авторефераты диссертаций БЕСПЛАТНАЯ БИБЛИОТЕКА РОССИИ

КОНФЕРЕНЦИИ, КНИГИ, ПОСОБИЯ, НАУЧНЫЕ ИЗДАНИЯ

<< ГЛАВНАЯ
АГРОИНЖЕНЕРИЯ
АСТРОНОМИЯ
БЕЗОПАСНОСТЬ
БИОЛОГИЯ
ЗЕМЛЯ
ИНФОРМАТИКА
ИСКУССТВОВЕДЕНИЕ
ИСТОРИЯ
КУЛЬТУРОЛОГИЯ
МАШИНОСТРОЕНИЕ
МЕДИЦИНА
МЕТАЛЛУРГИЯ
МЕХАНИКА
ПЕДАГОГИКА
ПОЛИТИКА
ПРИБОРОСТРОЕНИЕ
ПРОДОВОЛЬСТВИЕ
ПСИХОЛОГИЯ
РАДИОТЕХНИКА
СЕЛЬСКОЕ ХОЗЯЙСТВО
СОЦИОЛОГИЯ
СТРОИТЕЛЬСТВО
ТЕХНИЧЕСКИЕ НАУКИ
ТРАНСПОРТ
ФАРМАЦЕВТИКА
ФИЗИКА
ФИЗИОЛОГИЯ
ФИЛОЛОГИЯ
ФИЛОСОФИЯ
ХИМИЯ
ЭКОНОМИКА
ЭЛЕКТРОТЕХНИКА
ЭНЕРГЕТИКА
ЮРИСПРУДЕНЦИЯ
ЯЗЫКОЗНАНИЕ
РАЗНОЕ
КОНТАКТЫ

Pages:     | 1 |   ...   | 25 | 26 || 28 | 29 |

«Petrozavodsk State University, Petrozavodsk, Russia The Program of Russian Academy of Sciences «Biological resource of Russia» 2009-2011 ...»

-- [ Страница 27 ] --

Червова Л.С. 1997. Болевая чувствительность и поведение рыб // Вопр. ихтиологии. Т. 37, N 1. С. 106– 111.

Червова Л.С., Каменский А.А., Малюкина Г.А. и др. 1992. Исследование механизма интраназального действия дерморфина у представителей двух классов позвоночных // Жур. эволюцион. биохим. физиол. Т. 28, N 1. С. 45–48.

Червова Л.С., Лапшин Д.Н. 2000. Опиоидная модуляция болевых порогов у рыб // Доклады АН. Т. 375, N 5. С. 703–704.

Червова Л.С., Лапшин Д.Н., Каменский А.А. 1994. Болевая чувствительность форели и аналгезия, вы зываемая интраназально вводимым дерморфином // Доклады АН. T. 338, N 6. С. 836–837.

Brooks A.I., Standifer K.M., Ciszewska G.R. et al. 1993. Expression of -3 and binding sites in Bufo marinus (Giant toad) and Carassius auratus (Goldfish) brain // Soc. Neurosci. Abstr., Opioids: Recep., III. V. 19, N 5. P. 1156.

Ebbesson L.O.E., Daviche P., Ebbesson S.O.E. 1993. Distribution and changes in - and -opiate receptors in the midlife critical period of natural development in Coho salmon, Oncorhynchus kisutch // Abstr. Amer. Assoc.

Anat., 106th Ann. Meet. Joint. Jpn. Assoc. Anat., San Diego, Calif., March 27–31, 1993, Anat. Rec. Suppl, P. 48.

Newby N.C. et al. 2008. Pharmacokinetics of morphine and its metabolites in freshwater rainbow trout (Oncorhynchus mykiss) // J. Vet. Pharmacol. Therap. V. 31. P. 117–127.

Sneddon L.U. 2003. The evidence for pain in fish: the use of morphine as an analgesic // Applied Animal Behav. Sci. V.83. P. 153–162.

VIIth Congress on biology of fish. 2006. Canada. St.-John’s, 18–22 July.

Abstract

Book, pp. 241.

BEHAVIORAL REACTIONS OF WHITE SEA COD ON THE NOCICEPTIVE STIMULATION L.S. Chervova Dept. of Ichthyology, Faculty of Biology, Lomonosov Moscow State University, Moscow, Russia, e-mail: lily_chervova@mail.ru An originally optico-mechanical system was elaborated to record the behavioral responses to aversive stimuli in cod. The nociceptive stimulation (0.1-s train of 30 electric pulses of 0.5 ms each) and registration of the caudal peduncle moving were made synchronically. Nociceptive thresholds (NT) were measured at 5-min intervals for 1 h before and 1–2 h after administration of analgesic agents. Drugs used were two -opioids dermorphin and -casomorphin, and nonopioid agents sydnophenum, analginum, novocainum. Drugs were administrated by different ways – intranasally, peritoneally, subcutaneously.

Administration of analgetics produced dose-dependent and lasting for at least 1 h (up to 2–3 h) increase of NT in 1.5–3.0 times. The higher the dose, the more quickly it acted. Local subcutaneous injections of 2% solution of novocainum blocked the nociceptive responses. Stress significantly reduced nociceptive responses in cod. Results suggest that fish as higher vertebrates have nociceptive and opioid and nonopioid antinociceptive systems;

and its both take part in the control of fish behavior on the level of central mechanisms РЕЗУЛЬТАТЫ ИНСТРУМЕНТАЛЬНОГО АВИАМОНИТОРИНГА БЕЛОМОРСКОЙ ПОПУЛЯЦИИ ГРЕНЛАНДСКОГО ТЮЛЕНЯ В 1998–2008 ГГ.

В.И. Черноок Научно-исследовательский институт «Гипрорыбфлот», г. Санкт-Петербург, Россия e-mail: chernook@grf.spb.ru Беломорская популяция гренландского тюленя является важной частью экосистем Баренцева и Белого морей. Этот многочисленный вид тюленей может являться биогеографическим интеграль ным показателем состояния морских экосистем в Баренцевоморском регионе. По состоянию этой популяции и распределению тюленей можно:

оценить биоресурсный потенциал морей, в которых обитает гренландский тюлень;

• определять местоположение высокопродуктивных районов;

• оценить воздействие тюленей на промысловые виды рыб;

• отслеживать воздействие глобальных климатических изменений на биоресурсы;

• оценивать воздействия нефтяного промысла на морскую экосистему;

• определять размер квот для промысла беломорской популяции гренландского тюленя.

• Для получения объективных документальных данных и для принятия обоснованных управ ленческих решений была создана система инструментального контроля состояния беломорской по пуляции гренландских тюленей. Количество родившихся щенков – интегральный показатель со стояния всей популяции и перспектив ее дальнейшего развития. Численность приплода быстрее реагирует на изменения среды обитания, чем численность всей популяции.

Ежегодно в конце февраля – в начале марта у гренландских тюленей наступает щенка, и в этот период тюлени образуют в Белом море достаточно плотные залежки, количество самок на которых дос тигает несколько сотен тысяч голов. В первой декаде марта уже более 90% самок приносит детенышей.

После рождения детеныши тюленей находятся на льду и не сходят в воду в течение 3 недель (период лактации), что и создает условия для проведения инструментального учета численности приплода грен ландских тюленей на щенных залежках. Количество взрослых тюленей на льду сильно зависит от мно гих факторов: погодных условий, времени суток, физиологии животных и др. Количество взрослых тю леней на льду может составлять от 10% до 90% от общего количества взрослых животных, находящих ся на щенных залежках. Поэтому регистрация именно детенышей при помощи фото, видео и тепловой аппаратуры даёт более достоверную оценку состояния популяции. Учет приплода нью-фаундлендской и ян-майенской популяций гренландских тюленей проводят в Канаде и Норвегии.





На сегодняшний день инструментальные авиасъемки являются основным средством учета морских млекопитающих. Аэровизуальный учет не может дать требуемой точности, кроме того, ма териалы такого учета не имеют документальной основы, в них много субъективизма, их невозмож но проверить и повторно обработать. Применение инструментальной методики учета дало возмож ность документировать материалы съемок, провести анализ и сравнение многолетних колебаний численности приплода популяции и тенденции ее развития.

Метод комплексной тепловой авиасъемки заключается в синхронной съемке теплокровных тюле ней на льду в инфракрасном и видимом диапазонах спектра с последующей совместной обработкой по лученных снимков. Теплового контраста между детенышами тюленей и окружающим фоном (льдом) достаточно для их регистрации с помощью тепловизионной аппаратуры с борта самолета.

В середине марта выполнялись инструментальные учетные авиасъемки гренландских тюле ней в Белом море. Зарегистрированные тепловизором тюлени разделяются на взрослых и детены шей при совместном анализе инфракрасных изображений и фотоснимков видимого диапазона (рис.

