авторефераты диссертаций БЕСПЛАТНАЯ БИБЛИОТЕКА РОССИИ

КОНФЕРЕНЦИИ, КНИГИ, ПОСОБИЯ, НАУЧНЫЕ ИЗДАНИЯ

<< ГЛАВНАЯ
АГРОИНЖЕНЕРИЯ
АСТРОНОМИЯ
БЕЗОПАСНОСТЬ
БИОЛОГИЯ
ЗЕМЛЯ
ИНФОРМАТИКА
ИСКУССТВОВЕДЕНИЕ
ИСТОРИЯ
КУЛЬТУРОЛОГИЯ
МАШИНОСТРОЕНИЕ
МЕДИЦИНА
МЕТАЛЛУРГИЯ
МЕХАНИКА
ПЕДАГОГИКА
ПОЛИТИКА
ПРИБОРОСТРОЕНИЕ
ПРОДОВОЛЬСТВИЕ
ПСИХОЛОГИЯ
РАДИОТЕХНИКА
СЕЛЬСКОЕ ХОЗЯЙСТВО
СОЦИОЛОГИЯ
СТРОИТЕЛЬСТВО
ТЕХНИЧЕСКИЕ НАУКИ
ТРАНСПОРТ
ФАРМАЦЕВТИКА
ФИЗИКА
ФИЗИОЛОГИЯ
ФИЛОЛОГИЯ
ФИЛОСОФИЯ
ХИМИЯ
ЭКОНОМИКА
ЭЛЕКТРОТЕХНИКА
ЭНЕРГЕТИКА
ЮРИСПРУДЕНЦИЯ
ЯЗЫКОЗНАНИЕ
РАЗНОЕ
КОНТАКТЫ


Pages:     | 1 |   ...   | 3 | 4 || 6 |

«Вестник Брянского государственного университета. № 4 (2008): Математика. Физика. Биология. Химия. Брянск: РИО БГУ, 2008.160 с. Редакционная коллегия ...»

-- [ Страница 5 ] --

[7] клетки Rhizobium lupini на каждый грамм фиксации азота используют от 3 до 6 г углеро да. Еще более затратным является процесс потребления углеводов у азотобактера. Для свя зывания одного грамма азота он перерабатывает 70-100 глюкозы, а эффективность этого процесса составляет 1,5-2,0%. Исследования Г.С.Посыпанова [8], А.С. Кононова [1] подтвер дили мнение о том, что небольшие дозы азота на ранних фазах роста полезны для растений люпина. В смешенных посевах люпина с яровой пшеницей на фоне N60 урожайность зерна возрастала на 22 % [1]. При достаточном количестве азота молодые растения люпина мень ше страдают от паразитизма клубеньковых бактерий на фазе всходы-розетка. Уникальные функции симбиотрофных организмов приобретают особое значение в связи с возможностью использования биологических механизмов питания растений азотом, что особенно важно в гетерогенных агроценозах. Микробная масса особенно богата азотом. В клетках микроорга низмов содержится до 12 % азота, на P2O5 приходится -3%, К2О [9]. Процесс азотфиксации стимулируется микроэлементами молибденом и кобальтом. Согласно современным пред ставлениям процесс фотосинтеза состоит из трех этапов. Первый- это фотохимическое раз ложение воды при участии хлорофилла и выделении О2. Второй – это окислительно востановительный процесс с участием хлорофилла и цитохромов, при котором образуется АТФ и запасается энергия света. Третий этап - это использование энергии запасенной с уча стием хлорофилла для восстановления СО2 до углеводов в темновую фазу.

Можно предположить, что количество синтезируемого пигмента хлорофилла в семя долях и листьях растений показывает направленность и величину интенсивности фотосинте за в гетерогенной системе. Как показали исследования, в смешанном посеве у растений лю пина в фазу всходов возрастает количество хлорофилла в семядольных листьях, такая тен денция характерна для гетерогенного агроценоза и при последующих фаза люпина (табл.1).

Но особенно сильно увеличивается количество хлорофилла в семядолях и листья люпина и ячменя при инокуляции люпина клубеньковыми бактериями в смешанных посевах (табл.1).

Можно предположить, что фитогормоны, в частности цитокинины способст вующие накоплению антоцианов, в семядольных листьях одновидовых посевов лю пина узколистного, а в смешанном посеве подвергались быстрому разрушению в се мядолях люпина под влиянием рассеянной солнечной радиации вызванной листьями ячменя.

Вестник Брянского госуниверситета №4 (2008) Исследования показали, что в гетерогенной системе включающей различающиеся по биологии растения количество хлорофилла в семядолях люпина, листьях азотфиксирующе го бобового растения люпина и не азотфиксирующего ячменя - коррелирует с изменением обменных процессов, что связано с направленностью химических реакций, снижающих со держание антоциана в семядолях при рассеянной солнечной радиации и благоприятно влияющих на азотный обмен люпина и ячменя по сравнению с их одновидовыми посевами.

In intercropping agrocenoze beside nitroginfixcacion plants amount chlorophyll in cotyledon of the lupine, sheet and not nitroginfixcacion barley – link the fraudulent processes with change that is connected with directivity chemical reaction, reducing contents antozian in cotyledon under diffused solar radiation and favourable influencing upon nitric changing the cultures.

The key words: chlorophyll, antozian, nitroginfixcacion, lupine, mixed sowing..

Список литературы 1. Кононов А. С. Люпин: технология возделывания в России. - Брянск, 2003. 212 с.

2. Физиология растений : учеб. для студентов вузов, обучающихся по специальности 032400 «Биология» / Н.И. Якушкина, Е.Ю. Бахтенко. М.: Гуманитар, изд. центр ВЛАДОС, 2005. 463 с.

3. Доспехов Б. А. Методика полевого опыта. М.: Агропромиздат, 1985. 351c.

4. Бабьева И.П., Зенова Г.М. Биология почв. М., изд-во МГУ, 1989. 336 с.

5. Гродзинский A.M. Аллелопатия растений и почвоутомление. - Киев, 1991. 432 с.

6. Winter F.G.Allelopathie als Stoffwauderung und Stoffumwandlund // Ber.Dtsch.

hort. Ges. 1960.Bd.73.№9.

7. Кретович В. Л. Биохимия растений. М.: Высш. школа, 1986. 553с.

8. Аллелопатия растений и почвоутомление. Киев, 1991. 432 с.

9. Посыпанов Г.С. Биологический азот // Проблемы экологии и растительного белка.

М., изд-во МСХА, 1993.

10. Агроэкология / В. А. Черников, Р. М. Алексахин, А. В. Голубев и др.;

Под ред.

В.А.Черникова, А. И. Чекереса. М.: Колос, 2000. 536 с.

Об авторах А.С. Кононов – докт. с/х. наук, проф., Брянский государственный университет им. академика И.Г. Петровского, as-kon@yandex.ru М.Ю. Никитушкина – аспирант, Брянский государственный университет им. академика И.Г. Петровского, as-kon@yandex.ru УДК 631. ВОЗМОЖНОСТИ АДАПТИВНОЙ СЕЛЕКЦИИ ЧЕРНОЙ СМОРОДИНЫ Н.В. Маркелова Селекция черной смородины, пройдя путь природной и научной селекции, находится на этапе адаптивной се лекции. Создание адаптивных сортов основано на конструировании генотипов на основе известных олигогенов и полигенов, контролирующих устойчивость сортов к неблагоприятным факторам среды и сочетающих ком плекс хозяйственно ценных признаков и свойств. Основным методом создания таких сортов является межвидо вая гибридизация с использованием методов гетерозисной селекции, основанная на широком использовании генофонда с целью переноса искомых генов и блоков генов в гибридные популяции, на интеграции наследст венности разных видов. В селекционный процесс вовлекаются гены различных видов черной смородины. В качестве исходного материала в гибридизацию целесообразно использование потомком черной смородины раз Естественные науки ных эколого-географических групп, которые имеют сложное генетическое строение и являются проверенными донорами на отдельные признаки и их комплекс. Это обеспечивает в селекции положительные результаты.

Ключевые слова: селекция ягодных культур, адаптивность, генотип, доноры, гибридный материал, сорт.

Во всем мире большое значение придается получению экологически чистой продук ции, охране окружающей среды, в связи с чем разрабатываются технологии, исключающие или сводящие к минимуму применение химических средств, загрязняющих среду. В услови ях современного развития земледелия и внедрения таких технологий одно из центральных мест при возделывании той или иной культуры принадлежит сорту. Совершенствование сор тимента ягодных культур, в частности черной смородины, определяется созданием наиболее урожайных, крупноплодных, высокоустойчивых к болезням и вредителям сортов.

В последнее время в связи с изменениями климата, ухудшением экологической обста новки, переходом на высокопроизводительные технологии, с усилением вредоносности бо лезней и вредителей изменились требования к сортам, что нашло отражение в различных се лекционных программах.

Селекция черной смородины, пройдя путь от природной (случайной селекции) через научную селекцию, находится на этапе адаптивной селекции. Основным направлением та кой селекции как в целом для ягодных культур, так и для черной смородины, является созда ние сортов, сочетающих пригодность к механизированной уборки ягод, стабильную урожай ность (не менее 70 ц/га), высокую комплексную устойчивость к болезням и вредителям, вы сокое содержание в ягодах биологически активных веществ (витамина С не менее мг/100г) [9].

С точки зрения стратегии и тактики адаптивной селекции, наиболее эффективным пу тем совершенствования сортов является конструирование генотипов на основе известных олигогенов, контролирующих в основном устойчивость к болезням и вредителям, и полиге нов, контролирующих сочетание адаптивности и компонентов продуктивности. В связи с этим основным методом создания гибридного материала является межвидовая гибридизация с использованием методов гетерозисной селекции. Такая селекция основана на широком ис пользовании генофонда с целью переноса искомых генов и блоков генов в гибридные попу ляции, на интеграции в геномах наследственности разных видов. При этом в селекционный процесс вовлекаются гены различных видов черной смородины: европейской, скандинавской, сибирской, дикуши, клейкой, черешчатой, канадской и др.

В качестве исходного материала в гибридизации целесообразно использование по томков черной смородины разных эколого-географических групп. Такие формы имеют сложное генетическое происхождение, а использование уже проверенных генетических до норов на отдельные признаки обеспечит в селекции положительные результаты.

Значительный прогресс достигнут по величине ягод черной смородины, уровень средней массы наиболее крупноплодных сортов уже достигает 4 грамма [1,3]. Донорами признака крупноплодности ягод черной смородины считаются формы европейского, сибир ского подвидов и скандинавского экотипа, которые имеют превосходство над сортами за падноевропейского происхождения. А самый высокий выход крупноплодных гибридов по лучен в группе скрещиваний, производных от европейского и сибирского подвидов черной смородины.

Важным признаком хорошего сорта остается содержание в ягодах витамина С. За стабильность и высокое значение этого признака потомки черной смородины европейского, сибирского подвидов и дикуши рекомендованы как исходные формы для гибридизации [7].

Однако, отмечают, что в условиях средней полосы сибирский подвид черной смородины и дикуши отличается более низким содержанием витамина С в ягодах, чем европейский под вид [2]. Анализ содержания витамина С в ягодах потомков смородины черешчатой показал промежуточный характер проявление этого признака, слабое варьирование и отсутствие трансгрессивных форм. Разработаны скрещивания для преодоления отрицательной корреля Вестник Брянского госуниверситета №4 (2008) ционной зависимости между крупноплодностью и содержанием в ягодах витамина С и по лучены крупноплодные сорта с высоким содержанием в ягодах витамина С [1,3,6].

Одним из комплекса признаков продуктивности для черной смородины является ко личество цветков в кисти. Большинство длиннокистных сортов и гибридов получено от скрещиваний со смородиной черешчатой и смородиной прицветниковой [4,6]. Длиннокист ные формы отмечены у смородины дикуши, а сибирские сорта, как правило, имеют корот кую и среднюю кисть [4,5].

