, , ,


-  >> 
Pages:     | 1 |   ...   | 16 | 17 ||


-- [ 18 ] --

, , -, (Chuiko et al., 1997). , 15-20 : , 12-14. , . 1988 1989 . (p0.05) 1988 . 1989 ., , . , , 1989 . , . , . 1988-89. , . ( .. ) : 1989-90 . ( 30-40 ) 1987 . , , , 1986-87. , . , , .

, () (60 ) (Oreochromis mossambicus Peters, 1852) , ( ., 2001). 60 . , , , . , . - .

, , : , , , . -, - .

1. K.T. . : , 1983. 233 .

2. .., .. (Esox lucius L.) // . . .

. 2005. .41. 5. .426-429.

3. .. . : , 1991. 320 4. .., .. (Perca fluviatilis L.) // .: . - .. :

, 1989. .27-38.

5. .., .., .., .. Acipenser rutheus Linneaus // . 2011. 7. .39-43.

6. . ., . ., . ., . . Oreochromis mossambicus (Peters, 1852) , // . . . 2001. 3. .72-79.

7. .. - . ., 1972. 367 .

8. Adams S.M. Status and use of biological indicators for evaluating the effects of stress on fish // In: Adams S.M. (Ed) Biological indicators of stress in fish. American Fishery Society Symposium 8. Bethesda: AFS, 1990. P.1-8.

9. Chuiko G.M., Zhelnin Y.Y., Pod'gornaya V.A. Seasonal fluctuations in brain acetylcholinesterase activity and soluble protein content in roach (Rutilus rutilus L): a freshwater fish from Northwest of Russia // Comp.

Bioch. Physiol. 1997. V.117C. No 3. P. 251-257.

10. Heath A.G. Water pollution and fish physiology. Boca Raton NY London Tokyo: Lewis Publishers, 1995. 359 p.

11. Pavlov D.F. Brain acetylcholinesterase activity in relation to induced reproductive activity in Mozambique tilapia (Oreochromis mossambicus Peters) // Comp. Biochem. Physiol. 1994. V. 109A. N2. P. 231- 12. Pavlov D.F., Chuiko G.M., Shabrova A.G. Adrenaline Induced Changes of Acetylcholinesterase Activity in the Brain of Perch (Perca fluviatilis L.) // Comp. Biochem. Physiol. 1994. V. 108C. N 1. P. 113-115.

13. Thomas P. Molecular and biochemical responses of fish to stressors and their potential use in environmental monitoring // In: Adams S.M. (Ed) Biological indicators of stress in fish. American Fishery Society Symposium 8. Bethesda: AFS, 1990. P.9- 14. Wendelaar Bonga S.E. The stress response in fish // Physiological Reviews. 1997. V.77. N3. P.591-625.


Role of cholinergic system in stress response and adaptation of fish to different environmental factors is analyzed. It is shown fish cholinergic system is involved in the secondary stress responses of fish to action of various stressors such as injection of exogenous adrenaline and dexamethasone, specific and nonspecific toxicants, handling, spawning, and season fluctuations of the environmental factors. However further investigations should be undertaken to study fine mechanisms of such influences and relationships between primary hormonal and secondary cholinergic stress responses and their connection with responses of whole organizm.

, - - (SALMONIDAE) (COREGONIDAE) .. , .. , .. , .. , .. , . , mchurova@yandex.ru . , , , , . , , . , , . , , - / . , , , , (Overturf, Hardy, 2001;

Imsland et al., 2006;

Chcharo, Chcharo, 2008). - .

, , / (Salmonidae) (Coregonidae) .

(Salmo Salar Linnaeus, 1758;

, -), (oregonus lavaretus (Linnaeus, 1758);

), (oregonus albula (Linnaeus, 1758);

. ), (Parasalmo mykiss, Walbaum, 1792);


. , ( ), - (). +, Na+, Ca+, SO42-, HCO3, ( 645 /), (1,34 /), ( 8,5) ( 2007).

. (,, (,, -6- (-6-,, 1-- (1 , (, 1980). ( Beck (, , 1976). (, 1.9..1.) (Smith, 1955). ( , 1984). (MyHC) (-). . .