1). Авиасъемки выполнялись по стандартизованной сетке учетных галсов, высота полета 200–250 м, учетная полоса тепловизора 500–600 м, покрытие учетной полосой площади льда Белого моря 5– 7%. Учеты выполнялись в течение нескольких дней (3–5).

Кроме численности тюленей, при проведении этих авиаучетов мы получаем много дополни тельной важной информации: половозрастную характеристику популяции (по линейным размерам тюленей и возрастной окраске), взаимосвязь распределения тюленей и параметров среды, структуру щенных залежек, поведение животных, воздействие интенсивного судоходства и загрязнений на гренландских тюленей и др.

Рис. 1. Пример материалов тепловой и фотосъемки на льдах Белого моря: а – фрагмент инфракрасного изображе ния щенной залежки гренландского тюленя (черный фон – холодный лед, белые пятна на темном фоне – теплые тюлени: взрослые и щенки), b – фрагмент фотоснимка, с – соответствующий ему увеличенный фрагмент теплово го снимка. Белыми кружками отмечены самки тюленей и детеныши. Белых детенышей на льдах трудно распознать на обычных фотоснимках (показано с увеличением), а на тепловом снимке они хорошо различимы Все зарегистрированные тепловизором тюлени имеют точные географические координаты.

Так, например, за один из полетов в полосе обзора тепловизора было зарегистрировано около тысяч тюленей и для каждого животного были определены его географические координаты. Это по зволяет обрабатывать материалы инфракрасных авиасъемок с помощью геоинформационных сис тем (ГИС). Все полученные «слои» – результаты съемки – укладываются на электронную карту.

В период с 1998 года по 2008 год практически ежегодно по унифицированной технологии комплексной тепловой авиасъемки выполнялись учеты детенышей гренландского тюленя в Белом море. Результаты авиаучетов приведены в табл. 1.

Таблица Авиаучеты детенышей гренландского тюленя в Белом море в 1998–2008 гг.

Год проведения авиаучета Численность щенков и ошибка учета, Количество добытых щенков, в тыс. голов в тыс. голов 1998 287,0+ 43,0 13, 2000 340,0+ 30,0 31, 2002 330,0+ 45,0 24, 2003 327,0+ 41,0 37, 2004 238,0+ 36,0 2005 122,0+ 19,0 14, 2007 159,0+28,0 5, 2008 114,0±21,0 13, В 1998–2003 гг. численность новорожденных щенков варьировала незначительно и в целом была на довольно высоком уровне в 290–340 тыс. голов. Однако в 2004 г. численность новорожден ных щенков резко упала – на 37%, различия статистически достоверны. В 2005 г. резкое снижение рождаемости продолжилось.

Особенностью 2007 г. было позднее становление ледового покрова и малая его площадь. Чис ленность новорожденных гренландских тюленей составила 159,0±28,0 тысяч голов. Щенные залеж ки были распределены на малой площади, плотность распределения тюленей достигала 1500 жи вотных на кв. км. И по этим плотным залежкам проходили трассы судов, разрушающие залежки. Во время полетов были зафиксированы танкеры и контейнеровозы, проходящие по ледовым полям Бе лого моря. Маршруты судов проходили через места концентраций самок с недавно родившимися детенышами. Суда и следы после них во льдах хорошо наблюдались визуально и были зафиксирова ны фотоаппаратами и тепловизором с регистрацией времени и места (рис. 2).

Рис. 2. Распределение гренландских тюленей на щенных залежках в Белом море 14–17 марта 2007 г. и судо ходные трассы, наложенные на спутниковый снимок распределения льда (белый цвет – лед, темный – открытая вода) Начало 2008 года характеризовалось мощной аномалией, которую можно рассматривать, как последствия глобального потепления. Ледовый покров на Белом море отсутствовал практически до 20 февраля. Ледообразование началось практически непосредственно с началом процесса деторож дения. Сроки деторождения запоздали и сдвинулись приблизительно на 10 дней. Толщина льда бы ла 10–20 см, много было «мокрых» льдов, то есть лед был малопригодным для процессов щенки и выживания детенышей. При попадании щенка в воду резко возрастает вероятность его гибели. В 2008 г. численность приплода составила 114,0±21,0 тысяч голов и явилась самой низкой у беломор ской популяции гренландского тюленя за период инструментального мониторинга с 1998 по 2008 г.

Фактически произошло трехкратное сокращение рождаемости в популяции.

Таким образом, в популяции гренландского тюленя в Белом море наблюдаются сильнейшие изменения, связанные с несколькими факторами. Глобальное потепление может стать самым мощ ным фактором, влияющим на выживаемость морских млекопитающих Арктики (рис. 3). Особенно если это происходит на фоне нарушения экологического равновесия в морской экосистеме. Сле дующий негативный фактор – повышенная антропогенная активность в Арктике, которая на блюдается в последние годы в связи с развитием нефтедобычи на шельфе и добычи минерального сырья на побережье и транспортировкой его морем. Смещение ледовых полей к Кандалакшскому заливу, где пролегают трассы нефтяных перевозок, привело к тому, что танкеры стали проходить прямо по репродуктивным залежкам тюленей, увеличивая вероятность гибели новорожденных.

Таким образом, кризисная ситуация с рождаемостью у гренландского тюленя заставляет пе ресмотреть многие методические подходы к оценке запасов морских млекопитающих, их промы словому использованию и организации охраны.

Рис. 3. График изменения площади льда (миллионы кв. км) в Арктике за 1998–2008 гг. (а) и диаграмма изме нения численности приплода беломорской популяции гренландского тюленя за тот же период (b). По верти кальной оси диаграммы численность приплода дана в тысячах особей.

Выводы Опыт 11-летнего использования инструментальной технологии учета позволил создать систе му объективного контроля состояния популяции гренландского тюленя в период резких климатиче ских изменений. Получен многолетний регулярный ряд данных о состоянии беломорской популя ции гренландских тюленей и ледовых характеристиках среды их обитания, что позволит определять взаимосвязь состояния популяции с процессами, происходящими в Баренцевом и Белом морях, и выявлять тенденции развития беломорской популяции гренландского тюленя.

Выражаю благодарность сотрудникам ПИНРО и Гипрорыбфлота, принимавшим участие в авиа съемках и обработке материалов авиаучетов.

Литература Черноок В.И., Кузнецов Н.В., Яковенко М.Я. Мультиспектральная авиасъемка залежек тюленей // Мурманск, ПИНРО, 1999. – 73 с.

Черноок В.И. и др. Оценка численности детенышей гренландского тюленя беломорской популяции на щенных залежках в 2003 г., Морские млекопитающие Голарктики, Москва- 2004, С.575–578.

Черноок В.И. Инструментальные методы мониторинга морских млекопитающих // Информационный бюллетень № 13. Совет по морским млекопитающим. – 2008. – С.26–30.

ПЕРВИЧНАЯ ПРОДУКТИВНОСТЬ ФИТОПЛАНКТОНА В ПРОЛИВЕ ПЕЧАКОВСКАЯ САЛМА БЕЛОГО МОРЯ В ЛЕТНИЙ ПЕРИОД.

В.А. Чугайнова, И.Ю. Македонская Северный филиал ПИНРО, г. Архангельск, Россия e-mail: val@sevpinro.ru Первичная продукция, наибольший вклад в которую вносят планктонные водоросли, наряду с поступающими в водоем аллохтонными органическими веществами составляет материальную и энергетическую основу всех последующих этапов продукционного процесса. Благодаря разработке методов изучения первичной продукции, общая биологическая продуктивность водоема получила количественное выражение. Необходимость количественной характеристики органических ве ществ, синтезируемых при фотосинтезе планктона, отчетливо выступает при решении многих во просов и практики гидробиологии. Но, несмотря на это, изученность продукционных характеристик фитопланктона оставляет желать лучшего.

Материалы и методы Исследования первичной продуктивности фитопланктона проводились с 7 по 21 июля 2007 г.

на стационаре СевПИНРО в проливе Печаковская Салма (Соловецкие острова) на суточных станци ях (всего 14 определений валовой первичной продуктивности). Кроме этого, одной из целей наших исследований явились качественные и количественные суточные изменения фитопланктона. В свя зи с этим в прибрежной зоне в поверхностном слое было собрано и обработано 13 проб фитопланк тона. Пробы фитопланктона отбирались 14–15 июля через два часа. В комплекс наблюдений наряду с качественными и количественными показателями фитопланктона входило определение темпера туры, солености вод, содержания кислорода.

Анализы проб морской воды выполнялись общепринятыми в гидрохимической практике ме тодами. Растворенный в воде кислород определялся объемным методом Винклера (Руководство..., 2003). Инкубирование проб воды для определения интенсивности фотосинтеза производилось в темных и светлых склянках при температуре морской воды и естественном освещении. Пробы на пигментный состав фитопланктона фильтровались через мембранные фильтры «Владипор» диамет ром 35мм с размером пор 0,65 мкм. Образцы фильтров хранились в морозильной камере в емкости с силикагелем. Пигменты микроводорослей были определены в лабораторных условиях стандарт ными методами. Оптические плотности экстракта измеряли при длинах волн 480, 630, 647, 664 и 750 нм. Концентрацию хлорофилла «а» вычисляли по формулам Джеффри и Хамфри (Jeffrey S.W., Humphrey G.F., 1975).