Особой проблемой для селекции ягодных культур остается селекция на устойчивость к болезням и вредителям. Это один из основных показателей адаптивности сорта. Лимити рующей болезнью для черной смородины в условиях Брянска является мучнистая роса. Ус тойчивость и иммунитет к мучнистой росе достигается различными путями. Одним из них остается использование доноров олигогенной устойчивости при сочетании их друг с другом или с высокой полевой устойчивостью. Другой путь – поиск высокоустойчивых доноров и источников. В связи с этим селекция на создание устойчивых к мучнистой росе форм оказа лась наиболее результативной при включении в гибридизацию сортов финского и шведского происхождения скандинавского экотипа [1,3,7]. Высокая полевая устойчивость отмечена у североамериканских сортов [7]. Таким образом, Финляндию и Швецию считают первичным очагом проявления устойчивости к мучнистой росе в пределах европейских сортов и форм.

Второй очаг высокоустойчивых форм – североамериканский, включающий смородину че решчатую, канадскую, американскую. Решение проблемы устойчивости стало возможным и при использовании в селекции смородины непоражаемых или слабо поражаемых американ ских видов крыжовника [9,10]. Неустойчивыми к мучнистой росе оказались сорта, которые берут свое происхождение от смородины черешчатой.

В последние годы значительно усилилась вредоносность ржавчины и листовых пятни стностей (антракноза и септориоза). Устойчивость к антракнозу выявлена у потомков сморо дины сибирского подвида, представителей европейского подвида, у гибридных потомков смородины европейской и дикуши, у смородино - крыжовниковых гибридов, у смородины ключевой, малоцветковой, американской и моховки [3,6]. Активно ведется и селекция на иммунитет к септориозу. Выявлены различные генетические формы устойчивости. Наиболее устойчивы к септориозу сорта сибирского подвида, относительно устойчивы – производные европейского подвида, трехгеномные потомки смородины дикуши [1,5]. Отмечена устойчи вость у смородины уссурийской и ключевой.

Из вредителей наиболее опасным и малоуязвимым остается почковый клещ, который является переносчиком микоплазменного заболевания – махровости. Устойчивость к почко вому клещу несут формы – производные сибирского подвида, европейского подвида, потом ки смородины клейкой, дикуши [3,5]. Исследованиями Keep E. (1981), В.П. Копань (1996) отмечена устойчивость геноплазмы крыжовника.

Положительной стороной современных сортов является их достаточно высокая ком плексная устойчивость к нескольким грибным болезням и вредителям. Ведущую роль в та кой селекции играет традиционный отбор рекомбинантов из гибридных популяций, выделяя тем самым малые гены устойчивости и дополняя их генами, контролирующими другие хо зяйственно ценные признаки. Сортообразцы черной смородины, устойчивые к комплексу болезней, имеются во всех генетических группах, но наибольшее их число выявлено среди потомков смородины дикуши и сибирского подвида. Наилучшими формами в данном на правлении являются гибриды, в генотипе которых объединены гены европейского, сибир ского подвидов и смородины дикуши.

Полученные формы широко используются в селекции. Их преимуществом в качестве исходного материала является возможность закрепить уже достигнутые высокие уровни проявления разных селекционных признаков и добиться наиболее полного сочетания в бли жайших поколениях отбора без существенной поломки ранее сложившегося комплекса адап тационных и хозяйственно ценных свойств. Современный генофонд открывает широкие возможности для создания адаптивных сортов черной смородины.

Естественные науки The selection of black currant, after passing the way of natural and scientific selection, is located on the stage of adap tive selection. The creation of adaptive types is based on the construction of genotype on the basis of known oligogenov and poly-genes, which control the stability of types to the unfavorable factors of medium and combining complex eco nomic valuable signs and properties. The basic method of creating such types is the interspecies hybridization with the use of methods of geterozisnoy selection, based on the wide use of a gene pool for the purpose of the transfer of the desired genes and blocks of genes into the hybrid populations, on the integration of the heredity of different types. The genes of different forms of black currant are implicated into the selective process. As the source material into the hy bridization the use by a descendant of the black currant of the different ecological- geographical groups, which have complex genetic structure and are the donors to the separate signs and their complex, is expedient. This provides in the selection positive results.

The key words: the selection of berry cultures, adaptability, genotype, donors, hybrid material, type.

Список литературы 1. Астахов А.И. Селекция смородины черной на генетической основе/ Астахов А.И.

// Плодоводство. Ягодоводство на современном этапе: Материалы межд. науч.-практ. конф./ НАН Беларуси: Самохваловичи, 2004. т.15. С.34-42.

2. Исачкин А.В. Сортовой каталог. Ягодные культуры/ Исачкин А.В., Воробьев Б.Н., Аладина О.Н. М.: ЭКСМО. Пресс, Лик пресс, 2001. С.66-131.

3. Князв, С.Д. Селекция черной смородины на современном этапе / С.Д. Князев, Т.П.

Огольцова.- Орел: Орел ГАУ, 2004. 238с.

4. Копань В.П. Олигогенные доноры в селекции плодовых и ягодных культур/ Ко пань В.П., Копань К.Н., Болдыжева Л.Д.// Состояние сортимента плодовых и ягодных куль тур и задачи селекции: тез. докл. Межд. науч. – метод. конф. (25 июля, 1996г, Орел) / ВНИ ИСПК. Орел, 1996. С.126-128.

5. Муравьева Л.П. Закономерности наследования адаптивно значимых признаков черной смородины в условиях Приенисейских степей Восточной Сибири / Муравьева Л.П., Муравьев Г.А. // Ягодоводство на современном этапе: сб. науч.тр: НАН Беларуси. Самохва ловичи: БелНИИП, 2004. Т.15. С.80-84.

6. Огольцова Т.П. Селекции черной смородины. Прошлое, настоящее, будущее / Т.П.Огольцова. – Тула: Приокское книжное изд-во. 1992. 384 с.

7. Равкин А.С. Черная смородина. Исходный материал, селекция, сорта / А.С. Равкин.

М.: Изд-во Моск. ун-та, 1987. 216 с.

8. Седов Е.Н. Сорта для интенсивных садов / Седов Е.Н. // Садоводство и виногра дарство. 2007. 1. С.15-16.

9. Keep E. Ribes glutinosum and R. sanguineum as donors of resistance to American gooseberry mildew in black currant breeding / Keep E. // Euphytica/ 1981 Vol. 30. P.197-201.

10. Rousi A. A probable case of monogenicalle determined resistanse to American goose berry mildew in blackcurrant / Rousi A. // Ann. Agr. Fenn. 1966. V.5. №9. P.256-258.

Об авторе Н.В. Маркелова – канд. с.-х. наук, ст.преп., Брянский государственный университет им. академика И.Г. Петровского, pirat700@nextmail.ru УДК 578. ОПРЕДЕЛЕНИЕ НУКЛЕОТИДНОЙ ПОСЛЕДОВАТЕЛЬНОСТИ ФРАГМЕНТА ГЕНА БЕЛКА ОБОЛОЧКИ МЕСТНОГО ИЗОЛЯТА ВККМ Е.В. Немцова, А.В. Артюхова, Е.В. Дроздов, В.В. Заякин, И.Я. Нам Проведено клонирование фрагмента гена белка оболочки вируса кустистой карликовости малины длиной bp в pal-TA вектор. Фрагмент получен в ходе RT-PCR на образцах РНК ремонтантной малины, пораженной Вестник Брянского госуниверситета №4 (2008) вирусом. Определена нуклеотидная последовательность двух фрагментов ВККМ, встроенных в плазмидную ДНК различных клонов E.coli. Сравнение этих последовательностей с имеющимися в банке генов последова тельностями гена белка оболочки 15-ти изолятов ВККМ показало, что местный изолят наиболее близок к штамму R15, относящемуся к группе RB изолятов.

Ключевые слова: малина, вирус кустистой карликовости малины (ВККМ), ген белка оболочки, штамм R15, нуклеотидная последовательность.

Вирус кустистой карликовости малины (ВККМ), относящийся к роду Idaeovirus, яв ляется одним из наиболее опасных патогенов малины и ежевики. Поражая посадки этих культур, он приводит к возникновению хлорозов, некрозов, появлению деформированных и «рассыпчатых» плодов, снижению продуктивности растений [1]. При заболевании растений число костянок в ягодах снижается до 10-12 штук, в то время как в норме доходит до 60 [2].

В полевых условиях ВККМ способен передаваться при семенном размножении и с пыльцой, что приводит к сложностям контроля над этим вирусом.

Растения рода Rubus поражаются изолятами ВККМ, относящимися к трем группам:

S изоляты, подобные шотландскому изоляту D200. Большинство изолятов ВККМ относится к этой группе;

RB изоляты, подобные S изолятам серологически и по симптомалогии на травяни стых тест-растениях. Отличаются способностью инфицировать некоторые сорта малины, ус тойчивые к S изолятам;

В изоляты, выделенные из черной малины (R. occidentalis L.), серологически отли чимые от S и RB изолятов и имеющие невысокую инфекционную способность [1, 3].

В настоящее время различные изоляты ВККМ выявлены в питомниках и плантациях малины в Европе, Северной и Южной Америке, Австралии, Южной Африке. В отечествен ной литературе информация о распространении ВККМ, а также характеристика изолятов, встречающихся на территории России, отсутствует. Однако в посадках ремонтантной мали ны Кокинского ОП ВСТИСП1, расположенного в Брянской области, повсеместно обнаружи вается появление «рассыпчатых» плодов, что сильно сказывается на урожайности этой куль туры.

Для обнаружения ВККМ ранее нами была разработана методика на основе метода RT-PCR (Reverse Transcription – Polymerase Chain Reaction) и проведен скрининг этого виру са в лабораторном и полевом материале ремонтантной малины Кокинского ОП ВСТИСП [4].

Целью данной работы являлось определение штамма ВККМ, распространенного в питомни ке.

Методика Для решения поставленных задач осуществлялось клонирование фрагмента гена белка оболочки ВККМ с использованием стандартных методик [5, 6]. RT-PCR проводили на образ цах РНК растений ремонтантной малины Кокинского ОП ВСТИСП по разработанной ранее методике [4]. кДНК длиной 383 bp была элюирована из геля, обработана Phe-Chl (1:1) и ли гирована в pal-TA вектор (аналог pGEM-T Easy, производство «Евроген»). Лигазную реак цию проводили в стандартных условиях (16ч, 160С) с использованием T4 ДНК лигазы в ко личестве 5 ед. Вейса/мкл («СибЭнзим»). Для лигазной реакции использовали 50 нг ДНК век тора и 15-20 нг вставки, молярное соотношение вектора к вставке – 1:3.

Полученный продукт клонировали в клетках E. coli (штамм JM 109). Бело-голубую селекцию клонов проводили на среде LB, содержащей 2% агара, X-Gal (30 мкг/мл), IPTG ( мкг/мл), ампициллин (100 мкг/мл). Выросшие белые колонии проверяли на наличие вставки ВККМ длиной 383 bp методом PCR (праймеры RBDV-СP+3Eco и RBDV-CP-3Sal) и рест рикцией плазмидной ДНК по сайту EcoRI. ДНК двух клонов E. coli, содержащих вирусный фрагмент, была секвенирована («Евроген»).

ОП ВСТИСП – Опорный пункт Всероссийского селекционно-технологического института садоводства и пи томниководства Естественные науки С целью определения штамма ВККМ, распространенного в посадках ремонтантной малины Кокинского ОП ВСТИСП, полученная нуклеотидная последовательность клониро ванного фрагмента сравнивалась со всеми последовательностями РНК-2 ВККМ, имеющими ся в банке генов GenBank. Анализ и обработка результатов секвенирования проводились с использованием программы Vector NTI. Статистическая обработка результатов секвенирова ния и выравнивание нуклеотидных последовательностей гена белка оболочки ВККМ прово дилось с использованием программы ClustalW2. Для построения дендрограммы использова лась программа MEGA4: Molecular Evolutionary Genetics Analysis. Для выявления филогене тических связей применялся метод ближайших соседей NJ [7].