- . - - : , (. 1). . , . , .

1. , , MyHC, / (AC) / MyHC n r r r r r () r () r () r () (AC) (AC) (AC) (AC) 0+ 25 0,56* 0,55* 0,73* 0,67* 0,74* 0,73* 0,48* 0,46* 1+ 25 0,60* 0,62* 0,58* 0,53* 0,80* 0,71* 0,67* 0,57* 2+ 10 0,69* 0,70* 0,79* 0,84* 0,78* 0,77* -0,44 -0, 2+ 9 0,86* 0,75* 0,51* 0,79* 0,55* 0,82* -0,62 -0, 3+ 9 0,71* 0,73* 0,46* 0,78* 0,82* 0,92* 0,84* 0,62* 1+ 20 0,84* 0,75* 0,68* 0,73* - - 0,69* 0,77* 2+ 18 0,74* 0,65* 0,50* 0,65* - - 0,30 0,65* 3+ 15 0,44* 0,41 0,31 0,40* - - -0,45 -0, 1+ 20 0,65* 0,78* 0,45* 0,69* 0,71* 0,72* 0,56* 0,49* 2+ 15 0,52* 0,51* 0,53* 0,64* 0,82* 0,78* 0,50 0, : * - p 0, (MyHC) (. 1).

50% . MyHC (Overturf, Hardy, 2001;

Imsland et al., 2006), , . , .

, / . , (Peragon, 2001;

Vinagre, 2008). / (. 1). , , .

1- -6- , , , , (. 2). , , , . .

() .

2. -6-, 1- (AC) -6- 1- n r r r () r () (AC) (AC) 1+ 25 0,74* 0,73* 0,72* 0,73* 2+ 10 0,67* 0,74* 0,62* 0,75* 2+ 9 0,75* 0,82* 0,82* 0,64* 3+ 9 0,65* 0,89* 0,77* 0,89* 1+ 20 0,55* 0,69* 0,50* 0,64* 2+ 18 0,59* 0,73* 0,53* 0,65* 3+ 15 0,59* 0,78* 0,54 0,69* 1+ 20 0,53* 0,87* 0,49* 0,54* 2+ 15 0,34 0,93* 0,41 0,75* * - p 0, ( 23%, p0,05) ( 22%, p0,05) . , .

, : (r=0,82, p0,05), (r=-0,71, p0,05). , , . / , , 0,610,07, 1,090,05 p0,05. , (Mankiewicz-Boczek et al., 2010). , . - , , , . , , / (. 3). , , , , . (. 3), .

, , -6- , , - . , -6-, 1- , .

3. (y) R n r 9 y = 0,021x - 0,093 0,53 0,73 0, 7 y = 0,051x - 1,133 0,74 0,86 0, 9 y = 0,741x + 70,23 0,61 0,78 0, 7 y = -1,253x + 235,6 0,30 -0, 9 y = 0,0071 + 0,51 0,38 0,62 0, / 7 y = 0,015x - 0,459 0,70 0,83 0, 9 y = 0,015x - 0,70 0,84 0,92 0, MyHC 7 y = 0,037x - 1,656 0,55 0,74 0, , , , , -6- 1- , MyHC , , , , ( ). , . ( /) - , , .

11-04-00167-, -1642.2012.4, - 2009-2013 . ( ..

02.740.11.0700, .. 14.740.11.1034).


.., .. . : ,1976. 311 .


.. . .: , 1980. 272 .


., ., . . 3.

. .: , 1984. 480 .

C . 1998-2006 .


: . . , 2007. 210 .

Chcharo M.A., Chcharo L. RNA:DNA ratio and other nucleic acid derived indices in marine ecology 5.

// Int J Mol Sci. 2008. V.9. P.1453-1471.

6. Imsland A.K., Le Francois N.R., Lammare S.G., Ditlecadet D., Sigurosson S., Foss A. Myosin expression levels and enzyme activity in juvenile spotted wolfish (Anarhichas minor) muscle: a method for monitoring growth rates // Can J. Fish Aquat. Sci. 2006. V.63. P.1959-1967.