В результате исследований был получен ряд наблюдений над изменениями валовой первич ной продукции в течение 15 суток, а также выявлена суточная динамика качественных и количест венных показателей фитопланктона.

Результаты и их обсуждение По нашим наблюдениям, значения валовой первичной продукции (ППвал) в Печаковской Салме варьировали в широком диапазоне – 0,33–1,65 мгО2/л/сут (что соответствует 124– мгС/м3/сут), среднее значение составило 0,63 мгО2/л/сут (256,4 мгС/м3/сут). Максимальные значе ния были зафиксированы в последние двое суток, что, вероятно, связано с более благоприятными метеоусловиями (рис.1). Эти величины в основном соответствуют ППвал, полученной в предыду щие годы в данном районе (Чугайнова, Македонская, 2007).

В целом, валовый фотосинтез в течение 15 суток изменялся достаточно равномерно, показы вая волнообразный характер. Нужно отметить, что в этот период наблюдались стабильные природ ные условия. Так температура воды изменялась в диапазоне от 8,4°С в начале наблюдений до 10°С в конце (9,66 С средняя), соленость изменялась в пределах 26,2–26,9 ‰ (при средней 26,6 ‰). Так же практически однородными были и метеоусловия.

Показатели деструкции в течение всего периода наблюдений превышали ППвал, и только в конце срока их значения были близки к сбалансированности. В среднем деструкция составляла 414,4 мгС/м3/сут (при вариабельности 86,3 – 742, 5 мгС/м3/сут).

мгС/м3/сут 8 9 10 11 12 13 14 15 16 17 18 19 20 дата Рис. 1. Динамика изменений валовой первичной продукции 8–21 июля 2007 г.

Суточные изменения численности, биомассы и комплекса доминирующих видов фитопланк тона подвергались некоторым колебаниям. Биомасса изменялась в пределах от 94,8 до 496,44 мкг/л, а численность – от 4860 до 18220 кл/л (рис.2) Среднесуточные значения численности и биомассы составили 10277 кл/л и 311,21 мкг/л, соответственно.

кл/л мкг/л 20000 14000 числен 12000 ность 10000 биомас са 4000 0 10 12 14 16 18 20 22 0 2 4 6 8 часы Рис. 2. Численность (кл/л) и биомасса (мкг/л) фитопланктона 14–15 июля 2007 г.

Общее число таксонов микроводорослей в июльских пробах в течение суток колебалось от 13 до 25. Всего за время исследований было обнаружено 45 таксонов. В комплекс домини рующих таксонов июльского фитопланктона вошли: криптофитовые – Leoucocryptos marina;

зе леные – Piramimonas sp., мелкие Chlorococales;

диатомовые – Thalassiosira Nordenscioldii, Leptocylindrus danicus, Detonula confervacea, L icmophora paradoxa;

динофитовые – Gymnodinium arcticum. Комплекс микроводорослей довольно обычен для данного района в лет ний сезон (Македонская, 2007).

Основную роль в фотосинтетическом процессе играет хлорофилл «a», все другие пиг менты лишь передают поглощенную ими энергию хлорофиллу «a». Таким образом, содержа ние хлорофилла «a» является важнейшей характеристикой фотосинтетической активности фи топланктона, по которой можно также определить схематичные показатели биомассы фито планктона (см. рис. 2). Изучение количественных соотношений между различными пигмента ми фитопланктона позволяют судить о преобладании той или иной группы водорослей в мор ской воде. Так, основную массу морского фитопланктона составляют диатомовые и периди ниевые водоросли, которые содержат хлорофиллы «a» и «c». Определение даже небольшого количества хлорофилла «b» указывает на развитие мелких жгутиковых (зеленых) и синезеле ных водорослей. Соотношения между пигментами водорослей характеризуют также физиоло гическое состояние популяции фитопланктона. 51 % фитопигментов приходится на долю хло рофилла «а». Хлорофилл «b», присутствующий в хлоропластах зеленых водорослей составля ет 24 %, на долю хлорофилла «с», который содержится в клетках диатомовых, динофитовых и других отделов водорослей приходится 25 %. Такое соотношение пигментов свидетельствует об интенсивной фотосинтетической деятельности фитопланктона. Косвенно это подтвержда ется и насыщенностью вод кислородом, которая в период проведения суточной станции со ставляла 110–130 % нас., а также показателями ППвал.

Попытка сопоставить значения хлорофиллов, биомассы, численности микроводорослей с приливным циклом показала, что их концентрации не зависят от фазы прилива. А с содержанием и насыщенностью вод кислородом находятся в противофазе.

Выводы В летний период в районе пролива Печаковская Салма отмечены высокие значения первич ной продукции фитопланктона, сопоставимые с весенними.

Изменения качественного и количественного состава фитопланктона не имеют явно выражен ных отличий в течение суток. Причиной этого, по всей вероятности, является довольно стабильный гидрологический и гидрохимический режим вод Печаковской Салмы в период наблюдений.

Для уточнения суточных и сезонных изменений фитопланктонного сообщества данного рай она потребуются дополнительные исследования.

Литература Македонская И.Ю., 2007. О сезонной и межгодовой динамике фитопланктона Печаковской Салмы Онежского залива Белого моря //Проблемы изучения, рационального использования и охраны природных ре сурсов Белого моря –Материалы Х Международной конференции. г. Архангельск. С.154–158.

Чугайнова В.А., Македонская И.Ю., 2008. Сезонные изменения первичной продуктивности и хлоро филла «а» в районе Соловецких островов. //Морские прибрежные экосистемы: водоросли, беспозвоночные и продукты их переработки. Тезисы докладов 3-ой Международной научно практической конференции. Влади восток: ТИНРО-центр. С.163–164.

Руководство по химическому анализу морских и пресных вод при экологическом мониторинге рыбохо зяйственных водоемов и перспективных для промысла районов Мирового океана., 2003 г. М.: Издательство ВНИРО. –202 с.

Jeffrey S.W., Humphrey G.F., 1975. New spectrophotometric equations for determining chlorophylls a, b, c and c2 in higher plants, algae and natural phytoplankton // Biochem. und Physiol. Pflanz. Bd. 167. № 2. P. 191–194.

PHYTOPLANKTON PRIMARY EFFICIENCY IN PECHAKOVSKAJA SALMA BELT OF THE WHITE SEA DURING SUMMER PERIOD V.A. Chugajnova, I.J. Makedonskaja Northern Branch of PINRO, Arkhangelsk, Russia e-mail: val@sevpinro.ru Investigations of phytoplankton primary efficiency were spent on July 7–21, 2007 on SevPINRO permanent establishment in Pechakovskaja Salma belt, (Solovetskiye Islands) at daily stations ( definitions of total primary efficiency in all). On our observations, values of total primary production (TPP) in Pechakovskaja Salma varied in a wide range – 0.33–1.65 mgО2/l/day (that corresponds 124 – mgC/m3/day), average value has made 0.63 mgО2/l/day (256,4 mgC/m3/day). As a whole, total photosynthesis within 15 day changed in enough regular intervals, showing wavy character. Daily changes of number, a biomass and a complex of a dominating phytoplankton species also were exposed to some fluctuations. The biomass changed within the limits of from 94.8 up to 496.44 mkg/l, and number – from 4860 up to 18220 cells/l. Daily average values of number and a biomass have made 10277 cells/l and 311.21 mkg/l, accordingly.

СТОЙКИЕ ОРГАНИЧЕСКИЕ ЗАГРЯЗНЯЮЩИЕ СОЕДИНЕНИЯ В ЭКОСИСТЕМЕ РЫБИНСКОГО ВОДОХРАНИЛИЩА И ИХ ВЛИЯНИЕ НА РЫБ И ВОДНЫХ БЕСПОЗВОНОЧНЫХ Г.М. Чуйко1, А.А. Морозов1, Е.С. Бродский2, А.А. Шелепчиков2, Д.Б. Фешин Учреждение Российской академии наук Институт биологии внутренних вод им. И.Д. Папанина РАН, п. Борок, Ярославская обл., Россия Учреждение Российской академии Институт проблем экологии и эволюции им. А.Н. Северцова РАН, Москва, Россия e-mail: gko@ibiw.yaroslavl.ru Введение В последние 30 лет при экологических исследованиях повышенное внимание уделяется группе стойких органических загрязнителей (СОЗ). СОЗ относятся к классу хлорорганических соединений и обладают рядом специфических свойств: биоаккумуляция за счет высокой липофильности;

глобальная распространенность в окружающей среде;

высокая стойкость к физическим, химическим и биологиче ским факторам;

способность оказывать токсическое действие на организмы в крайне малых дозах. В 2001 г. в Стокгольме была принята и подписана Глобальная международная Конвенция о запрещении производства и использования СОЗ, к которой в 2002 г. присоединилась и Россия.