Результаты Нуклеотидные последовательности клонированных фрагментов ВККМ, а также по следовательности гена белка оболочки всех известных изолятов вируса представлены на рис.

1. Последовательности клонированных фрагментов (№ 1 и 2), встроенные в плазмидную ДНК двух различных клонов E.coli, несколько отличались друг от друга. Вероятно, это свя зано с ошибками при проведении PCR или при секвенировании. Данные фрагменты имели наибольшее сходство с участком гена белка оболочки РНК-2 и РНК-3 изолята вируса R15, относящегося к группе RB изолятов [8, 9]. Последовательности нуклеотидов S-изолятов по целому ряду позиций отличались от последовательности R15-изолята и от клонированных фрагментов (отличия выделены серым цветом).

Определена степень гомологии клонированных фрагментов изолята ВККМ, распро страненного в посадках ремонтантной малины Кокинского ОП, с геном белка оболочки всех известных изолятов ВККМ, последовательности которых имеются в банке генов [8, 9, 10, 11, 12, 13]. Степень гомологии клонированного фрагмента № 1 ВККМ с последовательностью РНК-2 и РНК-3 изолята R15 составляла 99,2% и 98,1% соответственно;

степень гомологии фрагмента № 2 составляла 98,9% и 97,9% соответственно (таблица № 1). В тех случаях, ко гда одна из этих последовательностей совпадала с последовательностью R15, а другая нет, следует считать, что эти отличия возникли случайным образом при проведении PCR или се квенировании и можно предположить, что нуклеотидные последовательности клонирован ных фрагментов совпадают с литературными. С учетом этого гомология фрагментов 1 и 2 с последовательностью гена белка оболочки изолята R15 составляла почти 100% (имелось от личие в один нуклеотид – позиция 1540).

Нуклеотидные последовательности штаммов, относящихся к различным группам (S, RB или B), очень похожи. Гомология их составляла от 85% до 98%. Участок гена белка обо лочки с 1640 по 1700 осн. являлся наиболее консервативным. 3/-конец праймеров, разрабо танных нами для анализа ВККМ, полностью комплементарен последовательностям всех изо лятов, кроме штамма, распространенного в Китае [10]. Поэтому с использованием данных праймеров можно проводить анализ большинства изолятов ВККМ, независимо от их сероло гических свойств.

Вестник Брянского госуниверситета №4 (2008) (1487) 1487 1500 1510 1520 1530 1540 1550 1560 1570 1 (1) -GACATGTCTATGTCTGGCTAAGGTTAAGCGCGTTAATACGTGGCTTAAAAAACTTTGATCGCGAATATTGGGATAACCAATTCGCATCAAAACCCA 2 (1) -GACATGTCTAT-TCTG-CTAAGGTTAAGCGCGTTAATACGTGGCTTTAAAACCT--GATCGCGAATATTGGGATAACCAATTCGCATCAAAACCCA Natsuaki_R-15(1486) GGACATGTCTATGTCTG-CTAAGGTTAAGCGCGTTAATACGTGGCTTAAAAACTTT-GATCGCGAATATTGGGATAACCAATTCGCATCAAAACCCA Mayo_R-15 (162) GGACATGTCTATGTCTG-CTAAGGTTAAGCGCGTTAATACGTGGCTTAAAAACTTT-GATCGCGAATATTGGGAAAACCAATTCGCATCAAAACCCA D1 (162) GGACATGTCTATGTCTG-CTAAGGTTAAGCGCGTTAATACGTGGCTTAAAAACTTT-GATCGCGAATATTGGGAAAACCAATTCGCATCAAAACCCA Can (126) GGACATGTCTATGTCTG-CTAAGGTTAAGCGCGTCAATACGTGGCTTAAAAACTTT-GATCGCGAATATTGGGATAACCAGTTCGCATCAAAACCCG D200 (162) GGACATGTCTATGTCTG-CTAAGGTTAAGCGCGTCAATACGTGGCTTAAAAACTTT-GATCGCGAATATTGGGATAACCAGTTCGCATCAAAACCCG CanS (162) AGACATGTCTATGTCTG-CTAAGGTTAGTCGCGTTAATACGTGGCTTAAAAACTTT-GATCGCGAATATTGGGATAACCAATTCGCATCAAAACCCG M (146) GGACATGTCTATGTCTG-CTAAGGTTAAGCGCGTTAATACGTGGCNNAAAAATTTT-GATCGCGAATATTGGGATAACCAATTCGCATCAAAACCCG RBDV_CP_RR-1(1462) GGACATGTCTATGTCTG-CTAAGGTTAAGCGCGTTAATACGTGGCTTAAAAATTTT-GATCGCGAATATTGGGATAACCAATTCGCATCAAAACCCG RDDV_CP_CMRR-1(1462) GGACATGTCTATGTCTG-CTAAGGTTAAGCGCGTTAATACGTGGCTTAAAAATTTT-GATCGCGAATATTGGGATAACCAATTCGCATCAAAACCCG RBDV_CP_CmGR-2(1473) GGACATGTCTATGTCCG-CTAAGGTTAAGCGCGTTAATACGTGGCTTAAAAACTTT-GATCGCGAATACTGGGATAACCAATTCGCATCAAAACCCA RBDV_CP_GR-2(1464) GGACATGTCTATGTCCG-CTAAGGTTAAGCGCGTTAATACGTGGCTTAAAAACTTT-GATCGCGAATACTGGGATAACCAATTCGCATCAAAACCCA RBDV_CP_GR-4(1461) GGACATGTCTATGTCCG-CTAAGGTTAAGCGCGTTAATACGTGGCTTAAAAACTTT-GATCGCGAATACTGGGATAACCAATTCGCATCAAAACCCA RBDV_CP_GR-6(1462) GGACATGTCTATGTCCG-CTAAGGTTAAGCGCGTTAATACGTGGCTTAAAAACTTT-GATCGCGAATACTGGGATAGCCAATTCGCATCAAAACCCA China(1446) GGACATGTCGATGGCCG-CTAAGGTTAAGCGCGTGAATACGTGGCTTAAAAATTTT-GATCGCGAATATTGGGATAACCAGTTCGCTTCAAAACCTC Z13-a (162) GGACATGTCTATGTCTG-CTAAGGTTAAGCGCGTTAATACGTGGCTTAAGAACTTT-GATCGCGAATATTGGGATAACCAATTCGCATCAAAACCCG Z13-b (162) GGACATGTCTATGTCTG-CTAAGGTTAAGCGCGTTAATACGTGGCTTAAGAACTTT-GATCGCGAATATTGGGATAACCAATTCGCATCAAAACCCG (1584) 1584 1590 1600 1610 1620 1630 1640 1650 1660 1670 1 (97) TTCCTAGACCTGCTAAACAGGTCTTGAAGGGTTCATCCTCCAAATCTCAGCAACGAGACGAAGGAGAGGTGGTCTTTACCCGAAAAGACTCCCAGAA 2 (93) TTCCTAGACCTGCTAAACAGGTCTTGAAGGGTTCATCCTCCAAATCTCAGCAACGAGACGAAGGAGAGGTGGTCTTTACCCGAAAAGACTCCCAGAA Natsuaki_R-15(1581) TTCCTAGACCTGCTAAACAGGTCTTGAAGGGTTCATCCTCCAAATCTCAGCAACGAGACGAAGGAGAGGTGGTCTTTACCCGAAAAGACTCCCAGAA Mayo_R-15 (257) TTCCTAGACCTGCTAAACAGGTCTTGAAGGGTTCATCCTCCAAATCTCAGCAACGAGACGAAGGAGAGGTGGTCTTTACCCGAAAAGACTCCCAGAA D1 (257) TTCCTAGACCTGCAAAACAGGTCTTGAAGGGTTCATCCTCCAAATCTCAGCAACGAGACGAAGGAGAGGTGGTCTTTACCCGAAAAGACTCCCAGAA Can (221) TTCCTAGACCTGCAAAACAGGTCTTGAAGGGTTCATCCTCCAAATCTCAACAACGAGATGAAGGAGAGGTGGTCTTTACCCGAAAAGACTCCCAGAA D200 (257) TTCCTAGACCTGCAAAACAGGTCTTGAAGGGTTCATCCTCCCAATCTCAACAACGAGATGAAGGAGAGGTGGTCTTTACCCGAAAAGACTCCCAGAA CanS (257) TACCCAGACCTGCAAAACAGGTCTTGAAGGGTTCATCCTCCAAATCTCAACAACGAGATGAAGGAGAGGTGGTCTTTACCCGAAAAGACTCCCAGAA M (241) TTCCTAGACCTGCAAAACAGGTCTTGAAGGGTTCATCCTCCAAATCTCAACAACGAGATGAAGGAGAGGTGGTCTTTACCCGAAAAGACTCCCAGAA RBDV_CP_RR-1(1557) TTCCTAGACCTGCAAAACAGGTCTTGAAGGGTTCATCCTCCAAATCTCAACAACGAGATGAAGGAGAGGTGGTCTTTACCCGAAAAGACTCCCAGAA RDDV_CP_CMRR-1(1557) TTCCTAGACCTGCAAAACAGGTCTTGAAGGGTTCATCCTCCAAATCTCAACAACGAGATGAAGGAGAGGTGGTCTTTACCCGAAAAGACTCCCAGAA RBDV_CP_CmGR-2(1568) TTCCTAGACCTGTAAAACAGGTCTTGAAGGGTTCATCCTCTAAGTCTCAATACCGAGATGAAGGAGAGGTGGTCTTTACCCGAAAAGACTCCCAAAA RBDV_CP_GR-2(1559) TTCCTAGACCTGTAAAACAGGTCTTGAAGGGTTCATCCTCTAAGTCTCAATACCGAGATGAAGGAGAGGTGGTCTTTACCCGAAAAGACTCCCAAAA RBDV_CP_GR-4(1556) TTCCTAGACCTGTAAAACAGGTCTCGAAGGGTTCATCCTCTAAGTCTCAATACCGAGATGAAGGAGAGGTGGTCTTTACCCGAAAAGACTCCCAAAA RBDV_CP_GR-6(1557) TTCCTAGACCTGCAAAACAGGTCTTGAAGGGTTCATCCTCTAAGTCTCAATATCGAGATGAAGGAGAGGTGGTCTTTACCCGAAAAGACTCCCAAAA China(1541) TTCCCAGGCCTGCTAAGCAGGTCTTAAGAGGTTCATCCTCCTCCTCTCAGCAATGTGATGAAGGAGAGGTGGTCTTTACCAGAAAAGACTCCCAGAA Z13-a (257) TTCCAAGACCTGCGAAACAGGTCTTGAAGGGTTCATCCTCCAAATCTCAACAACGAGATGAAGGAGAGGTGGTCTTTACCCGAAAAGACTCCCAGAA Z13-b (257) TTCCTAGACCTGCGAAACAGGTCTTGAAGGGTTCATCCTCCAAATCTCAACAACGAGATGAAGGAGAGGTGGTCTTTACCCGAAAAGACTCCCAGAA (1681) 1681 1690 1700 1710 1720 1730 1740 1750 1760 1 (194) ATCCGTTAGGACTGTGTCTTATTGGGTTTGTACTCCTGAGAAGTCGATGAAACCTCTCAAATACAAGGAGGACGAAAACGTTGTTGAAGTCACCTTC 2 (190) ATCCGTTAGGACTGTGTCTTATTGGGTTCGTACTC-TGAGAAGTCGATGAAACCTCTCAAATACAAGGAGGACGAAAACGCTGTTGAAGTCACCTTC Natsuaki_R-15(1678) ATCCGTTAGGACTGTGTCTTATTGGGTTTGTACTCCTGAGAAGTCGATGAAACCTCTCAAATACAAGGAGGACGAAAACGTTGTTGAAGTCACCTTC Mayo_R-15 (354) ATCCGTTAGGACTGTGTCTTATTGGGTTTGTACTCCTGAGAAGTCGATGAAACCTCTCAAATACAAGGAGGACGAAAACGTTGTTGAAGTCACCTTC D1 (354) ATCCGTTAGGACTGTGTCTTATTGGGTTTGTACTCCTGAGAAGTCGATGAAACCTCTCAAATACAAGGAGGACGAAAACGTTGTTGAAGTCACCTTC Can (318) ATCCGTTAGGACTGTGTCCTATTGGGTTTGTACTCCTGAGAAGTCGATGAAACCTCTCAAATATAAGGAGGACGAAAACGTCGTTGAAGTTACCTTC D200 (354) ATCCGTTAGGACTGTGTCCTATTGGGTTTGTACTCCTGAGAAGTCGATGAAACCTCTCAAATATAAGGAGGACGAAAACGTCGTAGAAGTTACGTTC CanS (354) ATCCGTTAGGACTGTGTCCTACTGGGTTTGTACTCCTGAGAAGTCAATGAAACCTCTCAAATATAAGGAGGACGAAAACGTCGTTGAAGTTACCTTC M (338) ATCCGTTAGGACTGTGTCCTATTGGGTTTGTACTCCTGAGAAGTCAATGAAACCTCTCAAATATAAGGAGGACGAAAACGTCGTTGAAGTTACCTTC RBDV_CP_RR-1(1654) ATCCGTTAGGACTGTGTCCTATTGGGTTTGTACTCCTGAGAAGTCAATGAAACCTCTCAAATATAAGGAGGACGAAAACGTCGTTGAAGTTACCTTC RDDV_CP_CMRR-1(1654) ATCCGTTAGGACTGTGTCCTATTGGGTTTGTACTCCTGAGAAGTCAATGAAACCTCTCAAATATAAGGAGGACGAAAACGTCGTTGAAGTTACCTTC RBDV_CP_CmGR-2(1665) ATCCGTTAGGACTGTGTCCTATTGGGTTTGTACTCCTGAGAAGTCAATGAAACCTCTCAAATACAAGGAGGACGAAAACGTCGTTGAAGTTAGTTTC RBDV_CP_GR-2(1656) ATCCGTTAGGACTGTGTCCTATTGGGTTTGTACTCCTGAGAAGTCAATGAAACCTCTCAAATACAAGGAGGACGAAAACGTCGTTGAAGTTAGTTTC RBDV_CP_GR-4(1653) ATCCGTTAGGACTGTGTCCTATTGGGTTTGTACTCCTGAGAAGTCAATGAAACCTCTCAAATACAAGGAGGACGAAAACGTCGTTGAAGTTAGTTTC RBDV_CP_GR-6(1654) ATCCGTTAGGACTGTGTCCTATTGGGTTTGTACTCCTGAGAAGTCAATGAAACCTCTCAAATACAAGGAGGACGAAAACGTCGTTGAAGTTGGTTTC China(1638) ATCCGTTAGGACTGTGTCTTATTGGGTCTGCACTCCTGAGAAGTCTATGAAACCTCTCAACTATAAGGATGGCGAAAACGTTGTTGAAGTCGTCTTC Z13-a (354) ATCCGTTAGGACTGTGTCCTATTGGGTTTGTACTCCTGAGAAGTCAATGAAACCTCTCAAATACAAGGAGGACGAAAACGTCGTTGAAGTTACCTTC Z13-b (354) ATCCGTTAGGACTGTGTCCTATTGGGTTTGTACTCCTGAGAAGTCAATGAAACCTCTCAAATACAAGGAGGACGAAAACGTCGTTGAAGTTACCTTC (1778) 1778 1790 1800 1810 1820 1830 1840 1850 1860 1 (291) AATGACCTCGCAGCTCAAAAGGCTGGTGGCAAATTGGTTTCCATACTGTTGGAAATCAATGTGGTGGGCGGTGCCGTCGACGACA----------- 2 (286) AATGACCTCGCAGCTCAAAAGGCTGGTGACAAATTGGTTTCCATACTGTTGGAAATCAATGTGGTGGGCGGTGCCGTCGACGACA----------- Natsuaki_R-15(1775) AATGACCTCGCAGCTCAAAAGGCTGGTGACAAATTGGTTTCCATACTGTTGGAAATCAATGTGGTGGGCGGTGCCGTCGACGACAAAGGTCGAGTGG Mayo_R-15 (451) AATGACCTCGCAGCTCAAAAGGCTGGTGACAAATTGGTTTCCATACTGTTGGAAATCAATGTGGTGGGCGGTGCCGTCGACGACAAAGGTCGAGTGG D1 (451) AATGACCTCGCAGCTCAAAAGGCTGGTGACAAATTGGTTTCCATTCTGTTGGAAATCAATGTGGTGGGCGGTGCCGTCGACGACAAAGGTCGAGTGG Can (415) AATGACCTCACAGCTCAAAAGGCTGGTGACAAATTGGTTTCCATTCTGTTGGAAATCAATGTGGTGGGCGGTGCCGTCGACGATAAAGGTCGAGTGG D200 (451) AATGACCTCACAGCTCAAAAGGGTGGTGACAAATTGGTTTCCATTCTGTTGGAAATCAATGTGGTGGGCGGTGCCGTCGACGATAAAGGTCGAGTGG CanS (451) AATGACCTCACGGCCCAAAAGGCTGGTGACAAATTGGTTTCCATCTTGTTGGAAATCAATGTGGTGGGCGGTGCCGTCGACGACAAAGGTCGAGTGG M (435) AATGACCTCACAGCTCAAAAGGCTGGTGACAAATTGGTTTCCATCCTGTTGGAAATCAATGTGGTGGGCGGTGCCGTCGACGACAAGGGTCGAGTGG RBDV_CP_RR-1(1751) AATGACCTCACAGCTCAAAAGGCTGGTGACAAATTGGTTTCCATCCTGTTGGAAATCAATGTGGTGGGCGGTGCCGTCGACGACAAGGGTCGAGTGG RDDV_CP_CMRR-1(1751) AATGACCTCACAGCTCAAAAGGCTGGTGACAAATTGGTTTCCATCCTGTTGGAAATCAATGTGGTGGGCGGTGCCGTCGACGACAAGGGTCGAGTGG RBDV_CP_CmGR-2(1762) AATGACCTCGCAGCCCAAAAGGCTGGTGACAAATTGGTTTCCATCCTGTTGGAAATCAATGTGGTGGGCGGTGCCGTCGACGATAAGGGTCGAGTGG RBDV_CP_GR-2(1753) AATGACCTCGCAGCCCAAAAGGCTGGTGACAAATTGGTTTCCATCCTGTTGGAAATCAATGTGGTGGGCGGTGCCGTCGACGATAAGGGTCGAGTGG RBDV_CP_GR-4(1750) AATGACCTCGCAGCCCAAAAGGCTGGTGACAAATTGGTTTCCATCCTGTTGGAAATCAATGTGGTGGGCGGTGCCGTCGACGATAAGGGTCGAGTGG RBDV_CP_GR-6(1751) AACGACCTCGCAGCCCAAAAGGCTGGTGACAAGTTGGTTTCCATCTTGTTGGAAATCAATGTGGTGGGCGGTGCCGTCGACGATAAAGGTCGAGTGG China(1735) AGCGACCTCACCGCTCAAAGAGCTGGTGATAAATTGGTCTCCCTCCTGTTGGAGATCAATGTGGTAGGCGGAGCCGTGGCCGATAAAGGTCGTGTGG Z13-a (451) AATGACCTCACAGCTCAAAAAGCTGGTGATAAATTGGTTTCCATCCTGTTGGAAATCAATGTGGTGGGCGGTGCCGTCGACGACAAGGGTCGAGTGG Z13-b (451) AATGACCTCACAGCTCAAAAAGCTGGTGATAAATTGGTTTCCATCCTGTTGGAAATCAATGTGGTGGGCGGTGCCGTCGACGACAAGGGTCGAGTGG Рис. 1. Сравнение нуклеотидных последовательностей клонированных фрагментов длиной 383 bp с последовательностями гена белка оболочки различных штаммов ВККМ:

1 и 2 – нуклеотидные последовательности клонированных фрагментов;

остальные – нуклеотидные последовательности различных изолятов ВККМ по данным GenBank. Участки, соответствующие праймерам, подчеркнуты Естественные науки На основе сравнения последовательностей клонированных фрагментов с последова тельностями гена белка оболочки ВККМ, имеющимися в банке генов, построена дендро грамма, отображающая филогенетические связи (рис. 2).

Наибольшие отличия от всех проанализированных изолятов ВККМ были характерны для штамма из Китая – он не входил ни в один из кластеров и располагался на значительном расстоянии от всех других изолятов. Как природные, так и лабораторные S изоляты из Вели кобритании и Финляндии, образовывали отдельный кластер с двумя изолятами из Словении, а также с изолятом черной малины М (кластер б). Остальные изоляты ВККМ, распростра ненные в Словении, были сгруппированы в отдельный кластер с вероятностью 99% (кластер в).

Таблица № 1. Степень гомологии клонированных фрагментов ВККМ длиной 383 bp с геном белка оболочки наиболее распространенных штаммов Степень гомоло гии, % № Штамм Источник Фраг- Фраг мент № мент № 1 1 RBDV R15 Natsuaki T., 1991 / GenBank S55890 99,2 98, 2 RBDV R15 Mayo M.A., 1991 / GenBank D01052 98,9 97, 3 RBDV D1 Jones A.T., 2000 / GenBank AF259796 98,4 97, 4 RBDV Cm RR-1 Mavric I., 2008 / GenBank EU796089 96,0 94, 5 RBDV RR-1 Mavric I., 2008 / GenBank EU796090 96,0 94, 6 RBDV Can Jones A.T., 2000 / GenBank AF259797 95,7 94, 7 RBDV Z13-b Wang Q., 2005 / GenBank AY894679 95,7 94, 8 RBDV Z13-a Wang Q., 2005 / GenBank AY894678 95,5 94, 9 RBDV M Jones A.T., 2000 / GenBank AF259794 95,5 94, 10 RBDV D200 Jones A.T., 2000 / GenBank AF259795 94,7 93, 11 RBDV CanS Jones A.T., 2000 / GenBank AF259798 94,1 93, 12 RBDV CmGR-2 Mavric I., 2008 / GenBank EU796088 93,6 92, 13 RBDV GR-2 Mavric I., 2008 / GenBank EU796087 93,6 92, 14 RBDV GR-4 Mavric I., 2008 / GenBank EU796086 93,6 92, 15 RBDV GR-6 Mavric I., 2008 / GenBank EU796085 92,8 91, RBDV (китай- Chamberlain C.J., 2003 / GenBank 16 86,7 85, ский изолят) DQ Нуклеотидные последовательности клонированных фрагментов с высокой степенью достоверности (98%) образовывали отдельный кластер совместно с изолятами R15 и D (кластер а). Штамм D1, относящийся к S-группе, получен в лабораторных условиях при не прерывном культивировании изолята D200 в Nicotiana benthamiana [1]. Все остальные S изоляты находились на значительном расстоянии от данного кластера.

Из рис. 2 следует, что нуклеотидные последовательности клонированных фрагментов 1 и 2 имеют более тесную связь с изолятом R15, чем с D1. Это подтверждает, что изолят ВККМ, распространенный в посадках ремонтантной малины ОП ВСТИСП, имеет наиболь шее сходство с R15-изолятом ВККМ.

Вестник Брянского госуниверситета №4 (2008) а R D RR Cm RR M б CanS z13-a 97 z13-b Can D GR в Cm GR GR GR china 0.08 0.06 0.04 0.02 0. Рис. 2. Филогенетические связи, выявленные на основе анализа нуклеотидных после довательностей гена белка оболочки ВККМ с использованием метода ближайших соседей (NJ):

1 и 2 – нуклеотидные последовательности клонированных фрагментов, остальные – нуклеотидные последовательности различных изолятов ВККМ по данным GenBank Изолят R15 относится к группе изолятов RB (resistance breaking), преодолевающих генетическую устойчивость малины к ВККМ. Поэтому, сорта, устойчивые к S изолятам, не являются перспективными для нашей зоны. Это необходимо учитывать при проведении се лекционных мероприятий.