7. Mankiewicz-Boczek J., Kaczkowski Z., Godowska M., Zalewski M. RNA/DNA ratio as an indicator of the impact of long-term accumulative contamination for the assessment of river degradation - a pilot study // Ecohydrology and Hydrobiology. 2010. P I-VIII. URL:

http://versita.metapress.com/content/c906680500771684/ ( : 15.03.2011) 8. Overturf K., Hardy R. Myosin expression levels in trout muscle: a new method of monitoring specific growth rates for rainbow trout Oncorhynchus mykiss (Walbaum) on varied planes of nutrition // Aquat. Res. 2001. V.32. P.315-322.

9. Peragon J., Barroso J.B., Garcia-Salguero L., Higuera M., Lupianez J.A. Growth, protein-turnover rates and nucleic-acid concentrations in the white muscle of rainbow trout during development // Int. J. Biochem. Cell Biol. 2001. V.33. P.12271238.

10. Vinagre C., Fonseca V., Maia A., Amara R., Cabral H. Habitat specific growth rates and condition indices for the sympatric soles Solea solea (Linnaeus, 1758) and Solea senegalensis (Kaup, 1858), in the Tagus estuary. Portugal, based on otolith daily increments and RNA-DNA ratio // Journal of Applied Ichthyology. 2008. V.24. P.163-169.

CORRELATION OF METABOLIC ENZYMES ACTIVITY, RNA/DNA RATIO AND MYOSIN GENE EXPRESSION WITH BODY SIZE OF FISH OF TWO FAMILIES SALMONIDAE AND COREGONIDAE M.V. Churova, O.V. Mescheryakova, A.E. Veselov, O.P. Sterligova, N.N. Nemova The study was designed to elucidate the relationship of several biochemical parameters with weight and length of fish. The objects under study were salmon, whitefish and rainbow trout of different age group. The positive correlation of fish sizes with activity of cytochromre c oxidase, lactate dehydrogenase, aldolase in white muscle, activity of glucose-6-phosphate dehydrogenase and 1-glycerophosphate dehydrogenase in liver, RNA/DNA ratio and expression of myosin heavy chain gene in white muscle were revealed. There were differences in analyzed parameters between whitefish inhabiting the tailing dump of the iron mining and ore dressing mill and the non affected lake.

..1, ..2, .. 1- . .. , 2- . .. , E-mail: zabel@ibiw.yaroslavl.ru . , ( ). , , : ( , ) ( ). (, , 1989;

., 2004). , () ( , -).


, , .. (, 2004;

, 1991).

, , , - . in vitro. , , .

, , , , (, , 2003). in vitro .

1+, 14.50.9 78.84.4 , . .. . , 26 30 . () (). in vitro , 1;



0.05. (0.65%). 1% - . ( ., 2009).

, , 96 15 - .

100 , 4 :

I - , II - 1\3 , III - 2\3 , IV - 2\3.

, () () :

= (II+III+IV)\100, II, III IV .

= (0*I +1*II+2*III+3*IV)\100.

Statistica 6.0 Excel .

, in vitro. , , , (. 1).

% 0.05 0.1 0.5 1 dCl . 1. in vitro. - ;

- .

( ), , , , , . , , , , , , , .

, , , . (. 2).


1, 0, 0, 0, 0, 0.05 0.1 0.5 1 CdCl . 2. in vitro. - ;

- .

0.05 , 0.1 0.5 , 1 . , , , . .

, . C- (De Smetet al., 2001), (Thuvander, 1992), ( ., 2009). : Cd Pb Cu Hg.

, , (, 2007).

in vivo ( ., 2009).

, , , , , , .


1. .., .. . , 1989. 158 .

2. .., .., .. ( ). /: - , 2004. 312 .

3. .. // - . -. . - ., - - . 2007. . 23-27.

4. .., .. -- () // . . 2003. . 123. 4. . 411-418.

5. .., .., .. Perca fluviatilis (Perciformes, Percidae) // . 2009. . 49, 1. . 117-124.

6. .., .., .., .. // . , 2009. . 10, 1(37). .81-91.