Хлорсодержащие пестициды (ХОП) и полихлорированные бифенилы (ПХБ) – наиболее распространенные группы СОЗ, которые в больших масштабах применялись с середины про шлого столетия в сельском хозяйстве и промышленности. В странах, подписавших конвен цию, использование и производство СОЗ в настоящее время запрещено. Однако эти соедине ния продолжают глобально циркулировать в водных экосистемах, в том числе и в России (Кленкин и др., 2008). В последние годы мониторинг ХОП в России проводится только для воды водных объектов, а для ДО и рыбы он носит нерегулярный характер. По ПХБ монито ринг вообще отсутствует.

Рыбинское водохранилище – один из крупнейших пресных водоемов в России. Однако иссле дования содержания ХОП в его ДО проводились лишь в Шекснинской части в черте г. Череповца (Колпакова и др., 1996), а их накопления в рыбе – в Моложской части (Майер и др., 1981). Данные по ПХБ представлены более полно. Ранее показано, что в экосистеме водохранилища присутствуют ПХБ, локальным источником которых является Череповецкий индустриальный комплекс (Чуйко и др., 2008). Однако их конгенерный состав до сих пор остается неисследованным. Не проводилась и оценка их экологического риска для водохранилища.

Цель работы – исследовать качественный состав и содержание ХОП и ПХБ в ДО и рыбе Ры бинского водохранилища, проанализировать источники их поступления и пространственного рас пределения, дать нормативную оценку уровней их аккумуляции.

Материалы и методы Пробы ДО и рыбы отбирались с экспедиционного судна в сентябре 2006 г. ДО брали с гори зонта 0 – 20 см в трех повторностях с каждой точки с глубины 10–12 м на 6 станциях бывшего рус ла р. Шексны (ст. 1–4) и р. Мологи (ст. 5, 6). Выбор станций проводился с учетом гидрологических особенностей и расположения основного источника загрязнения в г. Череповце (рисунок). Образцы ДО отбирали коробчатым дночерпателем ДАК-250 с площадью захвата 0.4 м2. Интегральная проба грунта с каждой станции высушивалась на воздухе до постоянной массы. Измерения делались три жды, рассчитывались средние значения. Рыба, лещ (Abramis brama L.), отлавливалась донным тра лом на станциях 2–6 по 10 экз., включавшие в равном соотношении особей обоего пола со средней длиной 358 мм и массой 853 г. Отбирались образцы дорсальных мышц массой 5 г с левой стороны тела. Пробы с каждой станции объединялись и из них готовился фарш. Для анализа использовалась объединенная навеска фарша массой 5 г. Содержание СОЗ определяли методом хромато-масс-спек трометрии высокого разрешения (Шелепчиков и др., 2008). Анализировались следующие ХОП: гек сахлорбензол (ГХБ), дихлор-дифенилтрихлорэтан (ДДТ) и его метаболиты (ДДД и ДДЕ),, и – изомеры 1,2,3,4,5,6-гексахлорциклогек-сана (ГХЦГ). При анализе ПХБ выделялись конгенеры со степенью хлорированности 3–7, обозначенные по системе ЮПАК: 28/31, 52, 101, 105, 118, 138, 153, 156, 157, 167 и 180.

Результаты и их обсуждение На всех станциях в ДО обнаружены СОЗ, среди которых в наибольшем количестве присутствуют ПХБ (Табл. 1).

Суммарное содержание ДДТ, ДДД и ДДЕ на порядок, а ГХБ на два порядка ниже, чем общая сумма ПХБ. В пространственном отношении все исследуемые СОЗ распределяются в ДО неравно мерно. Их концентрации на ст. 1–3 выше, чем на ст. 4–6. Однако характер пространственного рас пределения разных СОЗ различается. Содержание ГХБ между станциями варьирует незначительно, содержание ДДТ и его метаболитов – в более широком диапазоне, а суммарное содержание ПХБ – еще в более широких пределах. Качественный состав ДДТ во всех образцах ДО одинаковый и пред ставлен исходным веществом и его метаболитами. Однако их соотношение на разных участках во дохранилища различается. На ст. 1–3 преобладают ДДТ и ДДД, суммарная доля которых составляет 80–90%. На ст.4–6 их доля ниже и составляет 42–64%. Состав ПХБ в ДО на всех станциях представ лен 3-, 4-, 5-, 6- и 7-хлорированными конгенерами (3-ХБ, 4-ХБ, 5-ХБ, 6-ХБ и 7-ХБ, соответственно).

Доля низко и высоко хлорированных 3-ХБ и 7-ХБ в общем пуле ПХБ не превышает 6–10% и мало варьирует между станциями. Основная часть (88–95%) представлена 4-ХБ, 5-ХБ и 6-ХБ. Их соотно шение на разных станциях различается. Доля 6-ХБ понижается от ст.1 к ст.6 с 50 до 9%, в то время как доля 4-ХБ повышается с 15 до 52%. 5-ХБ демонстрируют более сложную картину. На ст. 1 их доля – 20%, на ст.2 и 3 она увеличивается до 50–55%, а на ст.4–6 опять снижается с 38 до 27%. По соотношению конгенеров станции делятся на две группы: ст. 1–3, где преобладают 5-ХБ, 6-ХБ и 7 ХБ, и ст. 4–6, где высока доля 3-ХБ и 4-ХБ.

Таблица Содержание ПХБ и ХОП (мкг/кг сухой массы) в ДО на разных участках Рыбинского водохранилища Станции Соединения 1 2 3 4 5 ПХБ-28/31 9.86 17.44 4.00 4.00 1.04 4. 3-ХБ (сумма) 14.87 26.25 6.00 8.00 1.82 5. ПХБ-52 3.65 13.54 3.87 2.14 1.87 3. 4-ХБ (сумма) 21.61 71.21 17.08 11.23 11.56 23. ПХБ-101 3.13 28.88 8.04 1.60 1.54 1. ПХБ-105 2.89 24.17 9.74 0.69 0.24 0. ПХБ-118 5.93 46.70 18.44 1.72 0.92 1. 5-ХБ (сумма) 29.18 214.92 83.14 10.59 7.68 12. ПХБ-138 3.05 23.29 12.15 1.05 0.56 0. ПХБ-153 3.13 25.65 10.67 1.24 0.72 0. ПХБ-156 0.54 5.03 2.04 0.13 0.04 0. ПХБ-157 0.15 0.94 0.61 0.04 0.02 0. ПХБ-167 0.16 0.90 0.71 0.09 0.02 0. 6-ХБ (сумма) 73.65 92.79 44.26 4.41 2.48 3. ПХБ-180 1.03 7.30 0.51 0.39 0.34 0. 7-ХБ (сумма) 3.47 20.41 10.47 1.56 1.25 1. Общая сумма ПХБ 142.78 425.59 154.95 27.79 24.78 46. ДДЕ 2.40 5.50 2.67 1.68 1.36 1. ДДТ+ДДД 11.25 21.61 23.99 2.92 0.94 2. Сумма ДДТ, ДДД и ДДЕ 13.65 27.11 26.66 4.60 2.30 4. ГХБ 0.78 0.83 0.36 0.49 0.34 0. В России нормы содержания СОЗ в ДО отсутствуют, хотя в других странах они имеются.

Например, согласно канадскому природоохранному законодательству временные безопасные нормы (interim freshwater sediment quality guidelines, ISQG) и возможные действующие уровни (probable effect levels, PEL) для ДО пресноводных экосистем равняются (ISQG/PEL): ДДТ – 1.19/4.77, ДДД – 3.54/8.51, ДДЕ – 1.42/6.75, сумма ПХБ – 34.1/277 мкг/кг сухой массы (Canadian Council…, 2002). Для ГХБ нормативы не установлены. Полученные результаты показывают, что содержание ДДТ и его метаболитов в районе г. Череповца на ст. 1–3 превышает допустимые суммарные значения ISOG (6.15 мкг/кг) в 2–4 раз, а на ст.2 и 3 – даже превышает в 1.5 раза зна чения PEL. Для ПХБ превышение безопасных уровней ISOG на ст.1 и 3 около 4.5 раза, а на ст. оно достигает 12 раз. Значения PEL на этой станции превышены в 1.5 раза. На остальных иссле дованных участках водохранилища уровни ДДТ и ПХБ для обоих показателей находятся ниже или чуть выше (ст.6) нормативных.

В мышцах леща также обнаружены СОЗ, среди которых на всех станциях, за исключением ст.6, преобладают ПХБ (Табл. 2). Содержание ХОП на один-два порядка ниже.