The 383 bp length fragment of the coat protein gene of Raspberry bushy dwarf virus (RBDV) has been cloned into pal TA plasmid vector. It was derived by RT-PCR from the everbearing raspberry infected RBDV. The nucleotide se quences from two clones E.coli has been determinated. Comparisons of these sequences with the coat protein gene se quences (from GenBank) showed that our local isolate has most similarity to R15 strain from the group of RB isolates.

The key words: Raspberry, Raspberry bushy dwarf virus (RBDV), coat protein gene, strain R15, nucleotide sequence.

Список литературы 1. Jones A. T., McGavin W. J., Mayo M. A., Angel-Diaz J. E., Karenlampi S. O., Kokko H.

Comparisons of some properties of two laboratory variants of Raspberry bushy dwarf virus (RBDV) with those of three previously characterized RBDV isolates // European Journal of Plant Pathology.

2000а. Vol. 106, №7. P. 623-632.

2. Strik B., Martin R. R. Impact of Raspberry Bushy Dwarf virus on ‘Marion’ Blackberry // Plant Disease. 2003. Vol. 87, №3. Р.294-296.

3. Murant A. F., Jones A. T. Comparison of isolates of Raspberry Bushy Dwarf Virus from red and black raspberries // Acta Hortic. 1976. Vol. 66. P.47-52.

Естественные науки 4. Немцова Е. В., Заякин В. В., Казаков И. В., Евдокименко С. Н., Нам И. Я. Скрининг вируса кустистой карликовости малины методом RT-PCR in vitro и в полевом материале // С.-х. биология. Сер. Биология растений. 2007. № 5. С. 119-123.

5. Генная инженерия растений: лабораторное руководство: под ред. Дж. Дрейпера.

М.: Мир, 1991. 408 с.

6. Маниатис Т., Фрич Э., Сэмбрук Дж. Методы генетической инженерии: Молеку лярное клонирование. М.: Мир, 1984.

7. Saitou N., Nei M. The neighbor-joining method: A new method for reconstructing phy logenetic trees // Molecular Biology and Evolution. 1987. № 4. P.406-425.

8. Natsuaki T., Mayo M. A., Jolly C. A., Murant A. F. Raspberry bushy dwarf virus RNA 2, complete sequence // GenBank NC_003740. 2008. URL:

http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nuccore&id= 9. Mayo M. A., Jolly C. A., Murant A. F., Raschke J. H. Raspberry bushy dwarf virus mRNA for coat protein, complete cds. // GenBank D01052. 2007. URL:

http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nuccore&id= 10. Chamberlain C. J., Kraus J. E., Kohnen P. D., Finn C. E., Martin R. R. Raspberry bushy dwarf virus segment RNA-2, complete sequence // GenBank DQ120126. 2005. URL:

http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nuccore&id= 11. Jones A. T., McGavin W. J., Mayo M. A., Angel-Diaz J. E., Kokko H., Karenlampi S.O.

Raspberry bushy dwarf virus strain Can coat protein mRNA, partial cds. // GenBank AF259797. 2000б. URL:

http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nuccore&id= 12. Wang Q., Cuellar W. J., Akita M., Rajamaki M.-L., Valkonen J. P. T. Raspberry bushy dwarf virus isolate Z13-a coat protein gene, complete cds. // GenBank AY894678. 2006. URL:

http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nuccore&id= 13. Mavric Plesko I., Virscek Marn M., Sirca S., Urek G. Raspberry bushy dwarf virus iso late CmGR-2 segment RNA2, complete sequence // GenBank EU796090. 2008. URL:

http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nuccore&id= Об авторах Е.В. Немцова – ассистент, Брянский государственный университет им. академика И.Г. Петровского, elenanemz@mail.ru А.В. Артюхова – аспирант, Брянский государственный университет им. академика И.Г. Петровского, elenanemz@mail.ru.

Е.В. Дроздов – аспирант, Брянский государственный университет им. академика И.Г. Петровского, elenanemz@mail.ru.

В.В. Заякин – докт. биол. наук, проф., Брянский государственный университет им. академика И.Г. Петровского, elenanemz@mail.ru.

И.Я. Нам – докт. биол. наук, проф., Брянский государственный университет им. академика И.Г. Петровского, elenanemz@mail.ru Вестник Брянского госуниверситета №4 (2008) УДК 581.526. ПОЙМЕННЫЕ ГИГРОФИТНЫЕ СООБЩЕСТВА СОЮЗА MAGNOCARICION ELATAE KOCH 1926 В БРЯНСКОЙ ОБЛАСТИ Ю.А. Семенищенков В статье приводятся результаты многолетнего изучения пойменных гигрофитных сообществ cоюза Magnocari cion elatae в долинах рек Судости, Десны в Брянской области. С использованием техники флористической классификации установлено 9 ассоциаций: Caricetum gracilis, Caricetum elatae, Caricetum ripariae, Caricetum rostratae, Caricetum vesicariae, Caricetum vulpinae, Cicuto virosae – Caricetum pseudocyperi, Phalaridetum arun dinaceae, Iridetum pseudacori. Установлена верность видов синтаксонам с использованием статистического – коэффициента. Анализ ценофлоры проведен традиционными методами флористики.

Ключевые слова: флористическая классификация, Браун-Бланке, гигрофитная растительность, Magnocari cion elatae, Брянская область, Южное Нечерноземье России.

Введение Травяная растительность Брянской области в настоящее время достаточно хорошо изучена. Значительную часть ее фитоценотического разнообразия представляют крупноосо ковые и крупнозлаковые преимущественно пойменные гигрофитные сообщества на болотах, по берегам рек и озер. С позиций флористической классификации [23] они объединяются в cоюз Magnocaricion elatae Koch 1926 порядка Magnocaricetalia Pignatti 1953 класса водных и околоводных сообществ прикрепленных ко дну и возвышающихся над водой или прибреж новодных высокотравных гелофитов пресных стоячих или слабопроточных водоемов Phragmitо – Мagnocaricetea Klika in Klika et Novak 1941. Указанные сообщества широко встречаются в Южном Нечерноземье России занимают значительные площади и нередко ис пользуются как сенокосные угодья [4].

Сведения о распространении этих сообществ в Брянской области отмечаются в лите ратуре с 40-х годов ХХ века [6, 11, 13, 15, 16, 19]. Однако наиболее полно они описаны А.Д.

Булоховым [1, 2, 4], который приводит для Юго-Западного Нечерноземья России 5 ассоциа ций союза.

В настоящей статье обобщены результаты многолетнего изучения сообществ cоюза Magnocaricion elatae преимущественно в долинах рек Судости, Десны и их притоков в Брян ской области.

Природные условия района исследования Река Десна – первый по длине и второй по величине бассейна левобережный приток Днепра (рис. 1). Длина реки в пределах Брянской области составляет 413 км при площади водосбора – 27,8 тыс. км2. Гидрографическая сеть в бассейне неравномерна. Общая длина правобережных притоков – 716 км, левобережных – 1313 км. Озерность бассейна Десны со ставляет менее 1 % с преобладанием пойменных озер, заболоченность 1-6 %. Река Судость (208 км) – правобережный второй по величине приток Десны. Бассейн р. Судость на западе граничит с бассейном р. Ипуть, на юго-западе – р. Снов;

площадь его 6,08 тыс. км2. Продол жительность половодья на реках составляет 30-50 дней с максимумом в середине апреля – начале мая [12].

Естественные науки Рис. 1. Долины р. Судости и р. Десны в Брянской области.

Исследуемые поймы рек сложены аллювиальными отложениями мощностью 5-15 м.

Ширина пойм 0,1-4,0 км, высота над урезом воды до 5 м. Преобладают выровненные по верхности сегментных пойм, осложненные болотами и озерами-старицами [12, 22].

Для пойменных местностей характерны пойменные дерновые (песчаные, супесчаные, легкосуглинистые), дерновые глеевые, иловато-торфяные и болотные почвы.

Климат региона умеренно-континентальный с теплым летом и умеренно холодной зимой. Среднегодовая температура 4,7 - 5,1 С;

среднемесячная температура самого холод ного месяца (января) –8,8 - –8,2 С;

самого тёплого месяца (июля) 18,0 – 18,2 С. Среднего довое количество осадков – 580-610 мм. Продолжительность вегетационного периода – 140 145 дней [12].

По флористическому районированию А. Л. Тахтаджяна [18] район исследования при надлежит к Сарматской подпровинции Восточноевропейской флористической провинции.

По комплексному ботанико-географическому районированию по долине Десны в среднем течении проходит условная граница Полесской и Среднерусской подпровинций Восточноев ропейской провинции Европейской широколиственнолесной области [14]. Одновременно долина Десны на северной оконечности Брянской возвышенности считается южной грани цей подтайги [10]. Зональной растительностью этого региона являются широколиственные леса с елью (на севере) и без ели (в южной части) [14].

Большое влияние на распределение травяной растительности оказала проходившая во второй половине XX в. мелиорация земель в долинах рек, результатами которой стали значи тельное изменение водного режима в поймах и, в целом, трансформация местообитаний.

Материалы и методика Флористико-геоботаническое обследование правобережья р. Десны проведено в тече ние полевых сезонов 2002-2008 гг. На основе 61 геоботанического описания с использовани ем техники флористической классификации [23] установлено 9 ассоциаций. Обработка гео ботанических таблиц проведена с использованием пакета JUICE 7.0 [30] и Indicator для MS Excel [5]. Установленные единицы сравнивали с уже известными для Южного Нечерноземья России и других регионов [4, 21, 27, 29 и др.].

Установлена верность видов синтаксонам с использованием статистического – ко эффициента, который выступает двусторонней мерой верности [24, 25]. Кластерный анализ (Ward-метод) проведен с использованием пакета STATISTICA 6.0 на основе матрицы коэф фициента флористического сходства Съеренсена для пар синтаксонов.

Вестник Брянского госуниверситета №4 (2008) Синэкологические оптимумы сообществ по влажности, кислотности и обеспеченно сти минеральным азотом почвы установлены по экологическим шкалам Х. Элленберга [26].

Анализ ценофлоры проведен традиционными методами флористики. Номенклатура сосуди стых растений дана по С. К. Черепанову [20], моховидных – по М. С. Игнатову, О. М. Афо ниной [7].

Характеристика установленных синтаксонов Класс Phragmitо – Мagnocaricetea Klika in Klika et Novak 1941. Диагностические ви ды (д. в.): Alisma plantago-aquatica, Equisetum fluviatile, Galium palustre, Lycopus europaeus, Lythrum salicaria, Phragmites australis, Persicaria amphibia, Rorippa amphibia, Rumex hydrola patum, Scutellaria galericulata, Stachys palustris.

Порядок Magnocaricetalia Pignatti 1953, союз Magnocaricion elatae Koch 1926. Д. в.:

Carex acuta, C. acutiformis, C. riparia, C. rostrata, C. vesicaria, Galium palustre, Mentha arvensis, Phalaroides arundinacea, Poa palustris, Scutellaria galericulata.

Асс. Caricetum gracilis Almquist 1929 (табл. 1, 1). Д. в.: Carex acuta (доминант). Сооб щества занимают глубокие понижения центральных и притерассных пойм с влажными (8,5) нейтральными (6,9) средне обеспеченными минеральным азотом (6,1) перегнойно-глеевыми и иловато-глеевыми почвами. Одна из наиболее широко распространенных ассоциаций в поймах рек.

Облик сообществ определяет Carex acuta, нередко встречаются «чистые» остроосоко вые насаждения в местообитаниях с открытой застойной водой, где отмечаются всего 2-3 ви да сосудистых растений. В менее обводненных местообитаниях обыкновенны Calystegia se pium, Carex vesicaria, Lysimachia vulgaris, Lythrum salicaria. Проективное покрытие 80-100 %.