7. .. , . /, 2004.-270.

8. .. . , 1991 154 .

9. De Smet H., De Wachter B., Lobinski R., Blust R. Dynamics of (Cd, Zn)-metallothioneins in gills, liver and kidney of common carp Cyprinus carpio during cadmium exposure // Aquat. Toxicol. 2001.

V. 52. 2. P. 269281.

10. Thuvander A. 1992. The immune system of salmonid fish: establishment of methods for assessing effects of aquatic pollutants on the immune response // Dissertation Abstr. Int. V. 52. 2. P. 0216.

ADAPTIVE CAPACITY NONSPECIFIC CELL PROTECTION UNDER THE INFLUENCE OF CADMIUM IONS Shavel N.A.1, Zabotkina E.A.2, Serednyakov V.E. 1 - Yaroslavl State University. PG Demidov, Yaroslavl, 2 - ID Papanin`s Institute for Biology of Inland Waters of RAS, 152 742. Borok, Yaroslavl region, E-mail:

zabel@ibiw.yaroslavl.ru The results of the investigation of various concentrations of cadmium chloride on the phagocytic activity of peripheral blood neutrophils of carp in vitro experiments using NBT-test.

- STRONGYLOCENTROTUS NUDUS .. 1,2, .. 2,3, .. 1, .. 3, .. .

.. , , , , .. , , E-mail: eshamshurina@rambler.ru - , - . - - , .

, - -, , (Dommett et al., 2006).

, , , (), .

Strongylocentrotus nudus , (-SN).

- . - . -SN , . - -SN . (-), -SN qPCR .

Strongylocentrotus nudus (Echinoidea, Regularia). . (. , ) .

-SN () (Sigma, ). ( /) (). () 1 . 1 . (), 500 , ( ) 1, 2, 3, 4 .

(1500 / 5 ), () (), .

0 , -SN.

-SN c , . 492 (Bio-Tek Instruments, ). .

-SN q.

Quick-RNA MiniPrep (ZimoReseach, ). I, . SMART cDNA Amplification Kit (Clontech ). : 5' AGAGTCACACTAATGACAGGAC 3' 3' TTTCCTCAATTCGCAGCCGTG 5' . - . q / , SYBR Green I (, ), , MiniOpticon Real-Time PCR Detection System (BioRad, ).

, - . , , (Smith et al,1998;

Clow et al, 2000;

Nair et al, 2005).

, . -, , , (Chia, Xing, 1996). , -SN . , , -SN . , S.nudus (, 2010).

-SN , . , -SN ( ), , , q, (. 1). -SN . (3-4 ) (. 1 ). SN , , , , , . -SN , . 2-3 (. 1 ).

. 1. , -SN ( q ) -SN ( ) S. nudus: . ;

. , .

( ), 0- , - -SN. , -SN , (Bulgakov et al., 2007). , , , , , (. 2).

0 1 2 3 .2. , , , . , , , -SN, , .

, , -SN , . S. nudus, -SN . , , -SN .

12-III--06-072, 11-04 01-778- , 11G34.31.0010.


1. Dommett R.M., Klein N., Turner M.W. Mannose-binding lectin in innate immunity: past, present and future//Tissue Antigens. 2006. V.68;


2. Smith L.C., Shih C.S., Dachenhausen S.G. Coelomocytes express SpBf, a homologue of factor B, the second component in the sea urchin complement system// J Immunol. 1998. Volume. 161;



3. Expression of SpC3, the sea urchin complement component, in response to lipopolysaccharide/ Clow L.

A., Gross P. S., Shih C. S., Smith L. C.// Immunogenetics. 2000. Volume 51;

12. P.1021-1033.

4. Macroarray analysis of coelomocyte gene expression in response to LPS in the sea urchin. Identification of unexpected immune diversity in an invertebrate/ Nair S.V., Del Valle H., Gross P.S., et al.// Physiol Genomics. 2005. Volume. 22;

1. P.33-47.

5. Chia F, Xing J. Echinoderm coelomocytes.// Zool. Stud. 1996. 35. P.231254.

6. .. - Strongylocentrotus nudus. ..... . .-, 2010. 24.