В пространственном отношении СОЗ в мышцах леща распределяются на разных станциях не равномерно. Их концентрации на ст.2 и 3 выше, чем на ст. 4–6. Максимальные значения – на ст. или 3, минимальные – на ст.5 или 6, в зависимости от СОЗ. Состав изомеров ГХЦГ во всех образ цах мышц представлен -, - и -ГХЦГ. Их соотношение в пробах из разных участков близкое. До ля -ГХЦГ составляет 16–38%, -ГХЦГ – 30–56% и -ГХЦГ – 19–33%. Соотношение ДДТ и его ме таболитов в пробах на разных станциях одинаковое: сумма ДДТ и ДДД составляет 67–71%, ДДЕ – 29–33%. Состав ПХБ представлен 3-ХБ, 4-ХБ, 5-ХБ, 6-ХБ и 7-ХБ, однако между станциями он за метно варьирует. На ст. 2–4 профиль ПХБ в целом сходный. Доля 3-ХБ составляет 0–10%, доля 7 ХБ – 7–9 %. Основная часть (80–92%) представлена 4-ХБ, 5-ХБ и 6-ХБ. Их соотношение немного меняется от ст.2 к ст.4: доля 5-ХБ снижается с 47 до 35%, 4-ХБ возрастает с 17 до 23%, а 6-ХБ оста ется неизменной на уровне 25–28%. На ст. 5 ПХБ представлены 3-ХБ и 4-ХБ в соотношении 29 и 71%, а на ст. 6 обнаруживаются лишь 5-ХБ.

Таблица Содержание ПХБ и ХОП (мкг/кг сырой массы) в мышцах леща на разных участках Рыбинского водохранилища Станции Соединения 2 3 4 5 ПХБ-28/31 3.00 0.54 1.12 1.90 2. 6.00 1.31 2.32 1.05 5. 3-ХБ (сумма) ПХБ-52 0.64 1.04 0.45 0.50 0. 8.72 8.91 5.14 2.60 2. 4-ХБ (сумма) ПХБ-101 3.15 2.64 1.14 0.50 0. ПХБ-105 2.70 1.75 0.66 0.09 0. ПХБ-118 6.26 5.10 1.93 0.04 0. 23.77 19.95 7.55 0.14 0. 5-ХБ (сумма) ПХБ-138 3.96 3.97 1.49 0.40 0. ПХБ-153 4.29 4.76 1.81 0.40 0. ПХБ-156 0.25 0.31 0.08 0.05 0. ПХБ-157 0.65 0.66 0.25 0.05 0. ПХБ-167 0.14 0.08 0.03 0.05 0. 14.43 13.87 5.40 1.90 1. 6-ХБ (сумма) ПХБ-180 1.37 1.69 0.64 0.20 0. 7-ХБ сумма 3.85 4.15 1.54 1.00 1. Общая сумма ПХБ 50.76 48.19 21.95 3.65 0. ДДЕ 2.24 1.66 0.93 0.82 0. ДДТ+ДДД 4.57 3.62 1.99 1.99 1. Сумма ДДТ, ДДД и ДДЕ 6.80 5.28 2.92 2.80 1. -ГХЦГ 0.57 0.51 0.39 0.19 0. -ГХЦГ 1.46 0.43 1.40 0.28 0. -ГХЦГ 0.57 0.46 0.55 0.18 0. Сумма изомеров ГХЦГ 2.60 1.39 2.34 0.64 0. ГХБ 0.19 0.41 0.29 0.17 0. Обнаруженные уровни суммарного содержания ХОП (ДДТ и ГХЦГ) в мышцах леща близки к аналогичным показателям, зарегистрированным в тот же период в Азовском море у судака (2– мкг/кг сырой массы), и в несколько раз ниже, чем у осетровых рыб (8–99 мкг/кг) (Клёнкин и др., 2008). Это значительно ниже величин максимально допустимых уровней (МДУ), установленных в России для ДДТ и ГХЦГ в пресноводной рыбе – 300 и 30 мкг/кг сырой массы, соответственно (Ги гиенические нормативы…, 1996). Канадские нормативы остаточного содержания суммы ДДТ и его метаболитов в тканях рыбы, опасные для её потребителей, составляют 14 мкг/кг сырой массы (Canadian Council…, 2001). Тридцать лет назад (1978 г.) содержание ДДТ (с метаболитами) и линда на (-ГХЦГ) на ст. 5–6 в другом виде бентофаге, плотве (Rutilus rutilus L), в расчете на целую рыбу было 18–21 и 4–8 мкг/кг сырой массы, соответственно (Майер и др., 1981). Это в 6–12 раз выше то го, что сейчас наблюдается в леще в этом районе, и в 1.5–3 раза выше того, что обнаруживается в районе г. Череповца. Эти данные позволяет говорить о снижении за прошедший период нагрузки ДДТ и ГХЦГ на экосистему водохранилища. Однако высокая суммарная доля ДДТ и ДДД как в мышцах рыб (около 70%), так и в ДО (40–90%) свидетельствует о достаточно свежем поступлении пестицида в экосистему водохранилища.

В отличие от ХОП содержание ПХБ в мышцах леща заметно выше (50.762 мкг/кг), чем у азо воморских судака (1–8.8 мкг/кг) и осетровых (1–30 мкг/кг) (Клёнкин и др., 2008). По гигиениче ским нормативам РФ величина МДУ в пресноводной рыбе и рыбопродуктах для общего содержа ния ПХБ установлена в 300 мкг/кг сырой массы (Гигиенические нормативы…, 1996). Причем этот норматив рассчитан для суммы производных ПХБ и ХОП. Российские нормативы по содержанию отдельных конгенеров ПХБ отсутствуют. Суммарное содержание ХОП и ПХБ в мышцах леща из наиболее загрязненного участка водохранилища (ст.2) около 60 мкг/кг. Это в 5 раз ниже установ ленных в России норм. Однако канадские нормативы опасного для потребителей остаточного со держания ПХБ в рыбе, рассчитанные с учетом фактора токсической эквивалентности ВОЗ (WHO TEFs) и токсических эквивалентов (TEQ) отдельных конгенеров, составляют 0.79 нг TEQ/кг сырой массы (Canadian Council…, 2002). В мышцах леща обнаружено 5 наиболее токсичных конгенеров ПХБ, для которых известны значения WHO-TEFs: 105, 118, 156, 157 и 167. Исходя из их содержа ния в мышцах, расчетные значения суммарных TEQ составили для рыбы на ст. 2, 3 и 4 соответст венно 1.35, 1.17 и 0.42 нг TEQ/кг сырой массы. На ст.5 и 6 значения TEQ были на два порядка ниже.

Полученные данные показывают, что в зоне влияния череповецкого индустриального комплекса (ст.2,3) содержание ПХБ в мышцах леща превышает безопасный для потребителей уровень в 1.5– раза. На остальных участках водохранилища их содержание существенно ниже этого уровня.

Т.о., установлено, что в экосистеме Рыбинского водохранилища присутствуют ХОП и ПХБ.

Их качественный состав и содержание носят пространственно неоднородный характер, что свиде тельствует о локальном источнике поступления. Несмотря на запрет в СССР, а затем в России, про изводства и применения ХОП и ПХБ, их уровень в отдельных районах водохранилища остается достаточно высоким. Максимальные уровни содержания этих СОЗ обнаруживаются в ДО и рыбе в зоне влияния Череповецкого индустриального комплекса. Содержание СОЗ в этом районе водохра нилища в ДО достигает уровней, при котором они могут влиять на жизнедеятельность гидробио нтов, а в рыбе – представлять опасность здоровью для ее потребителей.

Работа выполнена при финансовой поддержке РФФИ (грант 08-05-00805).

Литература Гигиенические нормативы содержания пестицидов в объектах окружающей среды, 1996. ГН 1.1.546– 96. Утверждены Постановлением Госкомсанэпиднадзора России от 25 сентября 1996 г. N 19.

Клёнкин А.А., Короткова Л.И., Корпакова И.Г., Корниенко Г.Г., 2008. Хлорорганические пестициды и полихлорбифенилы в промысловых рыбах Азовского моря // Вопр. рыбол. Т. 9, № 2(34). С. 495–502.

Колпакова Е., Лулоф И., Руттемаан Й., 1996. Проект «Волга в Череповце». Отчет об исследованиях, проведенных в г.Череповце в августе 1995 г. Н.Новгород: Экоцентр «Дронт». 23 с.

Майер Ф.Л., Пети Дж.Д., Козловская В.И., Флеров Б.А., 1981. Определение остаточных количеств пес тицидов в рыбах Рыбинского водохранилища // Гидроб. ж. Т. 17, № 5. С. 83–87.

Чуйко Г.М., Законнов В.В., Герман А.В., Бродский Е.С., Шелепчиков А.А., Фешин Д.Б., Тиллитт Д.Э., 2008. Распределение полихлорированных бифенилов в экосистеме Рыбинского водохранилища при их ло кальном поступлении // Современное состояние водных биоресурсов: материалы научной конференции, по священной 70-летию С.М. Коновалова. Владивосток: ТИНРО-центр. С. 680–685.