Среднее видовое богатство 8 видов на 100 м2.

Асс. Caricetum elatae Koch 1926 (табл. 1, 2). Д. в.: Carex elata (доминант). Сообщества распространены в обводненных межгривных низинах в поймах крупных рек на влажных (8,4) нейтральных (7,0) средне богатых минеральным азотом (5,8) преимущественно торфяных почвах.

Сообщества опознаются по доминированию Carex elata высотой 0,5-0,9 м. Положение сообществ, как правило, соответствует наиболее пониженным участкам поймы. В травостое часто присутствует Carex acuta. Проективное покрытие 60-100 %. Среднее видовое богатство 8 видов на 100 м2.

Асс. Caricetum ripariae So 1928 em. Knapp et Staff. 1962 (табл. 1, 3). Д. в.: Carex ri paria (доминант). Сообщества встречаются по берегам водотоков и стариц, как правило, в долинах крупных рек на влажных (8,6) нейтральных (6,9) средне обеспеченных минераль ным азотом почвах (5,9) суглинистых почвах.

Облик мелкоконтурных сообществ определяет Carex riparia 0,5-0,7 м в высоту. Они вытянуты в виде узких полос шириной 0,3-0,6 м вдоль русел водотоков и по берегам водо емов. В травостое обычна Carex acuta. Характерно наличие характерных для нарушаемых сырых местообитаний Agrostis stolonifera, Alopecurus geniculatis, Bidens tripartita. Проектив ное покрытие 50-100 %. Среднее видовое богатство 7 видов на 100 м2.

Асс. Caricetum rostratae (Rbel 1922) (Dagys 1932) Bal.-Tul. 1963 (табл. 1, 4). Д. в.:

Carex rostrata (доминант). Сообщества отмечаются в поймах рек на влажных (8,2) нейтраль ных (6,5) средне богатых минеральным азотом (6,5) иловато-глеевых, суглинистых, торфя ных почвах.

Облик сообществ определяет Carex rostrata. Иногда обильны C. acuta, Glyceria maxima, Filipendula ulmaria. Сообщества встречаются небольшими участками среди сооб ществ других синтаксонов класса. Проективное покрытие 80-100 %. Среднее видовое богат ство 10 видов на 100 м2.

Естественные науки Асс. Caricetum vesicariae Br.-Bl. et Denis 1926 (табл. 1, 5). Д. в.: Carex vesicaria (доми нант). Сообщества отмечаются в поймах рек на влажных (8,3) нейтральных (6,2) средне обеспеченных минеральным азотом (5,4) иловато-глеевых, суглинистых, торфяных почвах.

Облик сообществ определяет Carex vesicaria. Высококонстантны виды союзов Mag nocaricion и Filipendulion (Carex acuta, Filipendula ulmaria, Lysimachia vulgaris, Lythrum sali caria, Stachys palustris). Иногда на территории полесских ландшафтов в сообществах ассо циации на лесных болотах встречаются Calla palustris, Comarum palustris, Menyanthes trifo liata. Проективное покрытие 60-90 %. Среднее видовое богатство 7 видов на 100 м2.


Асс. Caricetum vulpinae Nowinski 1927 (табл. 1, 6). Д. в.: Carex vulpina (доминант).

Сообщества распространены в неглубоких блюдцевидных понижениях в поймах рек, реже – по сырым лесным полянам полесских ландшафтов на влажных (7,3) нейтральных (6,6) сред не обепеченных минеральным азотом (5,7) дерновых глеевых, низинных, торфяных почвах.

Сообщества обычно мелкоконтурные и встречаются в виде «пятен» на фоне сооб ществ других синтаксонов классов Pragmitо – Magnocaricetea и Molinio – Arrhenatheretea.

Carex vulpina чаще всего не является полным доминантом и представлена разреженными особями. Ценофлора насыщена мезофитными и мезо-гелофитными видами: Carex hirta, Cen taurea jacea, Festuca pratensis, Galium aparine, Phleum pratense, Poa palustris, Ranunculus re pens, Vicia cracca. Проективное покрытие 80-100 %. Среднее видовое богатство 13 видов на 100 м2.

Асс. Cicuto virosae – Caricetum pseudocyperi Boer et Siss. in Boer 1942 (табл. 1, 7). Д. в.:

Carex pseudocyperus (доминант). Сообщества изредка встречаются по мелководьям и по бе регам прудов с глубинами 0-0,5 м на сырых (9,1) нейтральных (6,3) достаточно богатых ми неральным азотом (5,9) илистых грунтах.

Облик сообществ определяет Carex pseudocyperus высотой 0,4-0,8 м. Регулярно отме чаются Alisma plantago-aquatica, Carex cespitosa, Equisetum fluviatile, Thypha latypholia. Со общества разреженные, участки с открытой водой занимают плавающие на поверхности Hy drocharis morsus-ranae, Lemna minor, Spirodela polyrhiza. Проективное покрытие 50-80 %.

Среднее видовое богатство 9 видов на 100 м2.

Асс. Phalaridetum arundinaceae Koch ex Libb. 1931 (табл. 1, 8). Д. в.: Phalaroides arundinacea (доминант). Сообщества с доминированием Phalaroides arundinacea, приурочен ные к плоским низинам, западинам в поймах рек и прирусловым валам с влажными (7,6) нейтральными (6,4) средне обеспеченными минеральным азотом (5,6) дерновыми глеевыми, болотно-перегнойными, суглинистыми почвами.

Высокотравные (1,5-2,0 м) сообщества сформированы Phalaroides arundinacea. В со ставе ценофлоры комбинация видов союзов Magnocaricion, Phragmition, а также класса Molinio – Arrhenateretea. Проективное покрытие 80-100 %. Среднее видовое богатство видов на 100 м2.

Асс. Iridetum pseudacori Eggler 1933 (табл. 1, 9). Д. в. Iris pseudacorus (доминант). Со общества изредка встречаются по мелководьям прудов и стариц на суглинистых и глинисто песчаных влажных (8,9) нейтральных (7,0) достаточно богатых минеральным азотом (6,4) грунтах.

Опознаются по доминированию Iris pseudacorus 0,7-1,5 м в высоту, не образующего, как правило, компактных зарослей. Площадь, занимаемая сообществами обычно не превы шает 5-6 м2. По флористическому составу близки к союзу Phragmition, регулярно в них при сутствуют Epilobium parviflorum, Equisetum fluviatile, Leersia oryzoides, Spirodela polyrhiza.

Проективное покрытие 60-80 %. Среднее видовое богатство 12 видов на 100 м2.

В некоторых работах подобные сообщества рассматривают в ранге базального для класса Phragmito – Magnocaricetea [27, 29]. В то же время они четко диагностируются доми нированием Iris pseudacorus и обладают достаточным экологическим своеобразием также, как и большинство известных ассоциаций класса.

Вестник Брянского госуниверситета №4 (2008) Продромус Класс Phragmito – Magnocaricetea Klika in Klika et Novak Порядок Magnocaricetalia Pignatti Союз Magnocaricion elatae Koch Асс. Caricetum gracilis Almquist Асс. Caricetum elatae Koch Асс. Caricetum ripariae So 1928 em. Knapp et Staff. Асс. Caricetum rostratae (Rbel 1922) (Dagys 1932) Bal.-Tul. Асс. Caricetum vesicariae Br.-Bl. et Denis Асс. Caricetum vulpinae Nowinski Асс. Cicuto virosae – Caricetum pseudocyperi Boer et Siss. in Boer Асс. Phalaridetum arundinaceae Koch ex Libb. Асс. Iridetum pseudacori Eggler Все установленные ассоциации четко определяются по доминирующим видам, высту пающим диагностическими. Это демонстрируют высокие достоверные значения Ф коэффициента для доминантов в синтаксонах, что подтверждает их высокое диагностическое значение (табл.). Неслучайно многие синтаксоны гигрофитной пойменной крупноосоковой и крупнозлаковой растительности были установлены еще в начале ХХ века отечественными исследователями на доминантной основе. На фоне сравнительно небольшого количества ви дов в отдельных сообществах (в среднем 7-13 видов) обилие нередко характеризуется низкой выравненностью (значение индекса Шеннона H' = 0,02-1,72), что связано с наличием четко выраженных доминантов.

В ценофлоре союза отмечено 113 видов сосудистых растений в составе 39 семейств.

Лидируют по числу видов семейства Poaceae (13 – 11,5 %), Cyperaceae (13 – 11,5 %), Ranunculaceae (6 – 5,0 %), Polygonaceae (6 – 5,0 %), Lamiaceae (6 – 5,0 %), Asteraceae (6 – 5, %), Fabaceae (4 – 3,0 %), Rubiaceae (4 – 3,0 %), Rosaceae (4 – 3,0 %), Equisetaceae (3 – 2,0 %).

Такой спектр с большим разнообразием видов семейств Poaceae и Cyperaceae в целом соот ветсвует определению союза, объединяющего крупноосоковые и крупнозлаковые гигрофит ные сообщества.

В спектре жизненных форм по К. Raunkier [28] доминируют гемикриптофиты (52 %) с участием геофитов (15 %) и гидрофитов (9 %). Наиболее представительны группы длинно (35 %) и короткокорневищных [17] растений (11 %). Ценофлора носит геломорфный харак тер [9], в ней широко представлены виды геломорфной экобиоморфы и ее вариантов (мезо гело-, гигро-гело, ксеро-гело, гело-мезоморфные) – в сумме 54 %. Среди остальных типов заметно участие мезоморфных видов (10 %).

Азональный характер ценофлоры демонстрирует спектр геоэлементов и полизональ ных групп, в котором доминируют полизональные [3] виды (79 %) с преобладанием субсре диземноморско-бореальной группы (35 %). Показательно большое участие в составе сооб ществ характерных для гигрофитных и гелофитных сообществ болот, сырых и влажных лу гов циркумполярных видов (25 %).

Сообщества данного союза достаточно хорошо дифференцируются от других союзов травяной растительности Судость-Деснянского междуречья (рис. 2). Наибольшее флористи ческое сходство эти сообщества имеют с союзами прибрежноводной растительности Phragmition Koch 1926 порядка Phragmitetalia Koch 1926 и Filipendulion (Br.-Bl. 1947) (Segal 1966) Lohm. ap. Oberd. 1967 порядка Molinietalia Koch 1926. Блоки видов указанных союзов широко представлены в сообществах союза Magnocaricion (табл.).

Естественные науки Рис. 2. Флористическое сходство союза Magnocaricion elatae (8) с другими союзами травя ной растительности Судость-Деснянского междуречья (Ward-метод, евклидовы дистанции).

Обозначения союзов: 1 – Elatini – Eleocharition ovatae, 2 – Equisetetion arvensis, 3 – Potentillion anserinae, 4 – Phragmition, 5 – Scirpion maritimi, 6 – Sparganio – Glycerion, 7 – Oenanthion, 8 – Magnocaricion, 9 – Cicution, 10 – Cardamino – Montion, 11 – Calthion, 12 – Agrostio – Beckmannion, 13 – Filipendulion, 14 – Molinion, 15 – Alopecurion, 16 – Cynosurion, 17 – Scabioso – Poion, 18 – Koelerion glaucae, 19 – Hyperico – Scleranthion, 20 – Festucion valesiacae.

Изучение пойменной гигрофитной растительности будет продолжено. Материалы ис следования будут использованы при составлении кадастра травяной растительности Южного Нечерноземья России.

Таблица Дифференцирующая таблица синтаксонов союза Magnocaricion* Ассоциации 1 2 3 4 5 6 7 8 Количество описаний 8 6 5 8 7 7 6 9 Д. в. ассоциаций (серым цветом выделены значения постоянства с достоверным значением Ф-коэффициента) V31.4 V18.5 IV12.1 V16. Carex acuta III III III. III 100. C. elata s.l.. V.......

V100. C. riparia........

V100. C. rostrata........