7. Molecular and biological characterization of a mannan-binding lectin from the holothurian Apostichopus japonicus/ Bulgakov A.A., Eliseikina M.G., Petrova I.Y. et al// Glycobiology. 2007.

Volume 17;

12. P.1284 THE CHANGES OF LECTIN ACTIVITY OF COELOMIC FLUID AND EXPRESSION OF THE SEA URCHIN STRONGYLOCENTROTUS NUDUS MANNAN-BINDING LECTIN GENE IN RESPONSE TO BACTERIAL LIPOPOLYSACHARIDE INJECTION E. V. Samshurina, S. N. Kovalchuk, I. Yu. Petrova, A. A. Bulgakov, M. G. Eliseikina We have previously characterized the new lectin (MBL-SN) from the coelomic fluid of sea urchin Strongylocentrotus nudus. On the basis of peculiarities of the molecular structure and carbohydrate specificity MBL-SN can attribute to the mannan-binding lectins family. It was shown the inoculation of LPS in coelomic cavity of the experimental animals simultaneously generated the increase of MBL-SN gene expression in coelomocytes and the grows of the MBL-SN concentration in the coelomic fluid. These results demonstrated the participation of MBL-SN in immune response of S. nudus.


.. , , e-mail: nikitawayfarer@yandex.ru , , , . , . , (endocrine disruptors EDs), (Arukwe et al., 2003). EDs (White et al., 1994;

Sonnenschein, Soto, 1998), , .

, , (Vtg). (300600 ), , (Bieberstein et al., 1999) , . Vtg , .

. Vtg (L. pinnifasciata). , Vtg ().


. L.

pinnifasciata (Kner, 1870). Vtg 14 , 2007 ., . Vtg 104 , 2008 (N=20), (N=46) 2010 (N=29), 2011 (N=9) . 2 .

. Sephadex G coarse. Vtg Q Sepharose Vtg - Sephadex G 200. (Shved et al. 2010).

. Vtg . ( ., 1991). DEAE-Sepharose.

IgG ( ., 1991).

Vtg - (ELISA). 1.5 , 1/10 ( 5000 /), . (Shved et al., 2010).

. 4% . (, , 1957). . OLYMPUS (), .

Vtg , . L. pinnifasciata 15 35.5 / 10 , , (Norberg, 1995;

Heppell, Sullivan, 1999).

, Vtg NaCl 0.350.5 (. 1), (Brion et al., 2000). Vtg , . Vtg O. mykiss 240, 170, 90 30 (Brion et al., 2000).

. 1. Liopsetta pinnifasciata Q-Sepharose. D1280 = 280 , CNaCl, M NaCl, .

H. hippoglossus M. microlepis Vtg 160 (Norberg, 1995) 183 (Heppell, Sullivan, 1999) . L. pinnifasciata , 180, 98, 70, 52, 41 . Vtg. , , , , , Vtg (. 2).

Vtg (180 ) , ( 160 205 );

Pleuronectes americanus (175 ) Scophthalmus maximus (185 ), Paralichthys adspersus (205 ).

Vtg , . Vtg Vtg 156 / 2.5 /.

. 2. (і), (.) - () (Vtg) Liopsetta pinnifasciata - .

Vtg , . , Vtg , 2008 ., 5.29 28. / 16.386.73 /. , IV (F4). 2009 . (F2), .

Vtg F4 2.21 13.43 /. Vtg F2 , F4 0. 0.789 /. Vtg ( , , 0.029 /) . Vtg , 2008 . Vtg , 2009, 2010 2011 . Vtg (F2) (F6) , 2009 2011 .

(. 3).

. 3. Liopsetta pinnifasciata . (F) (M) , Vtg .

. 2008 . Vtg M4 , (156 /) 0.957 /.

2009 . Vtg 0.244 /. . M4 , (M3+4) . Vtg , 2009 ., 2008 . 2009 . M3+4 M4, . 2010 . Vtg , 0.18 294 /.

Vtg 0.40 14.00 /.

Vtg (. 3).

, Vtg , : , , (. 4).