Шелепчиков А.А., Бродский Е.С., Фешин Д.Б., Жильников В.Г., 2008. Определение полихлорирован ных бифенилов и пестицидов в объектах окружающей среды и биоматериалах методом хроматомасс-спектро метрии высокого разрешения // Масс-спектрометрия. Т. 5, № 4. С. 245–258.

Canadian Council of Ministers of the Environment, 2001. Canadian tissue residue guidelines for the protection of consumers of aquatic biota: Summary tables. Updated. In: Canadian environmental quality guidelines. 1999.

Canadian Council of Ministers of the Environment, Winnipeg.

Canadian Council of Ministers of the Environment, 2002. Canadian sediment quality guidelines for the protection of aquatic life: Summary tables. Updated. In: Canadian environmental quality guidelines. 1999. Canadian Council of Ministers of the Environment, Winnipeg.

КОРРЕЛЯЦИЯ БИОХИМИЧЕСКИХ ПОКАЗАТЕЛЕЙ С ЛИНЕЙНО-ВЕСОВЫМИ ПАРАМЕТРАМИ ОСОБЕЙ НЕКОТОРЫХ ВИДОВ РЫБ М.В. Чурова1, О.В. Мещерякова1, М.И. Шатуновский2, Н.Н. Немова Учреждение Российской академии наук Институт биологии Карельского научного центра РАН, г. Петрозаводск, Россия Учреждение Российской академии Институт проблем эволюции и экологии Им. А.Н. Северцова РАН, г. Москва, Россия e-mail:mchurova@yandex.ru Введение Рост – важный аспект в оценке общего состояния популяции рыб и каждой особи в отдельно сти. Существует много способов оценки роста рыб от традиционных и прямых измерений, таких как изменение длины, веса, к более современным, например, изучение уровня экспрессии генов.

Исследования последних лет (Hevroy et al., 2006;

Overturf, Hardy, 2001, Pelletier et al., 1995;

Tripathi and Verma, 2004;

Vinagre et al., 2008) показывают, что в оценке скорости роста рыб могут быть ис пользованы активность ферментов энергетического и пластического обмена, экспрессия генов мио зина и некоторых ферментов, показатель РНК/ДНК.

В данной работе мы изучали взаимосвязь линейно-весовых характеристик особей форели, ря пушки, беломорки с уровнем их некоторых биохимических показателей. Определялись следующие показатели: соотношение РНК/ДНК, уровень экспрессии генов тяжелой цепи миозина и цитохром с оксидазы (только для форели), активность некоторых ферментов углеводного и энергетического об мена.

Материалы и методы Исследовали особей разных возрастных групп ряпушки Coregonus albula L.(оз. Сямозеро, Республика Карелия), беломорки Clupea Harengus pallasi natio maris-albi Berg (Белое Море), форели Parasalmo mykiss Walb (форелевое хозяйство, Онежское озеро). У каждой особи определяли длину тела по Смиту (AC), общий вес (массу) тела. Общую активность ферментов лактатдегидрогеназы (ЛДГ, 1.1.1.27), глюкозо-6-фосфатдегидрогеназы (Г-6-ФДГ, 1.1.1.49) и 1-глицерофосфатдегидроге назы (1-ГФДГ, 1.1.1.8) определяли в мышцах и печени рыб по общепринятым методикам (Кочетов, 1980). Активность цитохром с оксидазы (ЦО, КФ 1.9.З.1.) определяли по методике Smith (Smith, 1955), при этом цитохром с восстанавливали двукратным по массе количеством аскорбиновой ки слоты в 0.02 М фосфатном буферном растворе (рН 7.0) в течение 2 часов и затем на колонке с сефа дексом G-25 выделяли в восстановленной форме свободным от избытка восстановителя.

Тотальную РНК выделяли из белых мышц с помощью набора «для выделения тотальной РНК Yellow Solve» (Клоноген, г. Санкт-Петербург). ДНК белых мышц выделяли методом Альанаби и Мартинеса (Aljanabi and Martinez, 1997). Концентрациию РНК и ДНК определяли спектрофотомет рически. Уровень экспрессии генов тяжелой цепи миозина и цитохром с оксидазы определяли в бе лых мышцах методом полимеразной цепной реакции в режиме реального времени (ПЦР). Тоталь ную РНК обрабатывали ДНКазой (10 ед/мл) (Силекс). Комплементарную ДНК (кДНК) синтезиро вали из препарата тотальной РНК с использованием MMLV-обратной транскриптазы и случайных гексонуклеотидов (набор «Синтез первой цепи ДНК», Силекс). Амплификацию проводили на при боре i-Cycler с оптической приставкой IQ5 (BioRad, США) с использованием реакционной смеси 2,5х для проведения ПЦР-РВ в присутствии интеркалирующего красителя SYBR Green I (Синтол).

Праймеры для актина и тяжелой цепи миозина подбирали с помощью программы Beacon Designer 5.0. Последовательности праймеров следующие: миозин (MyHC) (GenBank Z48794) прямой 5’ GCTGAGAAGGACGAGGAGATG-3’, обратный 5’- GCCTGCCTGTTGGAGTGG-3’;

-актин прямой обратный (GenBank AJ438158) 5’-TGGACTTTGAGCAGGAGATGG-3’, 5’ TCGTGGATACCGCAAGACTC-3’. Последовательность олигонуклеотидов для амплификации гена цитохром с оксидазы (COX4): прямой 5’-TACGTGGGGGACATGGTGTT- 3’, 5’ CCCAGGAGCCCTTCTCCTTC -3’(Koltitz C. et al., 2008). Протокол ПЦР: денатурация ДНК при 95оС 5 мин;

повторяющиеся циклы (50): денатурация ДНК при 95оС 20 с, отжиг праймеров при 59оС по 30 с, элонгация ДНК при 72оС по 30 с. После ПЦР проводили процедуру плавления фраг ментов ДНК (с 59 до 95оС с шагом 0,5оС). Концентрацию матричной РНК в виде кДНК определяли по стандартной кривой. Уровень экспрессии исследуемых генов нормализовали по уровню экспрес сии референсного гена -актина. Данные выражались как отношение концентрации мРНК иссле дуемого гена к концентрации мРНК -актина, умноженное на константу (100) для удобства интер претации данных.

Различия в активности ферментов и других показателей оценивали по критерию Т Стьюдента.

Различия считали достоверными при р0,05. Коэффициенты корреляции между сравниваемыми по казателями определяли по Пирсону и Спирмену.

Результаты и обсуждение В таблице 1 приведены характеристики выборок исследуемых видов рыб.

Показатель РНК/ДНК. Количественное определение нуклеиновых кислот в скелетных мыш цах и отношение РНК/ДНК используется как показатель скорости роста на ранних стадиях развития пресноводных и морских рыб в зависимости от влияния различных условий (питание, стресс, чис тота водоема и др.) и возраста. Он показывает, как меняется уровень клеточной РНК и, соответст венно синтез белка, при постоянной концентрации ДНК в клетке (Vinagre et al., 2008;

Grant, 1996).

Таблица Ихтиологические показатели исследуемых видов рыб Показатели Ряпушка Беломорка Форель Количество особей 45 23 Возраст 0+, 2+,3+ 3+ 1+, 2+ Длина (АС), см min-max 12,2–19,3 13,1–16,3 18,0–54, Вес Q, г min-max 22,6–99,7 20,9–41,7 75,9–2397, Результаты нашего исследования показали отрицательную корреляцию показателя РНК/ДНК с размерами рыб. При этом у форели наиболее сильная корреляция отмечается в возрасте 1+ (табл.

2). Для ряпушки значения коэффициента корреляции РНК/ДНК с длиной тела и весом составили (– 0,53) и (–0,48), соответственно. Такая зависимость свидетельствует о том, что относительная ско рость роста крупных рыб меньше, чем у мелких, что согласуется с литературными данными, полу ченными для трески (Buckley, Lough, 1987) и сайды (Houlihan et al., 1993). На наш взгляд это связа но с тем, что в процессе роста животного и увеличения его массы происходит снижение скорости ростовых процессов. Снижение темпов роста при увеличении размеров тела показано для всех групп позвоночных животных (Дгебуадзе, 2001).

Таблица Значения коэффициентов корреляции между линейно-весовыми и некоторыми биохимическими показателями особей радужной форели двух возрастов Линейно-весовые Значения коэффициентов корреляции показатели РНК/ДНК Экспрессия гена миозина Экспрессия гена цитохромоксидазы 1+ 2+ 1+ 2+ 1+ 2+ Вес –0,43* 0,54 0,54* 0,69* 0,51* 0, Длина –0,50* 0,52 0,52* 0,74* 0,61* 0, * – достоверность значения коэффициента корреляции.

