. отд-ние, Ин-т лазерной физики - Иркутск: Изд-во ИГУ, 2007. – С. 89-97.

84. Мухопад Ю.Ф., Индосов В.Н. Иерархическое резвирование микропроцессорных систем.// Методы и средства автоматиз., сбора и обработки эксперим данных. – Новосибирск: НЭТИ, 1984. – с. 54-57.

85. Мухопад Ю.Ф., Комков А.З. Программная матрица для пневматических систем управления дискретного действия. Патент РФ № 62717. Апрель 2007 г.

86. Мухопад Ю.Ф., Комков А.З., Пашков Н.Н. Программно-перестраиваемый пневма тический оптимизатор. Пат. РФ полезн. модель №70380 БИ №2, 2008.

87. Мухопад Ю.Ф., Комков А.З., Пашков Н.Н. Системные графовые модели управ ляемых пневмоструктур. Транспорт Урала, Екатеринбург: УрГУПС 2007. №4 (15) с. 95-100.

88. Мухопад Ю.Ф., Кругликов С.В., Наймарк С.М. Интегральные МДП структуры и их применение. М.: ЦНИИ Электроника, 1981.

89. Мухопад Ю.Ф., Кругликов С.В., Смолов В.Б. Микрооптоволоконные преобразо ватели информации на основе фотодиодной матрицы. Электронное моделирова ние, 1982. № 3.

90. Мухопад Ю.Ф., Кучина Е.М. Адаптивный аналого-цифровой фильтр. А.с. 714408.

БИ, 5,1980.

91. Мухопад Ю.Ф., Лукашенко В.М. Функциональные преобразователи с ограничен ным числом хранимых констант. Сб. Управляющие системы и машины, 1978.

№ 5.

92. Мухопад Ю.Ф., Микроэлектронные информационно-управляющие системы. Ир кутск: ИрГУПС. 2004. – 404 с.

93. Мухопад Ю.Ф., Молодкин В.А. О выборе формы носителя информации радиочас тотных и квазиоптических вычислителей. Тр. учеб. ин-тов связи, вып. 72, Л. 94. Мухопад Ю.Ф., Молодкин В.А., Пуртов А.В. Аналого-цифровой преобразователь.

А.с. 571896. БИ, 16, 1977.

95. Мухопад Ю.Ф., Молодкин В.А., Смолов В.Б. Дискретно-управляемые элементы комбинированных вычислителей СВЧ диапазона. Изв. ЛЭТИ, 1974. Вып. 96. Мухопад Ю.Ф., Молодкин В.А., Федченко А.И., Марусин В.В. Автоматическая оптимизация энергетических характеристик мостовых СВЧ-плазмотронов. Изв.

СО АН СССР, 1975. Вып 3. № 13. Секц. техн. Наук.

97. Мухопад Ю.Ф., Мухопад А.Ю. Комбинаторно-нейронные сети. Сб. Информаци онные технологии контроля и управления на транспорте. Иркутск: ИрИИТ, 2000.

Вып. 8.

98. Мухопад Ю.Ф., Мухопад А.Ю. Методика синтеза сложных автоматов. Новоси бирск: Научн. вестник НГТУ, вып. 1 (34), 2009. – с. 219-222.

99. Мухопад Ю.Ф., Мухопад А.Ю. Структурная организация управляющих уст ройств. Проблемы механики современных машин. Улан-Удэ, ВСГТУ, т. II, с.

259-262.

100.Мухопад Ю.Ф., Мухопад А.Ю., Бадмаева Т.С. Встроенный контроль в автоматах управления. Вестник Иркутского государственного технического университета. – Иркутск: ИрГТУ. – 2006. - № 2. – C. 148-149.

100. Мухопад Ю.Ф., Мухопад А.Ю., Бадмаева Т.С. Самоконтролируемый автомат. Па тент РФ №63588 БИ №15, 2007.

101. Мухопад Ю.Ф., Никулин В.Г. Моделирование процессов обработки информации в системах реального времени./ Матеем. и информ. технологии в энергетике, эко номике, экологии. Тр. Всероссийской конф. Иркутск, 2003, Иркутск СЭИ, 140 146.

102. Мухопад Ю.Ф., Пашков Н.Н., Пунсык-Намжилов Д.Ц. Ассоциативный автомат децентрализованного адаптивного управления системой автономных вычисли тельных процессов// Научный вестник НГТУ, Новосибирск, 2008 № 4 (33). с. 61 64.

103. Мухопад Ю.Ф., Попков В.К. Специализированные вычислительные среды. Улан Удэ: Бурятск. издат., 1982. – 183 с.

104. Мухопад Ю.Ф., Попков В.К., Чимитов Д.Н. Гибридная вычислительная среда для решения экстремальных задач на графах. Сб. Методы и программы решения оп тимизационных задач на графах и сетях, Новосибирск, СО АН СССР, 1982. Ч. 1.

105. Мухопад Ю.Ф., Проектирование специализированных микропроцессорных вы числителей. Новосибирск: Наука, 1981.

106. Мухопад Ю.Ф., Пуртов А.В. Аналого-цифровой преобразователь. А.с. 1322477.

БИ, 25, 1987.

107. Мухопад Ю.Ф., Пуртов А.В. Быстродействующий фазовый компоратор СВЧ диа пазона. Приборы и техника эксперимент, 1978. № 1.

108. Мухопад Ю.Ф., Пуртов А.В. Использование принципов и элементов СВЧ техники для построения быстродействующих АЦП. Автометрия, 1978. 11.

109. Мухопад Ю.Ф., Рудковский В.П. Многоразрядный вертикальный сумматор. Ло кальные вычислительные сети и распределенная обработка данных. Новосибирск НЭТИ, 1991, с. 55-62.

110. Мухопад Ю.Ф., Рудковский В.П. Устройство для вычисления координат изобра жения. А.с. 1468255. 1988.

111. Мухопад Ю.Ф., Сажин Б. Мостовые вычислители и управляющие устройства. Ир кутск, ИГУ, 1984, - 180 с.

112. Мухопад Ю.Ф., Сербуленко Л.М. Автоматная интерпритация устройств контроля МПС.// сб Микропроцессорные системы контроля и управления. тр. Сибирск. на учно-технич. конфер. Новосибирск, НЭТИ, Томск ТИАСУР. – 1992, - с. 41-49.

113. Мухопад Ю.Ф., Сербуленко Л.М. Устройство контроля микропроцессорной сис темы. Положит. решен. ВНИИ1ПЭ № 94033171/033292, сентябрь 1994.

114. Мухопад Ю.Ф., Системная модель микропроцессорных устройств. Локальные вы числительные сети и распределенная обработка данных. Новосибирск, НЭТИ, 1991. с. 63-71.

115. Мухопад Ю.Ф., Системный анализ Машины Тьюринга. Сб. Микропроцессорные системы, Новосибирск: НЭТИ, 1990.

116. Мухопад Ю.Ф., Скосырский Г.С. Устройство функционального контроля блоков памяти. А.с. №1547034 СССР, БИ №8, 1990.

117. Мухопад Ю.Ф., Скосырский Г.С., Репин В.М. и др. Формирователь временных последовательностей. А.с. № 991587 СССР БИ №3, 1983.