. 4. Liopsetta pinnifasciata : ();

, , ;

( ) ( ) ;

( ), . , , 100 , 50 21% Vtg ( 7 /) 2009 ., 75% Vtg 15 30 / 2008 .

, Vtg: 5.5 15 / 2008 . 2 7 / 2009 .

(. 1). , Vtg .

1. (%) (M) (F) Liopsetta pinnifasciata (Vtg) 2008 M F M F Vtg , / 0 5.5 15 0 0.005 7 0.05 1 2 0.05 15 30 0.005 0.1 25 12 16 75 5.5 5.5 18 0 37 16 0 11 17 7 0 37 16 0 16 28 7 0 0 0 0 0 0 10 Arukwe A.,Goksyr A. Eggshell and egg yolk proteins in fish: hepatic proteins for the next generation:


oogenetic, population, and evolutionary implications of endocrine disruption // Comp. Hepatol. 2003. Vol. 2 P.1-21.

2. Environmentally persistent alkyphenolic compounds are estrogenic/ R.White, S.Jobling, S.A.Hoarse, et al.

// Endocrinology.- 1994.-Vol. 135.-P.175-182.

3. Sonnenschein C.,Soto A.M. An updated review of environmental estrogen and androgen mimics, antagonists // J. Steroid Biochem. Mol. Biol.- 1998.-Vol. 65.-P.143-150.

4. Immunohistochemical localization of vitellogenin in rainbow trout (Oncorhynchus mykiss) hepatocytes using immunofluorescence/ U.Bieberstein, T.Berbner, M.Islinger, T.Braunbeck// Sci. Total Environ. 1999.-Vol. 233.-P.67-75.

5. Shved N.A.,Syasina I.G,Kumeiko V.V., Enzyme-linked immunosorbent assay (ELISA) measurement of vitellogenin in plasma and liver histopathology in barfin plaice Liopsetta pinnifasciata from Amursky Bay, Sea of Japan// Fish Physiol. Biochem.- 2010. Vol. 37;


6. / .., .., .., ..;

. .,1991.-288.

7. .., .. .- .: ,1957.-467.

8. Norberg B. Atlantic halibut (Hippoglossus hippoglossus) vitellogenin: induction, isolation, partial characterization// Fish Physiol. Biochem.- 1995.-Vol. 14.-P.1-13.

9. Heppell S.A.,Sullivan C.V. Gag (Mycteroperca microlepis) vitellogenin: purification, characterization, use for enzyme-linked immunosorbent assay (ELISA) of female maturity in three species of grouper// Fish Physiol. Biochem.- 1999.-Vol. 20.-P.361374.

10. Two-step purification method of vitellogenin from three teleost fish species: rainbow trout (Oncorhynchus mykiss), gudgeon (Gobio gobio), chub (Leuciscus cephalus)/ F.Brion, F.Rogerieux, P.Noury, et al.// J.

Chromat. B.- 2000.-Vol. 737.-P.3-12.

VITELLOGENIN OF BARFIN PLAICE LIOPSETTA PINNIFASCIATA AS BIOMARKER OF ESROGEN POLLUTION N.A. Shved, I.G. Syasina, V.V. Kumeiko A.V. Zhirmunsky Institute of Marine Biology of the Far Eastern Branch of the Russian Academy of Sciences e-mail: nikitawayfarer@yandex.ru Vitellogenin (Vtg) of the barfin plaice Liopsetta pinnifasciata was isolated and purified. A quantitative enzyme-linked immunosorbent assay for detection of serum vitellogenin concentration was developed. The concentration of Vtg in barfin plaice was detected based on the maturity stage of their gonads. It was shown, that juvenile and male fish Liopsetta pinnifasciata from the Amursky Bay (Peter the Great Gulf, The Sea of Japan) produce Vtg, that is evidence of estrogen material presence in the bay. For the first time correlation between serum Vtg and liver pathological changes was revealed in flounders from contaminated area.