Соотношение линейно-весовых показателей форели с индексом РНК/ДНК указывает на то, что этот показатель можно использовать в оценке скорости роста только молоди форели, так как достоверная корреляция была обнаружена только у двухлеток (1+). Вероятно, это связано с тем, что в ранние периоды онтогенеза рыб протекают, главным образом, процессы дифференциации клеток мышечной ткани, что, в частности, показано на заводской молоди семги (Лебская, Зайцев, 1985). В более старшем возрасте усиливаются процессы гипертрофии и массанокпления. Таким образом, от сутствие зависимости между индексом РНК/ДНК и линейно-весовыми параметрами у трехлеток (2+) указывает на то, что в этом возрасте синтез белка в мышцах связан не столько с процессом дифференциации клеток мышечной ткани и ростом тела рыб, сколько с другими функциями мы шечного белка и, вероятнее всего, с сократительной.

Уровень экспрессии гена тяжелой цепи миозина (MyHC) Согласно ряду исследовательских работ, экспрессия гена тяжелой цепи миозина положитель но коррелирует с темпом роста радужной форели и других видов рыб, тем самым, делая возмож ным использование этого показателя в качестве маркера для мышечного роста (Overturf, Hardy, 2001;

Dhillon et al., 2008).

Наши исследования показывают, что показатель экспрессии гена миозина, в отличие от ин декса РНК/ДНК является более точным и удобным критерием изменчивости линейно-весовых ха рактеристик и индикатором темпа роста форели. Этот показатель положительно коррелирует с ве сом и длиной рыб независимо от их возраста и пола (табл. 2). Следует отметить также, что у иссле дованной форели экспрессия гена миозина увеличивалась с возрастом, что подтверждает наши предположения о том, что у трехлеток форели (2+) прирост скелетной мускулатуры и массанакоп ление происходит более интенсивно, чем у двухлеток (1+).

Активность фермента цитохром с оксидазы При исследовании активности ЦО в белых мышцах форели было обнаружено, что активность фермента достоверно положительно коррелировала с весом и длиной рыб (табл.3), однако у рыб бо лее старшего возраста в некоторой степени снижалось значение коэффициентов. Такая же зависи мость была показана нами и на ряпушке (Мещерякова и др., 2008).

Анализ полученных нами данных (табл. 2) по экспрессии гена цитохром оксидазы в белых мышцах форели показал, что для двухлеток (1+) уровнь экспрессии гена ЦО положительно корре лирует с показателями веса и длины особей обоих полов. Для трехлеток форели (2+) не установлено корреляции этого показателя с линейно-весовыми характеристиками рыб, что указывает на важ ность аэробного метаболизма в росте и развитии рыб на самых ранних этапах онтогенеза.

Особо важное значение аэробный метаболизм имеет для клеток печени рыб. Здесь тесно пере плетаются метаболические пути углеводного, липидного и белкового обмена, синтезируются раз личные соединения для пластического и энергетического обмена, осуществляется детоксикацион ная функция. Энергообеспечение клеток печени осуществляется главным образом за счет аэробного синтеза АТФ. Следует отметить, что в печени ряпушки и беломорки высокие показатели веса и раз мера положительно коррелировали с активностью ЦО. Для ряпушки значения корреляции ЦО с ве сом составили (+0,67), с длиной (+0,63);

для беломорки (+0,61) и (+0,76), соответственно. Поэтому активность этого фермента можно использовать в оценке энергообеспечения печени, ее функцио нальной активности и общего состояния организма.

Активность фермента лактатдегидрогеназы Активность фермента ЛДГ в белых мышцах рыб связана с участием в анаэробном гликолизе, который является главным процессом энергообеспечения при интенсивных сокращениях мышц. Ес ли оценивать темпы прироста мышечной массы и тип двигательного режима особей, то наибольшая скорость прироста мышечной массы у рыб и других позвоночных наблюдается при выполнении кратковременных силовых сокращений (Иванов и др., 1977;

Аминева и др., 1984). Данные корреля ционного анализа между показателями веса, длины и активностью фермента показали, что самые крупные особи форели имели наибольшую активность ЛДГ, причем достоверная корреляция отме чалась для всех возрастов (табл.3). Для ряпушки установлены такие же зависимости (Мещерякова и др., 2008). Поскольку достоверная корреляция ЛДГ с весом была выражена сильнее, чем с длиной тела, это указывает на более сильную связь этого показателя с приростом мышечной массы, чем с увеличением длины тела рыб. Обнаруженные возрастные различия этого показателя вместе с дан ными о разном уровне экспрессии миозина у двух- и трехлеток форели подтверждают наши пред положения о том, что скорость прироста мышечной массы у форели в возрасте 2+ выше, чем в воз расте 1+.

Таблица Значения коэффициентов корреляции между линейно-весовыми показателями и активностью ферментов в органах форели Значения коэффициентов корреляции Линейно- весовые с ферментами белых мышц с ферментами печени показатели ЦО ЛДГ Г-6-ФДГ 1-ГФДГ 1+ 2+ 1+ 2+ 1+ 2+ 1+ 2+ Вес 0,78* 0,51* 0,69* 0,64* 0,54* 0,75* 0,87* 0,93* Длина 0,65* 0,52* 0,45* 0,53* 0,49 0,41 0,53* 0, * – достоверность значения коэффициента корреляции.

Таблица Значения коэффициентов корреляции между линейно-весовыми показателями и активностью 1-глицерофосфатдегидрогеназы и глюкозо-6-фосфатдегидрогеназы в печени ряпушки Значения коэффициентов корреляции Линейно-весовые Г-6-ФДГ 1-ГФДГ показатели 0+ 2+ 3+ 0+ 2+ 3+ Вес 0,64* 0,65* 0,69 * 0,69* 0,73* 0,78* Длина 0,50* 0,53* 0,54 0,55* 0,59 0, * – достоверность значения коэффициента корреляции Активность ферментов 1-глицерофосфатдегидрогеназы и глюкозо-6-фосфатдегидрогеназы Важнейшую роль в процессах роста и развития организма рыб, особенно в раннем онтогенезе играет печень.

Роль фермента 1-ГФДГ в печени связана, главным образом, с процессом синтеза глицерофосфата из углеводов, который используется для синтеза структурных и запасных липидов (Harmon, Sheridan, 1992). Фермент Г-6-ФДГ участвует в функционировании пентозофосфатного пу ти, посредством которого образуются пентозы, использующиеся в синтезе нуклеиновых кислот, и генерируется восстановитель в форме НАДфН, использующийся в реакциях биосинтеза стероидов и жирных кислот (Tripathi, Verma, 2004). Таким образом, указанные ферменты печени играют важ ную роль в процессах пластического обмена, синтезе структурных и запасных липидов. По резуль татам нашего исследования в печени форели и ряпушки была отмечена положительная корреляция между показателями веса, длины и активностью ферментов 1-ГФДГ и Г-6-ФДГ (табл.3 и табл.4).

Особенно высокие значения коэффициентов корреляции, увеличивающиеся с возрастом, наблюда ются между активностью этих ферментов и весом рыб. Это, скорее всего, связано с усилением син теза и накоплением запасных веществ с возрастом.

Заключение Таким образом, в результате исследований были установлены взаимосвязи некоторых биохи мических параметров с линейно-весовыми характеристиками рыб. Согласно полученным данным, показатель РНК/ДНК отрицательно коррелирует с длиной и весом рыб, что указывает на снижение скорости ростовых процессов с увеличением размеров тела. Наблюдаемая положительная корреля ция активности ЦО мышц и печени с размерами рыб позволяет заключить о значимости аэробного метаболизма в процессах роста, особенно на первых стадиях жизни. С увеличением веса в печени рыб увеличивается активность ферментов 1-ГФДГ и Г-6-ФДГ, что указывает на интенсификацию процессов липогенеза. Активность ЛДГ положительно коррелирует с размерами тела рыб. Уровень экспрессии гена тяжелой цепи миозина коррелирует с размерами особей форели. Установленное увеличение экспрессии гена миозина с длиной и весом форели позволяет заключить об усилении прироста мышечной массы в возрасте 2+.

Работа выполнена при финансовой поддержке гранта Президента РФ «Ведущие научные школы России» НШ-306.2008.4;

гранта РФФИ 08-04-01140, программы ОБН РАН «Биологические ресурсы России».

Литература Аминева В. А., Яржомбек А. А., 1984. Физиология рыб. M.: Легкая и пищевая промышленность. 200 с.

Дгебуадзе Ю. Ю., 2001. Экологические закономерности изменчивости роста рыб. М.: Наука. 276 с.

Иванов И. И. Коровкин Б. Ф., Пинаев Г. П., 1977. Биохимия мышц. М.: Медицина. 344 с.

Кочетов Г.А., 1980. Практическое руководство по энзимологии. М.: Высшая школа. 272 с.