118. Мухопад Ю.Ф., Скосырский Г.С., Чекмарев Ю.Д. Системный анализ постоянных запоминающих устройств. Сб. Микропроцессорные системы контроля и управле ния технологическими процессами, Улан-Удэ, 1989.

119. Мухопад Ю.Ф., Смолов В.Б. Вычислительное устройство с перестраиваемой структурой. А.с. 524187. БИ, 29, 1977.

120. Мухопад Ю.Ф., Смолов В.Б., Чекмарев Ю.Д. Использование системы геометриче ских кодов в ПЗУ. Изв. вызов СССР: Приборостроение, 1971. Т. 14, № 121. Мухопад Ю.Ф., Солдатенков Е.Г. Структурные модели сложных информационно управляющих систем// сб Информ. системы контроля и управления на транспорте.

– Иркутск, ИрИИТ, 2002, - с. 8-15.

122. Мухопад Ю.Ф., Структурное проектирование специализированных микроэлек тронных вычислителей. Аналит. обзор. М.: ЦНИИ Электроника, 1979. – 54 с..

123. Мухопад Ю.Ф., Цифровая фильтрация нестационарых сигналов. Информацион ные системы контроля и управления на транспорте. Иркутск: ИрГУПС. – 2004. – Вып. 11. – C. 152-156.

124. Мухопад Ю.Ф., Чекмарев Ю.Д. Конструктивная структура ПЗУ с геометрическим представлением информации// Информ. системы контроля и управл. на транспор те. Иркутск: ИрГУПС, 2004. вып. 11. – с. 127-136.

125. Мухопад Ю.Ф., Чекмарев Ю.Д. Постоянное запоминающее устройство. А.с.

1410101. Би, 26, 1988.

126. Мухопад Ю.Ф., Чимитов Д.Н., Попков В.К. Устройство нахождения экстремаль ных путей на графах. А.с. 1134944. БИ, 2, 1985.

127. Нарышкин. Цифровые устройства и микропроцессоры. М.: Академа, 2006. – 318 с.

128. Нейронные сети. С. Хайкин М.: СПб.: Киек «Вильямс», 2006, 1104 с.

129. Никищенков С.А. Функциональная диагностика реконфигуируемых транспортных технологических систем по информационно-логическим схемам процессов. Сама ра: СНЦ РАН, СамГАПС, 2005. – 159 с.

130. Новиков К.В. Joines сети для моделирования взаимодействующих процессов./ Информационные и матем. технологии в науке, технике и образовании. Тр. Х Байкальской Всерос. Конф. ч. I, Иркутск, ИСЭ СОРАН, 2005. – с. 243-249.

131. Новорусский В.В. Основы теории систем и системы логического управления. Но восибирск: Наука, 1997. – 335 с.

132. Панфилов И.В., Половко А.М. Вычислительные системы. М.: Сов. радио, 1980. – 304 с.

133. Пархоменко П.П., Согомонян Е.С. Основы технической диагностики. М.: Энерго атомиздат, 1981. – 319 с.

134. Пирогов А.И. Шамаев Ю.М. Магнитные сердечники в автоматике и вычислитель ной технике. М.: Энергия, 1967.

135. Питерсон Дж. Теория сетей Петри и моделирования систем. М.: Мир, 1984. – с. М.: Сов. радио, 1987. – 320 с.

136. Плотников А.В., Баркатов А.А. Стародубцев К.Е. Микропрограммное устройство управления.// УСиМ, 1987. - №4. с. 38-41.

137. Поликарпова Н., Шалыто А.А. Автоматное программирование. СПб: «Питер», 2009. – 176 с.

138. Поспелов Д.А. Логико-лингвистические модели в системах управления. М.: Энер гоатомиздат, 1981. – 242 с.

139. Потемкин И.С. Функциональные узлы цифровой автоматики. М.: Энергоатомиз дат, 1988, - 320 с.

140. Прищепа Л.С., Илюшкин В.А. Устройство для контроля дешифраторов.// Интел лектуальные системы в управлении, конструировании и образовании. Томск:

ТГУСУР, 2002. – с. 160-163.

141. Пунсык Намжилов Д.Ц., Мухопад Ю.Ф. Интегральные модули развертывающего преобразователя. Улан-Удэ: ВСТИ, 1992. – 48 с.

142. Пупырев Е.И. Перестраиваемые автоматы и МПС. М.: Наука, 1984. – 191 с.

143. Пухальский Г.И., Новосельцева Т.Я. Цифровые устройства. СПб.: Политехника, 1996. – 885 с.

144. Пухов Г.Е., Евдокимов В.Ф., Синьков М.В. Разрядно-аналогвые вычислительные системы. М.: Наука, 1978. – 255 с..

145. Рассохин Г.И. Метод синтеза логических схем на элементах запрета со многими выходами. М.: ВЦ АНСССР, 1965. – 28 с.

146. Редько В.Г. Эволюционная кибернетика. М.: Наука, 2003. – 156 с.

147. Рогозов Ю.Н., Чернов Н.И. Оптимизация логического базиса для синтеза цифро вых И2Л схем. Микроэлектроника, том 16, вып 4, 1987, с. 352-356.

148. Рудковский В.П., Мухопад Ю.Ф. Оптимизация математического базиса управ ляющих систем дискретной автоматики./ Автоматизированные системы контроля и управления на транспорте. Иркутск, ИрИИТ, 1999 вып. 5, с. 129 – 136.

149. Рудковский В.П., Мухопад Ю.Ф. Синтез управляющих устройств в арифметико логическом базисе./ Информационные технологии контроля и управления на транспорте. Иркутск: ИрИИТ, 2000, вып. 8 с. 84-87.

150. Рудковский В.П.м Синтез функциональных преобразователей информации в арифметико-логическом базисе./ Микропроцессорные системы контроля и управ ления Новосиьирск, НЭТИ, 1992. – с. 17-30.

151. Рыцар Б.Е., Кметь А.Б. Новый метод кодирования подфункций в задачах синтеза цифровых устройств на ПЛМ. Кибернетика и системный анализ. 2003. - №2. – с.

63-89.

152. С. Колдуэлл Логический синтез релейных устройств. М.: Иностр. литература, 1962, 737 (англ. изд. Wiley, NY, 1958).

153. Савельев А.Г. Минимизация числа внутренних состояний МПА, выполненного с использованием ПЗУ. Сб. Автоматы и управление. М.: Наука, Инс-т проблем пе редачи инф. АН СССР, 1973, с 15-26.

154. Сагалович Ю.А. Кодирование состояний автоматов. М.: Связь, 1975. – 208 с.

155. Сапожников В.В., Сапожников Вл.В. Методы синтеза надежных автоматов. Л.:

Энергия, 1980. – 93 с.

156. Свечников С.В., Конопелько В.П,, Тимченко Л.И. Квазиимпульсные потенциаль ные оптоэлектронные элементы и устройства логико-временного типа. Киев: Нау кова думка. 1987 – 254 с.

157. Сербуленко Л.М., Системный анализ микропроцессорных устройств./ Микропро цессорные системы контроля и управления. Тр. Сибирской научн.-техн. конф. Но восибирск, НЭТИ, 1992, с 31-41.

158. Смагин А.А. Организация сжатия информации в табличных структурах. Саратов:

Сар. Ун-т, 1985. – 124 с.

159. Согомонян Е.С., Слабаков Е.В. Самопроверяемые устройства и отказоустойчивые системы. М.: Радио и связь, 1989. – 208 с.