Ѩ .., .., .. Յ.......................................................................... .., .. Pͅ... .. ....................................................................................................................... .., .., .. TELEOSTEI.. .., .. OSTEICHTHYES... .. C ANADARA INAEQUIVALVIS BRUGUIERE ߅. . ., . . LMNA MINOR L. ȅ. .., .. … .., .., .. , ȅ .., .., .., .., .., .., - .., .., .., .., .., .. 70 , ................................................................................................................ .. AHNFELTIOPSIS FLABELLIFORMIS.. .., .., .., .. ߅.. .., .. HIMEROMETRA ROBUSTIPINNA ȅ .., ˨ .. , ȅ. .., .., ., .. - S- .., .., .., .. . .., .. ... .., .. CLADOCERA .. .., .. ONCORHYNCHUS KISUTCH - .. .., .., .., .. Ũ - CYPRINUS CARPIO........................................................................................................................................ .., .., .., .. WNT5 EUPENTACTA FRAUDATRIX .., .., .., .., .., .., .., .., ..

….. .., .., .., .., .., .., .. ߅.. .. . ۅ. .. - …... .., .., .., .. , , PSETTA MAXIMA MAEOTICA.. .. ... .. ̅. .., .. ۅ.. .. ….................................................................. .., .., .. - IG ACIPENSER RUTHENUS .., .. , .., .. . .. ߅.. .., .. COREGONUS.. .. ̅ .., .., .. . .. ۅ .. Յ... .. .......... .., ̨ .. LYMNAEA STAGNALIS (GASTROPODA, LYMNAEIDAE) ȅ. .., .., .. , EUBOTHRIUM RUGOSUM .., .. Җ…... .., .., .., .. LITTORITA LITTOREA Ʌ.. .., .. CLADOLABES SCHMELTZII.

. .., .. - Յ .. ۅ... .., .., .., .. . .. - (NEOGOBIUS MELANOSTOMUS) Ʌ... .., .., .. . ..................... .., .. DAPHNIA MAGNA ߅.. .. … .., .., .., .. MYTILUS GALLOPROVINCIALIS LAM. ()... .. , , , ߅. .., .. - ABRAMIS BRAMA (L.) . .., .., .., .., .. ... .. (URIA LOMVIA) (U. AALGE) ߅. .. ۅ...... .. ANODONTA CYGNEA. .., .. E. FRAUDATRIX. .., .., .. NO- , . .. BATRACHIUM KAUFFMANNII Ņ .., .. CHLORELLA VULGARIS BEIJER . .., ., .. (CYPRINUS CARPIO L.).. .., .. RUTILUS RUTILUS (L.) ... .. , Ʌ. .. Յ. .. ….. .., .., . .. - ۅ. .. ʨ .., .. . .. , TRICHOGASTER LEERI .., .., .., .. PARALITHODES CAMTSCHATICUS Ņ.............................................................................. .., .., .., .. PARASALMO MYKISS (WALBAUM, 1792).. .. - Ņ.. .. ( ). .. ( LYMNAEIDAE, PLANORBIDAE, THIARIDAE) .. DAPHNIA MAGNA .., .. HYPOPHTHALMICHTHYS MOLITRIX...................... .., .. υ. .. ۅ .., .., .. Ņ... .. (HIRUDO MEDICINALIS).... .., .., .., .. (SILURUS GLANIS L.) Յ... .., .. - ̅. .., .. Ӆ.. .., .. Ǩ . .., .., .., .., .. .. .., .., .., .. - .. .. .., .. SCORPAENA PORCUS L.. .., .., .. CHERAX QUADRICARINATUS, ... .. ….. .., .., .. . .., .., .. (PARAMECIUM CAUDATUM). ., .. .., .. (RUTILUS RUTILUS L) .., .. CARASSIUS AURATUS GIBELIO (BLOCH, 1782) .., .., .., .., . ..

ۅ .., .. …... .. DAPHNIA MAGNA STRAUS .. . ., . ., . . - ۅ... .., , .. .., .. - ۅ...................... .., .., .., .., ..

, - - (SALMONIDAE) (COREGONIDAE). .., .., .. ... .., .., .., .., ..


Pages:     | 1 |   ...   | 16 | 17 ||
-  >> 

<<     |    
2013 www.libed.ru - -

, .
, , , , 1-2 .