II9.6 II6.1 V63. C. vesicaria. II I...

II23.6 V76. C. vulpina I.... III.

V100. C. pseudocyperus........

II10.8 V81. Spirodela polyrhiza... I...

I33.3 II55.3 IV32.1 III14.7 V55.3 V47. Phalaroides arundinacea...

I13.8 I7.7 I10.3 I10.3 V76. Iris pseudacorus....

II47.5 V88. Epilobium parviflorum.......

Д. в. класса Phragmito – Magnocaricetea II12.7 II19.0 IV52. Alisma plantago-aquatica.... I.

14.8 11. I33.3 IV49. Equisetum fluviatile II II. I. I.

I33.3 I5.1 II32.1 I2.4 I2.4 V66. Lycopus europaeus I..

III13.2 II5.2 II3.2 III7.5 III13.2 III10. Galium palustre. I II 10.5 30. III4.9.2 III4.9 III6 III9. Lythrum salicaria II III. IV.

II23.3 II18.9 II23.3 III27. Glyceria maxima. I...

Вестник Брянского госуниверситета №4 (2008) II9.3 III13.1 III17.9 II24. Persicaria amphibia.. I.

5..- 27. II23.0 III39. Rumex hydrolapatum I... II.

1. I4.4 IV48.5 III27. Scutellaria galericulata I I I...

II9.9 I4.6 III43.4 II7. Stachys palustris.....

.- I42. Rorippa amphibia.......

.- I42. Butomus umbellatus.......

.- I35. Phragmites australis.......

Д. в. порядка Molinietalia и класса Molinio – Arrhenatheretea IV21.1 IV27.5 IV24. Filipendula ulmaria II. II II I.

III62. Centaurea jacea........

III31.3 II6. Thalictrum lucidum... I. III.

II21.7 IV27.4 IV34. Poa palustris I... III.

II26.2 II30. Stellaria palustre..... II.

II15.7 I3.1 III36. Potentilla anserina.... I.

I6.8 IV72. Achillea millefolium......

I6.6 III54. Phleum pratense..... I.

I18.7 I11.8 I14. Galium boreale......

III62. Stellaria palustris........

III62. Festuca pratensis........

I1.8 IV70.6 III31. Thypha latifolia I.....

II9.5 II18.1 III42. Ptarmica cartilaginea.... I.

I10.7 II41. Kadenia dubia..... I.

I18.0 II37. Coccyganthe flos-cuculi.......


I33. Galium uliginosum........

I33. Lathyrus palustris........

II6.8 II15.0 I1.9 II19. Myosotis palustris I I. I.

I11.3 I23.6 I11. Caltha palustris......

I1.5 II31.5 II20. Veronica longifolia.... I.

I25.1 I20. Thalictrum flavum.......

I17.1 I24. Lathyrus pratensis..... I.

II44. Ranunculus flammula...... II.

I23.6 I35.7 II31. Lysimachia nummularia......

II32.6 III46. Vicia cracca.. I.. III.

III35.1- II24. Glechoma hederacea. I. I. I.

II16.6 IV48.8 II4. Amoria repens... I I.

I5.4 II11.8 IV55. Alopecurus pratensis.. I. II.

I33. Symphytum officinale........

II19.0 III47. Mentha arvensis.. II. II..

Lysimachia vulgaris....... I I35. Amoria hybrida........

Д. в. классов Lemnetea и Potametea II19.7 III48.1 II10. Lemna minor..... I Hydrocharis morsus- 30.3 1.4 41. III30... II. I. III.

ranae Прочие виды 14. II14.1 II18.2 II11. Galium aparine II.....

2. II24.4 III28. Urtica dioica I I. I I. II II7.0 III10.6 IV56. Carex cespitosa.....

IV41.5 II3.2 III19. Calystegia sepium I.. I I.

I18.0 II37. Rumex crispus.......

I19.5 II33.7 III36. Acorus calamus......

I8.0 I10.2 II29. Epilobium hirsutum.... I.

I12.6 II40. Naumburgia thyrsiflora.......

II10.7 II41. Thyselinum palustre..... I.

I1.9 I3.7 II24.2 II19. Scirpus sylvaticus... I.

II22.4 III46. Comarum palustris.......

I16.0 I3.6 III42. Deschampsia cespitosa... II.

II34.4 III46. Glyceria fluitans.......

I9.5 IV73. Oenanthe aquatica.......

II34.4 III46. Agrostis stolonifera.......

I15.8 I9. Scutellaria hastifolia..... II.

Естественные науки I14.0 II36. Calamagrostis canescens.......

II13.1 1. IV59. Cirsium arvense.... I..

I33. Eupatorium cannabinum........

I4.9 III60. Persicaria hydropiper..... I.

IV88. Bidens tripartita........

I38. Plagiomnium cuspidatum........

I38. Bistorta major........

I25.1 I20. Geum rivale.......

II50. Menyanthes trifoliata........

.- III68. Ranunculus scleratus.......

II44. Rumex confertus...... II.

I23.6 II31. Salix alba juv........

II60. Alopecurus geniculatus........

I16.4 II35. Salix cinerea juv........

II44.7 I35. Beckmannia eruciformis..... II.

II47. Scirpus radicans........

II47. Utricularia vulgaris........

II47. Drepanocladus fluitans........

I35. Carex hirta........

I35. Cerastium holosteioides........

II47. Sparganium emersum........

II47. Juncus conglomeratus........

I31. Impatiens grandulifera...... I.

I31. Geranium pratense...... I.

I31. Equisetum palustre...... I.

I31. Equisetum pratense...... I.

I35.7 III58. Solanum dulcamara.......

I35. Alnus glutinosa juv.........

I35. Symphytum officinale........

I35. Carex omskiana........

I35. Calla palustris........

I35. Callitriche palustris........

I35. Carex nigra........

I35. Ranunculus acris........

III58. Leersia orizoides........

Cicuta virosa........ I Sagittaria sagittifolia........ I Galium rivulare........ I Salix triandra (0,3 м)........ I Scrophularia umbrosa........ I *Постоянство видов показано римскими цифрами и установлено по пятибалльной шкале: I – до 20 % описаний, II – 21-40 %, III – 41-60 %, IV – 61-80 %, V – 81-100 %. Верхний индекс – значение Ф-коэффициента.

Пункты описаний: 1 – асс. Caricetum gracilis: пойма р. Рудка у с. Полужье (Выгоничский р-н), 12.07.2005;

пойма р. Десны у д. Скрябино (Выгоничский р-н), 10.07.2005;

пойма р. Судость у пос. Жирятино (Жирятинский р-н), 20.07.2005;

2 – асс. Caricetum elatae: пойма р. Десны у д. Мякишево (Выгоничский р-н), 31.06.2006;

пойма р. Десны у д. Сосновка (Выгоничский р-н), 18.07.2006;

3 – асс. Caricetum ripariae: берега р.

Десны на участке с. Кветунь – д. Удолье (Трубчевский р-н), 13.08.2005;

4 – асс. Caricetum rostratae: пойма р.

Десны у с. Переторги (Выгоничский р-н), 5.07.2005;

пойма р. Судость у c. Суворово (Погарский р-н), 14.07.2005;

пойма р. Десны у с. Селище (Трубчевский р-н), 24.07.2005;

5 – асс. Caricetum vesicariae: пойма р. Судость у c.

Суворово (Погарский р-н), 14.07.2005;

пойма р. Десны у с. Переторги (Выгоничский р-н), 5.07.2005;

6 – асс.

Caricetum vulpinae: пойма р. Десны у с. Переторги (Выгоничский р-н), 5.07.2005;

пойма р. Десны у д. Скрябино (Выгоничский р-н), 10.07,2005;

пойма р. Десны у д. Мякишево (Выгоничский р-н), 31.06.2006;

7 – асс. Cicuto virosae – Caricetum pseudocyperi: берега пруда у д. Кисилевка (Выгоничский р-н), 11.08.2005;

берега пруда у с.

Новоселки (Брянский р-н), 28.08.2005;

берега озера у д. Лукин (Погарский р-н), 15.08.2006;

8 – асс. Phalaride tum arundinaceae: пойма р. Десны у д. Скрябино (Выгоничский р-н), 10.07.2005;

берега ручья у д. Бурачовка (Выгоничский р-н), 25.07.2005;

берега пруда у пос. Тиганово (Брянский р-н), 9.08.2005;

пойма р. Рожок у с Усошки (Почепский р-н), 29.07.2005;

9 – асс. Iridetum pseudacori: берега пруда у с. Страшевичи (Жирятинский р-н), 7.08.2007;

берега старицы р. Десны в г. Брянске, 9.09.2008. Автор Ю.А. Семенищенков.

In the article the results of many-years studies of flood-plain hygrophytic communities in the Sudost-river and Desna river walleyes in Bryansk region are done. According to Braun-Blanquet approach 9 associations are established:

Caricetum gracilis, Caricetum elatae, Caricetum ripariae, Caricetum rostratae, Caricetum vesicariae, Caricetum Вестник Брянского госуниверситета №4 (2008) vulpinae, Cicuto virosae – Caricetum pseudocyperi, Phalaridetum arundinaceae, Iridetum pseudacori. The species fidelity to the syntaxon is established with use of the statistical Ф-coefficient. The coenophlors analysis is realized with the traditional floristic approaches.

The key words: floristic classification, Braun-Blanquet, hygrophytic vegetation, Magnocaricion elatae, Bryansk re gion, South Nechernozemje of Russia.

Список литературы 1. Булохов А.Д. Основные типы пойменных лугов р. Десны и экологическая стратегия их использования [Текст] / Булохов А.Д., Булохова Н.А. // Долина Десны: природа и природопользо вание: Сб. науч. тр. М.: МФГО СССР, 1990 а. С. 72-83.

2. Булохов А.Д. Синтаксономия травянистой растительности южного Нечерноземья. 1.

Класс Phragmiti – Magnocaricetea Klika in Klika et Novak 1941 [Текст] / Булохов А.Д. // Ред. ж.

«Биол.науки». М., 1990 б. 42 с. Деп. в ВИНИТИ 01.08.90, № 4429-В90.

3. Булохов А.Д. К проблеме ботанико-географического анализа флоры зонально азональной растительности [Текст] / Булохов А.Д. // Экология и охрана биологического разно образия: Сб. науч. тр. Брянск. Изд-во БГУ, 2000. С. 21-22.

4. Булохов А.Д. Травяная растительность Юго-Западного Нечерноземья России [Текст] / А.Д. Булохов Брянск, 2001. 296 с.

5. Булохов А.Д. Компьютерная программа INDICATOR и методические указания по ее использованию для экологической оценки местообитаний и анализа флористического раз нообразия растительных сообществ [Текст] / А.Д. Булохов, Ю.А. Семенищенков. Брянск, 2006. 30 с.

6. Виноградов И.С. Растительные ассоциации заливных лугов Восточного Полесья (по наблюдениям в поймах р. Ипути и Десны) [Текст] / Виноградов И.С. // Ученые зап. Сев. Осетинск. пед. ин-та. 1941. Т.2. №2. С. 3-40.

7. Игнатов М.С. Список мхов территории бывшего СССР [Текст] / М. С. Игнатов, О.

М. Афонина. Arctoa. Т. 1. № 1-2. 1992. С. 1-85.

8. Красная книга Брянской области. Растения. Грибы [Текст]. Брянск: ЗАО «Изда тельство «Читай-город», 2004. 2004 с. 272 с.

9. Лавренко Е.М. Об основных направлениях изучения экобиоморф в растительном покрове [Текст] / Лавренко Е.М., Свешникова В.М. // Основные направления современной геоботаники. Л, 1968. С. 10-15.

10. Ландшафтная карта СССР: Масштаб 1:4000000 [Текст] / Под.ред. А.Г. Исаченко.

М.: ГУГК., 1988.

11. Луга Нечерноземья [Текст] / Под ред. А.Г. Воронова. М., 1984. 160 с.