160. Соловьев В.В., Климович А. Логическое проектирование цифровых систем на ос нове ПЛИС. М.: Горячая линия – Телеком, 2008, - 374 с.

161. Стародубцев Н.А. Синтез схем управления параллельных вычислительных сис тем. Л.: Наука, 1984. – 320 с.

162. Стерлинг Д.Дж. Техническое руководство по волоконной оптике. М.: Лори, 1988.

– 288 с.

163. Стешенко В.Б. ПЛИС фирмы Altera: проектирование устройств обработки сигна лов. М.: Додэка, 2000. – 124 с.

164. Столяров Л.Н., Новик К.В. Joines – сеть для моделирования взаимодействующих параллельных процессов./ Моделирование процессов управления. С.б. ст. Мос ковск. физ. техн. институт. – М.:, 2004, - с. 81-97.

165. Суржик В.В., Мухопад Ю.Ф. Самостабилизирующийся экраноплан. Пол. реш. пат.

РФ № 2007 111299/11 (0122,72) от 27.03.2007 г.

166. Тоценко В.Г, Алгоритмы технического диагностирования дискретных устройств.

М.: Радио и связь, 1985. – 238 с.

167. Уилмсхерст Т. Разработка встроенных систем с помощью микроконтроллеров PIC. М.: «МК-Пресс», 2008. – 543 с.

168. Ульянов С.А. Автоматизация процедуры качественного анализа свойств автомат ной модели./ Информационные и матем. технологии в науке, технике и образова нии. Тр. Х Байкальской Всерос. Конф. ч. I, Иркутск, ИСЭ СОРАН, 2005. – с. 317 323.

169. Харазов К.И. Устройства автоматики с магнитоуправляемыми контактами. М.:

Энергоатомиздат, 1990, - 256 с.

170. Харлан С.Н. Моделирование работы устройств автоматики средствами теории ав томатов// сб. Белоруск. Гос. ун-та, Гомель, 1995. с. 102-133.

171. Чимитов Д.Н., Мухопад Ю.Ф., Попков В.К. Устройство для определения крат чайшего пути на графах. А.С. №11334944 СССР, БИ №2, 1985.

172. Шагурин Н.И., Петросян К.О. Проектирование цифровых схем на элементах ин жекционной логики М.: Радио и связь, 1984.

173. Шалыто А.А. Логическое управление. Методы аппаратной и программной реали зации алгоритмов. СПб.: Наука, 2000.

174. Шимбирев П.Н. Гибридные непрерывно-логические устройства М.: Энергоатом издат, 1990. – 173 с.

175. Шишкин Г.И. Обеспечение помехоустойчивости цифровых систем. Саров.: ФГУП «РФЯЦ-ВНИИЭФ, 2004,ч1. – 435 с.

176. Щербаков Н.С. Достоверность работы цифровых устройств М.: Машиностроение, 1989. – 224 с.

177. Юдитский С.А., Магергут В.З.Логическое управление дискретными процессами.

М.: Машиностроение, 1987. – 175 с.

178. Якубайтис Э.А. Логические автоматы и микромодули. – Рига: Зинатне, 1975. – с.

Ключевые слова: автомат, микро программа, булева функция, коди рование, управление, модель, системы.

Key words: automatic machines, microprogramm, boolean function, cod ing, control, model, systems.

Аннотация.

Приведен обзор основных научных работ в области инженерных ме тодов проектирования и теории дискретных устройств и систем.

УДК 519.6: Начигин В.А., Эльхутов С.Н.

СРАВНИТЕЛЬНЫЙ АНАЛИЗ ПРОГРАММНЫХ СРЕДСТВ ДЛЯ МОНИТОРИНГА ТЕХНИЧЕСКИХ СИСТЕМ Специализированное программное обеспечение Существующее в настоящее время программное обеспечение (ПО) решает задачи мониторинга, прогнозирования и диагностирования техни ческого состояния систем. Во многих случаях компоненты прогноза и ди агностики поставляются отдельно от основного программного продукта, поэтому решающего только задачи сбора, хранения измерений, а также мониторинга по собранным измерениям. На российском рынке специали зированного программного обеспечения присутствуют такие изготовители как «ВАСТ», «ДИАМЕХ», «ИНКОТЕС», «ПромДиа» и др.

Функциональные возможности существующего ПО можно рассмот реть на примере программы «Диамант-2», которая может использоваться совместно с анализаторами вибрации «ТОПАЗ», «КВАРЦ», «АГАТ».

Система предусматривает использование в качестве коллекторов дан ных анализаторы вибрации производства фирмы «ДИАМЕХ».

В составе ПО ДИАМАНТ-2 предусмотрен дополнительный модуль авто матической диагностики «ДИАМАНТ-ЭКСПЕРТ», позволяющий прово дить диагностирование дефектов узлов агрегатов в автоматическом режи ме в различных объемах: по всей БД, по конкретным типам агрегатов (мо делям), по конкретным узлам или по конкретным дефектам узлов.

Ниже приведен пример окна программы при анализе трендов (рис. 1):

Рис. 1. Анализ трендов При анализе данных характеристик ПО «ДИАМАНТ-2» позволяет вы водить зависимости скалярных данных: общего уровня для данных, обще го уровня или стандартных/частотных спектров, значений пик-фактора и СКЗ для данных пик-фактора, значений эксцессов ВЧ и НЧ для данных эксцесса или амплитуды и фазы для данных амплитуды/фазы или гармо нических спектров. Возможны зависимости от времени (для временной ха рактеристики) или от частоты вращения (для разгона/выбега), а также за висимость частоты вращения от времени (для данных разгона/выбега) и каскады спектров (для данных спектров).

Модуль экспертной системы диагностики ДИАМАНТ-ЭКСПЕРТ ДИАМАНТ-ЭКСПЕРТ обеспечивает автоматический анализ вероят ности возникновения того или иного дефекта в работе оборудования.

Помимо традиционных методов анализа и сравнения данных замеров об щего уровня, различных спектров, пик-фактора, эксцесса, формы сигнала для принятия решения в программе могут быть использованы данные спе циальных обследований (спектры собственных частот, замеры разго на/выбега, анализ вибраций приходящих извне, контурные характеристики и т.д.).

Основой экспертной системы являются узлы агрегатов. Узлы создаются для моделей агрегатов и при создании агрегатов структуры, приписанных к модели, автоматически переносятся в агрегат, где их описания могут быть дополнены и отредактированы. Также узлы могут быть созданы непосред ственно в агрегате структуры. Всего для одной модели или агрегата можно описать до 255 узлов.

Каталог узлов может формироваться пользователем отдельно (рис. 2). По мере наработки каталога узлов со всеми необходимыми описаниями и ди агностическими правилами, этот каталог в виде отдельной базы данных поставляется в составе экспертной системы.

Рис. 2. Каталог узлов Для проведения диагностирования автоматически экспертная система отыскивает требуемые данные для расчета критериев диагностирования, уточняет формулы их расчета с учетом записанных значений частот вра щения, рассчитывает значения критериев с учетом интегрирования / диф ференцирования данных и представления единиц и проверяет правила ди агностирования. Если для дефекта узла описано несколько правил диагно стирования, рассчитывается их суммарная вероятность.

После проведения диагностирования узлов агрегата в отдельном окне выводится протокол диагностирования, в котором выведена информация о возможности/невозможности анализа различных правил, об обнаруженных дефектах и рассчитанной вероятности их наличия. В соответствии с задан ными для дефектов уровнями предупредительной и аварийной сигнализа ции,сообщения о дефектах раскрашиваются в заданные цвета светофора сигнализации.

В составе экспертной системы ДИАМАНТ-ЭКСПЕРТ поставляется каталог подшипников качения со всеми необходимыми геометрическими размерами (средний диаметр, диаметр тел качения, их количество и угол контакта) и формулами для возможности расчета характерных частот не исправностей (дефектов наружного и внутреннего колец, сепаратора и тел качения). В каталог включены опорные и опорно-упорные шариковые и роликовые подшипники отечественного производства.

Специализированные системы мониторинга Мониторинг системы «колесо-рельс»

В Ростовском государственном университете путей сообщения разра ботана методика управления жизненным циклом системы «колесо-рельс» с использованием программного комплекса «АНАЛИТИК»: PLM (Product Lifecycle Support Management).

Цель создания методики - разработка системы управления инженер ными данными и жизненным циклом системы колесо-рельс на базе совре менных информационных технологий класса PLM.

Основная задача - создание программного ядра корпоративной систе мы мониторинга, имеющий открытую архитектуру баз данных и интегри рованный в распределенную информационную сеть ОАО "РЖД". Методи ка позволяет обеспечить хранение и управление технической документа цией и информацией о структуре, вариантах системы «колесо-рельс», ин теграции компонентов системы в различные подсистемы.

На этапе эксплуатации программа обеспечивает накопление данных о результатах эксплуатации колесных пар и рельсов, обмен информацией между соответствующими службами. Программа рассчитана на управле ние данными и организации взаимодействия между отделами внутри предприятия (ТЧ, ПЧ) и между службами управления железной дороги, для обеспечения устойчивого взаимодействия в системе "колесо- рельс".

Один из внедренных на СКЖД модулей программного комплекса «АНАЛИТИК» является «Электронная версия ТО-3 для локомотивных де по и служб локомотивного хозяйства», которая позволяет автоматически генерировать отчеты, прогнозировать пробег до следующей обточки ко лесных пар, выдавать задание на обточку. Дополнительный модуль про граммы позволяет проводить расчёты фактически получаемых величин снижения затрат на топливо (электроэнергию) при проведении работ по лубрикации колес и рельсов в зависимости от фактического объема пере возок и результатов текущей работы рельсосмазывающих систем.

Вибродиагностический комплекс «СМ-3001 - АРМИД»

Данный комплекс предназначен для диагностики технического со стояния колесно-редукторных блоков (КРБ) электропоездов переменного и постоянного тока на базе 3-х канального сборщика-анализатора вибросиг налов СМ-3001 и программного обеспечения «АРМИД».

Вибродиагностический комплекс предназначен для проведения без разборной диагностики колесно-редукторных блоков электропоездов пе ременного и постоянного тока.

Перечень диагностируемых узлов КРБ:

• зубчатое зацепление;

узел вала малой шестерни;

• опорный подшипник (опорный стакан) тягового редуктора;

• подвеска редуктора;

• резино-кордовая муфта;

• моторно-якорный подшипник.

• Бортовая система измерения нагрузки на колесо/бокового давления Система разработана компанией «ПромДиа» для анализа безопасности движения скоростного поезда путем автоматического измерения нагрузки на колесо и бокового давления на поезд. Это особенно важно при испыта ниях сверхскоростных пассажирских экспрессов и существующих поездов.

Нагрузка на колесо и боковое давление определяются в виде электронных сигналов с помощью тензодатчиков, подключенных к плоскому или спи цевому колесу, и усиливаются динамическим тензоусилителем. Усиленные сигналы передаются на ПК по высокоскоростному АЦП, а затем анализи руются на ПК. Тензодатчики можно подключить двумя способами:

• временное подключение;

• непрерывное подключение.

Система анализа выполняет расчет коэффициента крушения поезда в режиме реального времени и записывает результаты на жесткий диск, то гда как выводит их с помощью внешнего самописца (рис. 3). Для записи форм волны в режиме реального времени можно подключить дополни тельно 2 записывающих устройства.

Рис. 3. Блок-схема анализа давления колеса/бокового давления Комплексные системы мониторинга и диагностики Разработана и сейчас находится в стадии практической апробации и реализации на объектах техносферы АО «Российские Железные дороги»

технология глобальной космической и локальной воздушной диагностики и мониторинга железнодорожных тоннелей, рельсовых путей, земляного полотна и железнодорожных мостовых сооружений.

Технология включает в себя:

глобальную космическую диагностику железнодорожных объектов и • их ближайшего и дальнего окружения;

• локальную воздушную диагностику железнодорожных объектов, их участков, узлов, элементов и непосредственного окружения.

Глобальная космическая диагностика железнодорожных объектов и их ближайшего и дальнего окружения проводится с помощью многозональ ных, гиперспектральных оптических, а также инфракрасных и радарных спутниковых систем. Она позволяет решать следующие задачи:

• трассодиагностика железнодорожного пути, выявление прилегаю щих к нему объектов техносферы, их характерных элементов и бли жайшего окружения;

• анализ рельефа местности трассы железнодорожного пути;

• анализ влажности грунтов и оценка динамики подтопления иссле дуемой трассы железнодорожного пути;

• выявление потенциально опасных участков железнодорожного пути и его окружения;

• определение зон повышенных тектонических нагрузок.

УДК 004. Е.В.Овдиенко СОГЛАСОВАНИЕ ЗКСПЕРТНЫХ ПРОГНОЗОВ ИЗМЕНЕНИЯ ОБЪЕМОВ ГРУЗОПЕРЕВОЗОК НА ВСЖД В информационной системе анализа грузоперевозок на ВСЖД была поставлена цель добиться макроанализа данных, чтобы, имея базу данных по перевозкам более чем за 10 лет, реализовать задачу прогнозирования их объемов, которая бы была полезна и могла бы помочь в принятии некото рых управленческих решений.

Для того, чтобы выдвинуть прогноз на будущее как, например, изме нится объем грузоперевозок для некоторого рода груза, самое простое бы ло применить экстраполяционный подход к выбранным по запросу дан ным, описывающим состояние грузоперевозок на протяжении нескольких лет. Для составления такого прогноза достаточно оценить прошлые пока затели объемов грузоперевозок, а затем перенести эти тенденции в буду щее, т.е. прогноз окажется простой проекцией (экстраполяцией) прошлого в будущее. Но это справедливо было бы для случая, когда развитие проис ходит гладко и непрерывно.


В условиях нынешнего финансового кризиса, когда происходят кар динальные и непредвиденные изменения, эффективность применения ста тистических методов для прогнозирования и планирования, особенно на длительный период, падает. В таких условиях особую роль в предвидении будущего приобретает интуиция или особые знания специалистов, назы ваемых экспертами. Так, для задачи прогнозирования скачкообразных процессов на железной дороге, в большей мере соответствуют экспертные методы.