12. Природа и природные ресурсы Брянской области. Учебное пособие для учащихся и студентов [Текст] / Под ред. Л. М. Ахромеева. Брянск: Изд-во Брянского гос. пед. ин-та., 2001 – 216 с.

13. Радченко Л.А. Синтаксономия как основа стратегии охраны растительного покро ва ландшафтов лессовых равнин (в пределах Брянской области) [Текст]: Автореф. дис….канд.

биол. наук: 03.00.05 / Л. А. Радченко;

Брянский пед. ин-т. Брянск, 1999. 24 с.

14. Растительность Европейской части СССР [Текст] / Под ред. С. А. Грибовой, Т.

И. Исаченко, Е. М. Лавренко. Л.: Наука, 1980. 429 с.

15. Рыбаков Р.Т. Растительность поймы реки Десны от г. Брянска до границы УССР // Тр. Белорус. с-х акад. [Текст] / Р. Т. Рыбаков. М., 1951. Т. 17. С. 75-90.

16. Семенищенков Ю.А. Синтаксономия естественной травяной растительности Су дость-Деснянского междуречья (Брянская область). Класс Phragmito – Magnocaricetea [Текст] / Семенищенков Ю.А. // Успехи современного естествознания. 2006 г. №9. С. 103-105.

17. Серебряков И Г. Экологическая морфология растений [Текст] / И.Г. Серебряков.

М.: Высшая школа, 1962. 378 с.

18. Тахтаджян А.Л. Флористические области Земли [Текст] / А. Л. Тахтаджян. Л:

Наука, 1978. С. 41-43.

Естественные науки 19. Толчаин Г.А. Растительный покров Брянской области (краткий очерк) // Уч. зап.

Новозыбковского пед. ин-та [Текст] / Толчаин А. Л. Смоленск, 1967. Т. 6. Сер. биол. С. 29 49.

20. Черепанов С.К. Сосудистые растения России и сопредельных государств [Текст] / С.К. Черепанов. СПб.: Мир и семья, 1995. 992 с.

21. Чемерис Е.В. Растительный покров истоковых ветландов Верхнего Поволжья [Текст] / Е.В. Чемерис. Рыбинск: ОАО «Рыбинский Дом печати», 2004. 158 с.

22. Шевченкова Т.Ф. Геология Брянской области [Текст] / Т.Ф. Шевченкова. Брянск, 2001. 34 с.

23. Braun-Blanquet J. Pflanzensoziologie [Text] / J. Braun-Blanquet. 3. Aufl. Wien;

Т.-Y., 1964. 865 S.

24. Chytr M. Determination of diagnostic dpecies with statistical fidelity measures [Text] / Chytr M., Tich L., Holt J., Botta-Dukt Z. // J. Veg. Sci., 2002. Vol. 13. P. 79-90.

25. Chytr M. Diagnostic, constant and dominant species of vegetation classes and alliances of the Czech Republic: a statistical revision [Text] / Chytr M., Tich L. // Folia. CR: Masaryk University, 2003. 234 p.

26. Ellenberg H. Zeigerwerte von Pflanzen in Mitteleuropa [Text] / H. Ellenberg, H.E. Weber, R. Dull, V. Wirth, W. Werner, D. Paulssen. 2 Auflage. 1992. 258 S.

27. Oberdorfer E. Pflanzensociologische Exkursionsflora [Text] / E. Oberdorfer. – Verlag Stuttgart: Ulmer, 1994. 7. Aufl. 1050 S.

28. Raunkier K. The life forms of plants and statistical plant geography being the collect pa pers [Text] / K. Raunkier. Oxford, 1936. 632 p.

29. Stani Z. Marchland vegetation of the class Phragmito – Magnocaricetea in Croatia // Biologia, 2007. Vol. 62/3 [Text] / Stani, Z. Bratislava. P. 297-314.

30. Tichy L. JUICE, software for vegetation classification [Text] / Tichy L. // J. Vegetation Sci., 2002. Vol. 13. P. 451-453.

Об авторе Ю.А. Семенищенков – канд. биол. наук, ст.преп., Брянский государственный универ ситет им. академика И.Г. Петровского, yuricek@yandex.ru УДК 553.068,5 + 553. ВИДОВОЕ РАЗНООБРАЗИЕ ДОЖДЕВЫХ ЧЕРВЕЙ В ИРЛАНДСКИХ НАЦИОНАЛЬНЫХ БОТАНИЧЕСКИХ САДАХ (г.ДУБЛИН) Г.С. Шутенко, И.Л. Прокофьев, Л.С. Жирина Коллекция Национальных Ботанических Садов Ирландии (National Botanic Gardens of Ireland, Dublin) включает виды растений со всего мира, в них воссозданы уникальные микроэкосистемы. В процессе формирования кол лекций растения транспортировались в Ирландию с неповрежденной корневой системой и с небольшим коли чеством местной почвы. Это способствовало переносу дождевых червей из различных географических областей в Ботанические Сады Ирландии. Целью работы было изучение видового состава дождевых червей Ботаниче ских Садов Ирландии. Работы проводились в июне - августе 2008 года. На каждой пробной площади было взя то 2 почвенных блока (2525 см) в разных точках. В результате исследований было обнаружено 12 видов дож девых червей (Семейство Lumbricidae) на открытом воздухе, из которых один вид Dendrobaena attemsi (Michaelsen, 1902) ранее был найден в Ирландии только однажды. Найдено также 3 экзотических вида дожде вых червей в пальмовой оранжерее (Семейство Megascolecidae).

Ключевые слова: Ирландия, дождевые черви, биоразнообразие, ботанические сады.

Вестник Брянского госуниверситета №4 (2008) Одно из наиболее перспективных направлений современной экологии - исследования сообществ и антропогенного влияния человеческой деятельности на экосистемы. Почва – одна из сред обитания, которая изучена недостаточно [1]. Люмбрикофауна вносит значи тельный вклад в ее развитие. Многие ученые XVIII-XIX веков, например, Ч. Дарвин, А.

Брем, В. Докучаев и другие занимались подобными исследованиями. Уже в XX столетии они обратили особое внимание на дождевых червей, которые являются одним из самых важных компонентов почвы, и влияют на развитие экосистем. В Ирландии тема исследования дожде вых червей также актуальна. Такие ученые как Donald C.F. Cotton, O. Schmidt, E. Rota про вели исследования отдельных экосистем в некоторых регионах страны [4,11].

Дождевые черви важны в почвенном сообществе, т.к. они способны изменять среду обитания или даже создавать новую, поэтому их еще называют "инженерами экосистемы" [10]. Они увеличивают почвенные поры, когда строят свои ходы и норы;

транспортируют почву и органический материал;

размельчают органический материал, что является первым шагом в формировании плодородных почв;

обеспечивают питательными веществами расте ния (например, увеличивают количество фосфора);

переносят семена в различных слоях поч вы;

увеличивают разнообразие и улучшают деятельность микробного сообщества, обеспечи вая питательными веществами.

Эти действия улучшают структуру почвы, ее водопроницаемую способность [7,14,15] часто приводят к формированию гумусового горизонта на поверхности почвы (главным об разом в лесных экосистемах,[5,8]), меньше в садах или поле(e.g., [2]). Дождевые черви могут влиять на эрозию, удаляя почвенную подстилку, которая защищает ее от эрозионного воз действия дождя [6].

Разновидности дождевого червя можно классифицировать по трем морфо экологическим критериям: Epigeic, Anecics, Endogeic [3,6,9]:

Epigeics. Обитают в верхних слоях почвы богатых органическими веществами и питаются ими в больших количествах, типичны в подстилке лесных почв (частично на коре дерева). Разновидности, объединяемые этим классом, лишь иногда опускаются в минераль ные слои почвы. Они подвержены климатическим колебаниям и давлению хищников, а так же имеют тенденцию быть маленькими, с быстрой сменой поколений.

Anecics. Под этим названием объединяются разновидности, которые строят по стоянные вертикальные норы, проникающие глубоко в почву (до 3 м). Они играют очень важную роль в формировании почвы, а также ферментации органических веществ. Это дож девые черви большого размера и темно-бордового цвета, они способны быстро уползти при надвигающейся опасности, но обычно им свойственно медленное перемещение. Основными видами в этом классе являются Lumbricus terrestris (Linnaeus, 1758) и Aporrectodea longa (Ude, 1885). Последние известны как отличная приманка для рыбы, в первую очередь благо даря своим размерам, и, благодаря этому своему свойству, активно используются в коммер ческих целях.

Endogeics. Представители этого класса предпочитают обитать в почве менее насыщенной органическими веществами, а в рацион входит большее количество минераль ных веществ. Они строят непрерывно разветвляющиеся норы, как правило, горизонтальные, и они, очевидно, не являются главным звеном в преобразовании органики, но играют очень важную роль в формировании почвы. Они непрерывно смешивают и проветривают почву, а также помогают в разложении корней деревьев.

Коллекция Национальных Ботанических Садов Ирландии (National Botanic Gardens of Ireland, Dublin) включают более 17 000 видов растений со всего мира. Здесь собраны уни кальные микроэкосистемы, и это реальная возможность изучить различные виды дождевых червей на этой небольшой территории в 19,5 га.

Целью наших исследований было изучение видового состава дождевых червей в На циональных Ботанических Садах, Дублин.

Основные задачи включают:

Естественные науки o Рассмотрение фауны дождевых червей Национальных Ботанических Садов в отобранных типах растительности (3 на открытом воздухе, 1 в оранжереях);

o определение обилия дождевых червей и структуру сообщества на каждой пробной площади;

o сравнение структуры сообщества в зависимости от растительности;

o поиск ранее не зафиксированных или экзотических дождевых червей.

Материалы и методы Материалом для статьи послужили результаты исследований, проведенных нами на отобранных пробных площадях в Национальных Ботанических Садах, расположенных в г.Дублин, Ирландия (52 ° 22’ с. ш, 06°16’ з. д.). Площадь: 19,5 га (приблизительно 48 акров).

Почва песчаного и суглинистого механического состава, обогащенная известью, ледниково го и аллювиального происхождения;

pH 7,5;

хороший дренаж. Количество осадков 724 мм (среднегодовые данные, 1951-1980). Средняя температура в январе + 1.7°C, в июле + 19.3°C [13].

Пробные площади имеют неодинаковую растительность и почву. Одна пробная пло щадь расположена в оранжереях. На каждой пробной площади мы берем 2 почвенных блока (2525 см) на различных участках.

Осуществление выборки дождевых червей проводилось в течение 10-недельного пе риода в конце июня-августа в 2008 г. Методы, отобранные для собирания дождевых червей, учитывают специфику Национальных Ботанических Садов, т.к. все произрастающие там растения представляют собой огромную ценность и не могут быть повреждены. Для отбора дождевых червей мы использовали метод ручной разборки беспозвоночных из почвенных проб площадью 0,25 м2. Дождевых червей помещали в пластмассовые банки и перевозили в лабораторию. В лаборатории производили подсчет количества особей и взвешивали для оп ределения биомассы.

Дождевые черви были разделены на два класса возраста ювинильные и зрелые осо би – в зависимости от развития пояска, который у зрелых дождевых червей формирует хо рошо развитую полосу вокруг долей миделя. Ювинильные особи не имеют хорошо выра женного пояска и пубертатных валиков. Зрелые дождевые черви были подвергнуты эвтана зии в 4%-ном растворе формальдегида, после чего вымыты и сохранены в алкоголе.

Определение видов дождевых червей проводилось с использованием таксономического клю ча R. W. Sims and B. M. Gerard (1999). В виду того, что поясок (главная внешняя особенность, используемая в идентификации дождевых червей) полностью выражен только у зрелых осо бей, дождевые черви ювинильного класса не были идентифицированы. Экземпляры без го лов были включены только в исследования биомассы. Для статистической обработки резуль татов использовался MS Office Excel 2003.



Pages:     | 1 |   ...   | 3 | 4 || 6 |
 





 
© 2013 www.libed.ru - «Бесплатная библиотека научно-практических конференций»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.