Эксперты могут также выступать в качестве арбитров по оценке имеющихся данных, но в этом случае существует опасность, что лица при нимающие решения станут чрезмерно полагаться на статистические мето ды и на полученные на их основе результаты, и поэтому, могут не заметить существенных изменений, значение которых мог бы оценить другой спе циалист. Эксперты могут участвовать в опросе как генераторы, источники идей и предложений, т.е. выдвигать гипотезу развития событий, тогда сис тема должна объективно обработать поступающие данные. Результаты оп роса групп экспертов существенно отличаются от решений, формируемых в результате дискуссий на заседаниях комиссий, где может возобладать мнение авторитетных или всего лишь «напористых» участников. Это не означает, что индивидуальное мнение конкретного специалиста или реше ние такой комиссии не значимо. На рисунке 1 представлена классификация методов прогнозирования [1]. Как уже было сказано, коллективные экс пертные методы прогнозирования имеют большой недостаток - это влия ние коллективного мнения на прогноз эксперта. Поэтому от коллективного метода решено было отказаться в пользу индивидуального, что не отменя ет анализ результата системой и усреднение мнений экспертов внутри со гласованной группы. Можно было бы подумать, что выбран метод прогно зирования - «интервью», но поскольку анализ мнений экспертов системой все-таки присутствует, то в соответствии со схемой на рисунке 1, метод прогнозирования определен как «аналитические экспертные оценки».

Рис. 1. Классификация методов прогнозирования Требования к экспертам.

Количество членов экспертной группы значительно меньше в сравне нии с количеством респондентов, опрашиваемых при массовом опросе.

«Идеальный» эксперт должен обладать перечнем качеств, такими как:

1. креативность, то есть способность творчески решать задачи, метод решения которых полностью или частично не известен 2. эвристичность, то есть способность видеть 3. интуиция — способность делать заключения об исследуемом объек те без осознания пути движения мысли к этому заключению 4. предикаторность, то есть способность предсказывать, предчувство вать будущее состояние исследуемого объекта 5. независимость, то есть способность противопоставлять предубежде ниям и массовому мнению свою точку зрения 6. всесторонность, то есть способность видеть проблему с различных точек зрения.

Отбор экспертов, формирование экспертных групп — достаточно сложная задача, результат которой в наибольшей степени определяет эф фективность метода и правильность полученных решений, поэтому пред полагается опрашивать в качестве экспертов начальников отделов или их заместителей, непосредственно занимающихся планированием перевозок или отчетностью, т.е. начальников таких отделов как плановый, развития, финансовый и службы ДМ. Оценив число возможных кандидатов в экс перты, решается вопрос о численности экспертной группы. Оптимальное количество вряд ли возможно определить точно, но очевидно, что в малой группе экспертов на итоговую оценку оказывает излишнее влияние оценка каждого из экспертов [2]. Слишком большое число экспертов затрудняет формирование согласованного мнения. Кроме того, при увеличении числа участников уменьшается роль нестандартных мнений, отличающихся от мнения большинства, но не всегда оказывающихся неправильными. В идеале принципиальное значение имеет возможность обеспечения «равно правия» специалистов различных направлений, различного уровня компе тентности, но т.к. любой эксперт не застрахован от ошибки, планируется анализировать правильность его ответов на прошедшем периоде. Таким образом, планируется опрашивать экспертов, проводя интервью и задавая вопросы о ситуации в прошлом и будущем. Ранжирование - это процедура установления относительной значимости, важности ответов экспертов на основе их упорядочения, а ранг - показатель, характеризующий порядко вое место эксперта, оцениваемого по результатам правильности его отве тов на прошедшем периоде или при заведомо известных условиях [3]. Так, основываясь на правильности ответов эксперта на прошлом периоде вре мени, присваивается ему коэффициент достоверности, который ранжирует достоверность его прогнозов на будущее перед другими экспертами, уча ствующими в опросе. Считается, что наиболее надежные результаты полу чаются, когда количество экспертов для сравнения не превосходит 20 [4].

Математические методы анализа экспертных оценок.

Применение методов математической обработки экспертных оценок означает проверку согласованности мнений экспертов и усреднение мне ний экспертов внутри согласованной группы, или классификацию экспер тов, если нет согласованности.

Прогноз делается на один шаг по времени и описывается формулой (1):

Х (t)= a * t +b, (1) где t – переменная времени, b – известное значение, которое можно получить из БД, хотя эксперту его не обязательно показывать в целях проверки адекватности его прогноза.

Так, b – величина, положение на настоящий момент времени, т.к. X (t 0 ) = b.

– экспертные оценки, a [конечное _ множество ] a На рисунке 2 показана схема возможных положений прогнозов, где X (t 0 ) = b – это положение в настоящий момент времени, а – коэффициент, определяющий изменение прогноза X (t k ).

Рис. 2. Схематическое представление прогнозов экспертов в системе координат х и t При проведении опроса необходимо учитывать, что не всякий эксперт мыслит количественными категориями и в состоянии сказать, во сколько раз или на сколько единиц изменится, например, объем перевозок по дан ному грузу или в определенном направлении. Поэтому получаемые от экс пертов мнения должны быть выражены в порядковой шкале, т.е. надо пре дусмотреть при опросе в вариантах возможных ответов, указание диапазо на, или приблизительных ответов, типа «существенно не изменится», «не значительно возрастет», «возрастет», «значительно увеличится».

При опросе будем спрашивать у экспертов прогноз и о прошедшем периоде X (t 1 ), чтобы исключить прогнозы экспертов, которые не владеют информацией даже за прошлый период, и рассматривать в дальнейшем прогнозы только тех экспертов, которые правильно оценили тенденцию за прошедший период. Для таких экспертов проведем ранжирование – на сколько прогноз был ближе к действительному, настолько больше при сваивается коэффициент ранжирования wk.

Возможно предположить, что мнения какой-то части экспертов ока жутся согласованными, как например случай ответов первого X (t i ) и вто рого X (t i ) экспертов на рисунке 3, для чего условно примем, что если угол расхождения их прогнозов 15о, то ответы считаются согласованны ми.

Рис. 3. Согласованные и несогласованные прогнозы экспертов Для согласованных прогнозов производится процедура вычисления среднего взвешенного, высчитываемая по формуле (2):

n a k wk a1 w1 + a 2 w2 +... + a n wn a= = k = n n w w i i, (2) k =1 k = где n – количество учтенных экспертов.

n w = i Также по умолчанию считается, что, т.е. сумма весов должна k = равна быть единице.

В случае, если мнения экспертов оказались несогласованными, как на рисунке 3 между первым X (t i ) и третьим X (t i ) экспертами с углом 1 15о, то паре «крайних» экспертов предлагается дать обоснование своего решения - не больше нескольких предложений. Эти объяснения каждого сообщаются оппонентам анонимно и без указания прогноза, для того что бы эксперты, выдвинувшие самые резкие прогнозы, задумались и, или объяснили свой прогноз и не изменили своего решения, или изменили свой прогноз.

Так, после того как с учетом аргументации оппонента эксперт выразит готовность изменить свой прогноз, сблизив его с оценкой оппонента, вполне может быть, что в пару «экстремальных» экспертов войдет уже другой эксперт, у которого угол расхождения оценки будет 15о. Тогда им снова будет предложена процедура согласования прогнозов. Так будет по вторяться столько раз, пока все оценки экспертов не войдут в заданный диапазон 15о, или пока оба эксперта откажутся менять свои прогнозы. То гда по формуле (2) над оценками экспертов производится процедура вы числения среднего взвешенного. Алгоритм такой схемы представлен на рисунке 4, где P – это пороговая величина соответствующая на графике уг лу = 15о Рис. 4. Алгоритм обработки экспертных оценок Схема согласования, занимающая лишнее время у экспертов, предло жена для того, чтобы эксперты могли не только принимать решения на ос нове известной им информации, но и обмениваться знаниями с другими экспертами, таким образом, более полно представляя перспективы разви тия событий. Тогда прогноз в свою очередь, становился бы более досто верным, т.к. даже самые различные математические методы осреднения экспертных оценок, с ранжированием и без него, не могут быть более дос товерным, когда прогноз выдвигается на основе знаний человека, зачастую более интуитивных, чем логических [5].

Литература 1.Орлов А.И. Теория принятия решений. - М.: Изд-во "Март", 2004. – 761 с.

2.Т. Саати, К.Кернс Аналитическое планирование. Организация систем:

-М.: Ра дио и связь, 1991. – 224 с.

3.Горский В.Г., Гриценко А.А., Орлов А.И., Метод согласования кластеризован ных ранжировок // Автоматика и телемеханика. 2000. №3. С.159-167.


4.http://ru.wikipedia.org/ 5.Федосеев В.Н., Орлов А.И., Ларионов В.Г., Козьяков А.Ф. Управление промыш ленной и экологической безопасностью: Учебное пособие. - М.: УРАО, 2002. – 220 с.

УДК 004. А.Ю. Ткаченко ПРОГРАММА ПОИСКА ТОЧНО СОВПАДАЮЩИХ И ВЫСОКО ПОДОБНЫХ УЧАСТКОВ ГЕНОМОВ “DNA Analyzer” Введение Программное обеспечение предназначено для поиска наибольшей об щей подпоследовательности двух геномов (т.е. участков геномов, наиболее схожих между собой), с учетом их модификаций, произошедших вследст вие мутаций в ходе эволюции.

Генная и молекулярная биология на данный момент являются бурно развивающимися областями современной науки, где информационные технологи выступают адекватным инструментом исследования, что приве ло к возникновению нового термина “вычислительная биология” [1].

Наследственная информация всех живых организмов закодирована в молекулах дезоксирибонуклеиновой кислоты (ДНК). Молекулу ДНК мож но рассматривать как длинную строку символов четырехбуквенного алфа вита (A, T, G, C), по первым буквам названий нуклеотидов. Полный набор наследственной информации называется геномом организма, а ген – это конкретный участок генома, отвечающий за синтез определенного белка и соответственно за определенный набор внешних признаков (например, цвет глаз). Для биологов важно иметь средство, инструмент для анализа и исследования расшифрованных геномов и вновь изучаемых организмов на основе сопоставления их геномов. Это позволяет выявлять свойства вновь изучаемых организмов на основе сопоставления их геномов с уже изучен ными ранее. Кроме того, для задач генной инженерии важно не только об наруживать высокоподобные участки геномов, но и указывать конкретные редакционные преобразования, превращающие кусок одного генома в ана логичный участок другого. На основе этого можно выявлять или париро вать мутации, вызвавшие наследственные изменения.

Алгоритм работы программы Для решения названных задач была разработана программная система DNA Analyzer. Программа выявляет прежде всего участки генома, обла дающие симметрией двойственности типа (А – Т), (С – G) (рис. 1). Эти участки используются в качестве граничных для сопоставляемых генов.

Рис. 1. Симметрично - комплементарные свойства генома 1) Из обоих геномов находятся все подпоследовательности, которые удовлетворяют симметрично-комплиментарным свойствам (рис. 2);

ATTACGTAAT Рис. 2) После этого в геномах находятся гены (закодированные участки ин формации какого-либо органа живого организма или его характери стики);

ATTACGTAATGCTGATCCTAGG Ген 3) Производится отбор наиболее подходящих генов с учетом введенной степени подобия. Данное действие в целях экономии времени разде лено на два этапа:

• Если длина i-го гена из 1-го генома, или j-го гена из 2-го генома меньше указанной минимальной длины, то этот ген пропускает ся, и не участвует в следующих этапах обработки;

• Сопоставляются два гена из двух геномов, и если отношение длины гена меньшей длины к большей длине будет меньше ука занной степени подобия, то эти гены также исключаются из дальнейшей обработки;

, где L1 - длина меньшего гена, L2 - длина большего гена, P - степень подобия генов в процентах (задается пользователем).

• Если предыдущие два условия выполняются, то ищется редакци онное расстояние для этих двух генов;

ATTACGTAATGCTGATCCTAGG ATTATAATGCTTGAGCCTAGG Алгоритм поиска редакционного расстояния (расстояния Левенштейна) В качестве меры подобия используется редакционное расстояние Левен штейна. Базовым алгоритмом для отбора высокоподобных участков гено мов служит алгоритм вычисления редакционного расстояния методом ди намического программирования (рис. 2). Применением обратного хода по построенной методом динамического программирования таблице восста навливается редакционное предписание, преобразующее один из выявлен ных высокоподобных участков в другой. При этом степень подобия явля ется параметром программы и может задаваться пользователем.

Поиск высокоподобных участков геномов осуществляется следующим об разом:

1) Составляется матрица размером (M+1)(N+1), где M и N – длины первого и второго гена.

2) Нулевые элементы заполняются числами от 0 до M и от 0 до N.

3) i, j – ый элементы таблицы заполняются следующим образом: берет ся минимальный элемент из сопряженных ([i-1, j], [i, j-1], [i-1, j-1]) ячеек таблицы, причем если S1[i] S2[j], то значение элемента таблицы [i-1, j-1] учитывается увели ченным на единицу.

4) После построения таблицы осуществляем обратный ход из ячейки [m,n] к ячейке [0, 0].

Переход осуществляем в сторону сопряженной ячейки с наименьшим зна чением, причем, если таких ячеек будет две или три, то можно двигаться в любую сторону.

5) По действиям обратного хода составляем редакционное предписа ние:

• Если на i-ом шаге двигаемся вверх, то в строку S1 на i-ое место необходимо вставить символ S2[j];

• Если на i-ом шаге двигаемся влево, то из строки S1 необходимо удалить i – ый символ;

• Если на i-ом шаге двигаемся по диагонали и S1[i] = S2[j], то в строке S1 необходимо оставить i-ый символ на своем месте.

• Если на i-ом шаге двигаемся по диагонали и S1[i] S2[j], то в строке S1 необходимо заменить i-ый символ на j-ый символ из гена S2.

Рис.2. Алгоритм вычисления редакционного расстояния методом динамического программирования Вывод результатов После обработки геномов пользователю выдаются полные списки всех найденных “шпилек” и генов (рис. 3), а также карты обоих геномов (рис.

4), в которых отображены места расположения “шпилек” и генов относи тельно самого генома (зеленый цвет – расположение “шпильки”/гена).

При щелчке по зеленой области программа выдает сопоставление этой об ласти соответствующей области из другого генома, а при двойном щелчке – открывается выбранная область в списке генов (рис. 3).

Рис.3. Список найденных генов Рис. 4. Карта геномов Тестовые расчеты В качестве тестовых примеров были использованы локусы расшифрован ных геномов живых организмов, представленные на открытом доступе в сети Интернет [2]. Для исходных данных длиной порядка 200 тыс. букв выявляется порядка ста совпадающих на 98% участков длиной до несколь ких сотен букв каждый. Весь процесс поиска занимает не более пяти ми нут. Пользователю предъявляется список всех выявленных подобных уча стков с указанием их положения в геноме, длины и степени подобия в про центах. При выделении из названного списка конкретного элемента осу ществляется и показывается выравнивание подобных участков с демонст рацией преобразующих редакционных операций.

Литература 1. Дэн Гасфилд. Строки, деревья и последовательности в алгоритмах. Информа тика и вычислительная биология / Пер. с англ. И.В.Романовского. – СПб: Невский диалект. 2003. – 654с. (Dan Gasfield. Algorithm on string, trees, and sequences. Com puter science and computational biology. Cambridge University Press. 1997.).

2. http://www.ncbi.nlm.nih.gov/. Банк геномов.

II. ТЕОРИЯ И ПРАКТИКА МОДЕЛИРОВАНИЯ ТЕХНИЧЕСКИХ И СОЦИ АЛЬНЫХ СИСТЕМ УДК 531. Александров А.Ю, Жабко А.П., Косов А.А.

СТАБИЛИЗАЦИЯ ПОЛОЖЕНИЯ РАВНОВЕСИЯ НЕЛИНЕЙ НОЙ НЕКОНСЕРВАТИВНОЙ МЕХАНИЧЕСКОЙ СИСТЕМЫ С ДВУМЯ СТЕПЕНЯМИ СВОБОДЫ Постановка задачи. Рассмотрим механическую систему с двумя сте пенями свободы && p( x, y ) y = U x, && + p( x, y ) x = U y. (1) x y Здесь x, y - обобщенные координаты, точка над буквой означает производ ную по времени. В левые части уравнений (1) входят обобщенные ускоре ния и отличающиеся знаком слагаемые, называемые неконсервативными позиционными силами [1]. В правые части уравнений входят управляющие силы, которые могут выбираться из некоторых допустимых классов. Ко эффициент при неконсервативных позиционных силах пусть задается функцией p ( x, y ) = 1 + 2 ( x 2 + y 2 ). (2) Нелинейные неконсервативные позиционные силы именно такого вида ис пользуются при моделировании динамики ротора в магнитном подвесе [2].

Желаемому положению оси ротора соответствуют значения координат x = y = 0, задающие положение равновесия системы (1), (2) при отклю ченном управлении. Для обеспечения работоспособности магнитного под веса положение равновесия x = y = 0 должно быть асимптотически ус тойчивым по Ляпунову, т.е. малые начальные отклонения от равновесия должны со временем исчезать. Однако, как следует из результатов В.М.Матросова [3], при отключенном управлении положение равновесия системы (1) неустойчиво при любой функции (2). Поэтому возникает зада ча стабилизации, т.е. такого выбора закона управления, при котором была бы обеспечена асимптотическая устойчивость положения равновесия. При рассмотрении этой задачи следует учитывать, что имеющиеся исполни тельные органы не всегда обеспечивают возможность реализации управ ляющих сил произвольной структуры. Таким образом, возникает необхо димость решения задачи стабилизации за счет сил иной структуры по сравнению с действующими на систему в ее естественном состоянии, по ставленная впервые для линейных систем И.И.Метелицыным [4].

Работа частично выполнена при финансовой поддержке Российского фонда фундаментальных иссле дований (проект № 08-08-92208ГФЕН_а) В данной статье рассматривается такого рода задача для существенно нелинейного случая, когда вопрос об устойчивости не решается на основе уравнений линейного приближения. Здесь мы будем рассматривать ее в наиболее сложных и заведомо критических по Ляпунову случаях, когда 1 = 0, 2 0 и законы управления выбираются в классе нелинейных функ ций. При реализации системы управления на практике конструктору по лезно иметь в распоряжении несколько стабилизирующих обратных свя зей, чтобы выбрать из них наиболее подходящую.

Цель данной статьи – получение нескольких стабилизирующих поло жение равновесия системы (1) законов управления и моделирование дина мики замкнутой системы.

Предлагаются пять различных по характеру ис пользуемой структуры сил законов управления, обеспечивающих стабили зацию положения равновесия нелинейной замкнутой системы. Обоснова ние асимптотической устойчивости проводится на основе развиваемого ав торами подхода [5] в рамках метода декомпозиции. Метод декомпозиции, заключающийся в разделении сложной системы на несколько более про стых подсистем, изучении их по отдельности и обоснованном перенесении полученных результатов на исходную систему широко и эффективно при меняется в теории устойчивости и управления [3, 6, 7]. Основная идея применяемого в данной статье варианта метода декомпозиции заключается в замене исследования устойчивости одной системы дифференциальных уравнений второго порядка исследованием двух изолированных систем первого порядка, которая была первоначально разработана для обоснова ния прецессионной теории гироскопов [8, 9].

Стабилизация нелинейными потенциальными и линейными дис сипативными силами. Асимптотическая устойчивость положения равно x=y=0 будет достигнута, если в (1) положить весия U x = bx a1 x 3, U y = by a 2 y 3, (3) & & где a1, a 2, b - положительные постоянные. Применение такого закона управления требует измерения всех координат и скоростей. Если же изме ряется только одна координата (например, x ), то только ее и оставляем в законе управления, полагая в (3) коэффициент при другой координате рав ным нулю ( a 2 = 0 ). Асимптотическая устойчивость нулевого решения замкнутой системы при этом сохранится. Отметим также, что линейные диссипативные силы (называемые также силами вязкого трения), задавае мые первыми слагаемыми в (3), как правило, присутствуют во всех реаль ных системах, поэтому их может и не потребуется создавать с помощью специальных исполнительных устройств [9]. В таком случае, можно будет обойтись измерением только координат, или даже только одной из них.

Характерная для обратной связи (3) кривая приближения к положению равновесия на плоскости координат ( x, y ) показана на рис. 1. Здесь и далее показаны полученные численным интегрированием решения системы (1) со следующими начальными условиями x(0) = 0.25, x(0) = 0, y (0) = 0.25, & y (0) = 0.

& Рис. 1.

Стабилизация линейными гироскопическими и нелинейными за висящими только от скоростей диссипативными силами. Асимптоти ческая устойчивость положения равновесия x = y = 0 будет достигнута, ес ли в (1) положить U x = g sign( 2 ) y b1 (x 2 + y 2 ) x, U y = g sign( 2 ) x b2 (x 2 + y 2 ) y, m m (4) & & & & & & & & где b1, b2, g, m - положительные постоянные, причем 0 m 1. Для реа лизации управления (4) достаточно иметь лишь измеритель скоростей, ко ординаты могут и не измеряться. Характерная для обратной связи (4) кри вая приближения к положению равновесия на плоскости координат ( x, y ) показана на рис. 2.

Необходимо отметить, что ограничение m 1 на порядок малости дис сипативных сил было получено первоначально в процессе доказательства как одно из достаточных условий, обеспечивающее знакоопределенность производной функции Ляпунова в силу замкнутой системы, т.е. было обу словлено техникой доказательства. Однако это ограничение является принципиальным и не может быть отброшено, поскольку при m = g = 1, b1 = b2 = 2 0 у замкнутой системы имеются точные решения x(t ) = c sin t, y (t ) = c cos t, c = const. Характерная для обратной связи (4) при m = g = 1, b1 = b2 = 2 0 кривая, приближающаяся к круговой орбите одного из точ ных решений, а не к положению равновесия на плоскости координат ( x, y ), показана на рис. 2а.

Рис. 2.

Рис. 2а.

Стабилизация линейными гироскопическими и нелинейными (с зависящими от координат коэффициентами) диссипативными силами.

Асимптотическая устойчивость положения равновесия x = y = 0 будет дос тигнута, если в (1) положить U x = b1 (x 2 + y 2 ) x + g sign( 2 ) y, U y = b2 (x 2 + y 2 ) y g sign( 2 ) x, (5) m m & & & & где b1, b2, g, m - положительные постоянные, причем 0 m 1. Для реа лизации управления (5) вновь необходимо измерять и скорости и коорди наты. Характерная для обратной связи (5) кривая приближения к положе нию равновесия на плоскости координат ( x, y ) показана на рис. 3. Необхо димо отметить, что ограничение m 1 для управления (5) является необхо димым в том же смысле, как и для управления (4). При m = g = 1, b1 = b2 = 2 0 у замкнутой управлением (5) системы имеются точные реше ния x(t ) = c sin t, y (t ) = c cos t, c = const. Характерная для обратной связи (5) при m = 1, b1 = b2 = 2 0 кривая, приближающаяся к круговой орбите одно го из точных решений, а не к положению равновесия на плоскости коорди нат ( x, y ), показана на рис. 3а.

Рис. 3.

Рис. 3а.

Стабилизация линейными диссипативными и нелинейными (с за висящими от координат коэффициентами) гироскопическими силами.

Асимптотическая устойчивость положения равновесия x = y = 0 будет дос тигнута, если в (1) положить U x = b1 x + kp( x, y ) y, U y = b2 y kp( x, y ) x, (6) & & & & где b1, b2, k - положительные постоянные, причем k достаточно боль шая. Здесь также требуется полное измерение координат и скоростей. Ха рактерная для обратной связи (6) кривая приближения к положению рав новесия на плоскости координат ( x, y ) показана на рис. 4.

Рис. 4.

Стабилизация линейными диссипативными и нелинейными по тенциальными и гироскопическими силами. Асимптотическая устойчи вость положения равновесия x = y = 0 будет достигнута, если в (1) поло жить U x = c1 x 3 b1 x + kp( x, y ) y, U y = c 2 y 3 b2 y kp( x, y ) x, (7) & & & & где c1, c 2, b1, b2, k - положительные постоянные, причем k достаточно большая. Принципиальная особенность закона управления (7) по сравне нию с предыдущими (3)-(6) заключается в том, что он обеспечивает асим птотическую устойчивость даже и в том случае, когда в неконсервативных силах присутствуют линейные слагаемые, т.е. в (2) коэффициент 1 0.

Характерная для обратной связи (7) кривая приближения к положению равновесия на плоскости координат ( x, y ) показана на рис. 5.

Рис. 5.

Заключение. Следует отметить, что для линейных чисто неконсерва тивных систем необходимые условия стабилизации до асимптотической устойчивости линейными силами иной структуры найдены И.И.Метелицыным и Д.Р.Меркиным [4, 9, 10] и заключаются в требовании одновременного присоединения диссипативных и гироскопических сил и невырожденности матрицы неконсервативных сил. К рассматриваемому здесь нелинейному случаю эти условия, строго говоря, неприменимы. Тем не менее, выше во всех пяти случаях стабилизация осуществлена в полном соответствии с названными условиями. Определитель матрицы неконсер вативных сил для (1) равен 2 ( x 2 + y 2 )2 и отличен от нуля вне исследуемого положения равновесия x = y = 0. При отсутствии потенциальных сил в ста билизирующих обратных связях (4), (5) и (6) задействованы одновременно диссипативные и гироскопические силы. Если же присоединяются потен циальные силы, то стабилизация может быть осуществлена как с привле чением (управление (7)), так и без привлечения гироскопических сил, как это имеет место при управлении (3).

Литература 1. Меркин Д.Р. Введение в теорию устойчивости движения. М.: Наука, 1987. с.

2. Post R.F. Stability Issues in Ambient-Temperature Passive Magnetic Bearing Sys tems. February 17, 2000. Lawrence Livermore National Laboratory. Technical Informa tion Department’s Digital Library. http://www.llnl.gov/tid/Library.html.

3. Матросов В.М. Метод векторных функций Ляпунова: анализ динамических свойств нелинейных систем. М.: Физматлит, 2001. 384 с.

4. Метелицын И.И. К вопросу о гироскопической стабилизации // ДАН. 1952. Т.

86. № 1. С. 31 – 34.

5. Александров А.Ю., Жабко А.П., Косов А.А. Исследование устойчивости и ста билизация нелинейных систем на основе декомпозиции // Школа-семинар «Нели нейный анализ и экстремальные задачи». Иркутск, 24-30 июня 2008г. Тезисы док ладов. Иркутск, ИДСТУ СО РАН, 2008. С. 10-11.

6. Пятницкий Е.С. Принцип декомпозиции в управлении динамическими систе мами // ДАН. 1988. Т. 300. № 2. С. 300-303.

7. Черноусько Ф.Л., Ананьевский И.М., Решмин С.А. Методы управления нели нейными механическими системами. М.: Физматлит, 2006. 328 с.

8. Зубов В.И. Аналитическая динамика гироскопических систем. Л.: Судострое ние, 1970. 320 с.

9. Меркин Д.Р. Гироскопические системы. М.: Наука, 1974. 344 с.

10. Меркин Д.Р. О методе и теоремах И.И.Метелицына // ПММ. 2001. Т. 65. Вып.

3. С. 536 - 540.

УДК 330.115:37. М.П. Базилевский, С.И. Носков ТЕХНОЛОГИЯ ОРГАНИЗАЦИИ КОНКУРСА РЕГРЕССИОННЫХ МОДЕЛЕЙ Одной из основных проблем, связанных с разработкой математиче ских моделей объектов различной природы, является структурная специ фикация каждого отдельного уравнения, состоящая в выделении наиболее информативного (в определенном смысле) набора объясняющих перемен ных и выборе наиболее адекватной исследуемому процессу формы связи между ними. Обычно при моделировании социально-экономических про цессов отсутствуют надежные предпосылки содержательного характера, которые позволили бы построить универсальные алгоритмы разработки наиболее адекватной спецификации той или иной модели. В этом случае целесообразна организация "конкурса" моделей, состоящего в формирова нии множества их альтернативных вариантов с заданными заранее свойст вами и последующем выборе наиболее приемлемого варианта на основе совокупности формальных и содержательных критериев.

Рассмотрим линейное регрессионное уравнение:

m y k = i xki + k, k = 1, n, (1) i = k - номер наблюдения обрабатываемой выборки длины n, - вектор где оцененных параметров, xk - вектор значений экзогенных переменных мо дели, k - ошибки аппроксимации.

Соотношения между социально-экономическими факторами далеко не всегда можно выразить линейными функциями (1), так как при этом могут возникать неоправданно большие ошибки. В таких случаях нужно исполь зовать нелинейную (по объясняющим переменным) регрессию.



Pages:     | 1 || 3 | 4 |   ...   | 5 |
 





 
© 2013 www.libed.ru - «Бесплатная библиотека научно-практических конференций»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.