Лебская Т.К., Зайцев В.Б. 1985. Ультраструктура белой скелетной мускулатуры молоди семги (Salmo salr L.), выращиваемой на рыбоводном заводе. – В кн.: Проблемы биологии и экологии атлантического лосо ся. Л.: Наука, C. 34–45.

Мещерякова О.В., Чурова М.В., Немова Н.Н. 2008. Биохимические методы оценки роста и развития рыб. Корреляции активности некоторых ферментов метаболизма с показателями веса и роста особей и у раз ных возрастных групп ряпушки оз. Сямозеро (Республика Карелия) // Организмы, популяция, экосистемы:

проблемы и пути сохранения биоразнообразия: Материалы всероссийской конференции с международным участием «Водные и наземные экосистемы: проблемы и перспективы исследований». Вологда. С.71–75.

Aljanabi S. M., Martinez I., 1977. Universal and rapid salt-extraction of hight quality genomic DNA for PCR based techniques // Nucleic Acid Res. V.25. P.4692–4693.

Buckley L. G., Lough R. G., 1987. Recent growth, biochemical composition and prey field of larval haddok, Melanogrammus aeglefinus and Atlantic cod, Gadus morphua on Georges Bank // Can.J.Fish.aquat.Sci. V.44. P.4–25.

Dhillon R. S., Wang Y., Tufts B. L., 2008. Using molecular tools to assess muscle growth in fish: Applications for aquaculture and fisheries management // Comparative Biochemistry and Physiology. Part C: Toxicology and Pharmacology. V.148. P.452.

Grant G. C. 1996., RNA-DNA ratios in white muscle tissue biopsies reflect recent growth rates of adult brown trout // Journal of Fish Biology. N48. P.1223–1230.

Harmon J. S., Sheridan M. A., 1992. Glucose-stimulated lipolysis in rainbow trout (Oncorhynchus mykiss) liver // J. Fish Physiol. and Biochem. V. 10. P.189–199.] Hevroy E.M., Jordal A-E.O., Hordvik I., Espe M., Hemre G-I., Olsvik P.A. 2006. Myosin heavy chain mRNA expression correlates higher with muscle protein accretion than growth in Atlantic salmon, Salmo salar // Aquaculture. V. 252. P.453–461.

Houlihan D.F., Mathers E.M., Foster A., 1993. Biochemical correlates of growth rate in fish // Fish Ecophysiology / J.C. Rankin, F.B. Jensen. – London UK. Chapter 2. P.45 – 71.

Koltitz C., Borthaire M., Richart N., Corraze G., Panserat S., Vachot C., Lefevre F., Medale F., 2008. Liver and muscle metabolic changes induced by dietary energy content and genetic selection in rainbow trout (Oncorhynchus mykiss) // Am. J. Physiol. Regul.Integr. Comp. Physiol. V.294. P.1154–1164.

Overturf K., Hardy R., 2001. Myosin expression levels in trout muscle: a new method of monitoring specific growth rates for rainbow trout Oncorhynchus mykiss (Walbaum) on varied planes of nutrition // Aquat. Res. V.32.

P.315–322.

Pelletier D. Blier P., Dutil J.D., Guderley H. 1995. How should enzyme activities be used in fish growth studies? // J. Exp. Biol. V.198. P.1493–1500.

Smith L., 1995. Spectrophotometric assay of cytochrome с oxidase // Methods in Biochem. Analysis. V.2.

P.427–434.

Tripathi G., Verma P., 2004. Sex-specific metabolic changes in the annual reproductive cycle of a freshwater catfish // Comparative Biochemistry and Physiology. Part B: Biochemistry and Molecular Biology. V.137. P.101– 106.

Tripathi G., Verma P., 2004. Scaling effects on metabolism of a teleost //Journal of Experemental zoology.

V.301A. P.718–716.

Vinagre C., Fonseca V., Maia A., Amara R., Cabral H., 2008. Habitat specific growth rates and condition indices for the sympatric soles Solea solea (Linnaeus, 1758) and Solea senegalensis (Kaup, 1858), in the Tagus estuary, Portugal, based on otolith daily increments and RNA-DNA ratio // Journal of Applied Ichthyology. V. P.163–169.

CORRELATION OF BIOCHEMICAL PARAMETERS AND SIZES OF INDIVIDUALS OF SEVERAL FISH SPECIES M.V. Churova1, O.V. Mescherjakova1, M.I. Shatunovsky2, N.N. Nemova Institute of biology of Karelian Research Centre, Russian Academy of Sciences, Petrozavodsk, Russia Severtsov Institute of Ecology and Evolution of RAS, Moscow, Russia e-mail: mchurova@yandex.ru The present study was designed to elucidate the relationship the several biochemical parameters with weight and length of fish. We studied the RNA/DNA ratio, expression of Myosin hard chain gene, activities of cytochrome c oxidase (CCO), lactate dehydrogenase (LDH), glucose-6-phosphate dehydrogenase (G6PDH) and 1-glycerophosphate dehydrogenase (GPDH) in whitefish, White Sea herring and rainbow trout.

ИНДИКАТОРНАЯ РОЛЬ ФИТОПЛАНКТОНА В ОЦЕНКЕ ДОЛГОВРЕМЕННЫХ ИЗМЕНЕНИЙ КАЧЕСТВА ВОД БОЛЬШИХ ОЗЕР ЕВРОПЕЙСКОГО СЕВЕРА А.Н. Шаров Учреждение Российской академии наук Институт водных проблем РАН, г. Москва, Россия e-mail: sharov_an@mail.ru Сообщества пресноводного фитопланктона обладают относительно высокой чувствительно стью к загрязнению, оцениваемому по химическим показателям качества вод. Кроме того, водорос ли имеют высокую скорость воспроизводства, что позволяет быстро реагировать на изменяющиеся условия среды [Баринова и др., 2006]. Изучению особенностей развития фитопланктона в условиях антропогенного эвтрофирования озер посвящено много работ [Петрова, 1990;

Трифонова, 1990].

Разработаны шкалы классификации трофического состояния водоемов по фитопланктону [Трифо нова, 1990;

Tikkanen, 1986]. Биоиндикационные аспекты экологии водорослей изучены достаточно полно [Баринова и др., 2006]. Наибольший интерес для оценки состояния водных экосистем пред ставляют долговременные исследования сообществ в изменяющихся условиях среды обитания.

Цель данной работы – оценить долговременные изменения структурных характеристик фито планктонных сообществ больших озер Европейского Севера России в условиях изменения качества вод при их антропогенном эвтрофировании, загрязнении тяжелыми металлами и органическими со единениями, поступающими со сточными водами городов, горнодобывающих и горноперерабаты вающих предприятий (оз. Имандра, оз. Умбозеро) и целлюлозобумажного комбината (оз. Онеж ское).

Материалы и методы Материалом для работы послужили результаты исследований автора с 1993 по 2007 гг. трех крупных водоемов Севера европейской части России: оз. Онежское (Карелия), оз. Имандра и оз.

Умбозеро (Кольский п-ов).

Природные особенности региона обусловливают олиготрофное состояние водной среды. Ус ловия формирования качества вод на участках, удаленных от промышленных предприятий, считали близкими к природным (фоновым). В природно-чистых районах содержание общего фосфора Робщ в воде в среднем составляет 6, общего азота Nобщ – 70–80 мкг/л (табл. 1). Поступление хозяйствен но-бытовых и промышленных сточных вод городов Петрозаводск, Кондопога, Апатиты и Монче горск увеличивают содержание Робщ в воде до 70 мкг/л (табл. 1). Несмотря на то, что в непосредст венной близости с оз. Умбозеро разрабатываются месторождения фосфорсодержащих руд, допол нительного обогащения вод фосфором не отмечается, сохраняется природное состояние (табл. 1), и фосфор остается лимитирующим показателем продуктивности водоема. Повышенное содержание в воде азота является, очевидно, следствием ведения взрывных работ.

Наблюдения на оз. Имандра проводили в 1993–2006 гг. преимущественно в летний период (июль–август) по всей акватории озера на 24 станциях. Исследование оз. Умбозеро – август 1994 и 2007 гг. На оз. Онежское отбор проб проводился в период открытой воды в 2001–2006 гг. на станциях.

Отбор проб фитопланктона, фиксация и дальнейшая обработка проводилась согласно обще принятым методикам [Гусева, 1959]. При эколого-географической характеристике фитопланктона придерживались разработанных и универсальных систем, принятых в экологии и биогеографии ви дов [Баринова и др., 2006, Давыдова, 1985;

Sladecek, 1973].

Таблица Некоторые лимнологические характеристики (средние данные за период исследований) исследованных водоемов (здесь и в табл. 2 в числителе – для загрязненных районов, в знаменателе – фоновых) Площадь Глубина Проз Робщ SO42 Nобщ Niобщ Cuобщ Озера зеркала, макс. рачность км2 м мкг/л мг/л 2–3 25–40 59–140 15–62 2–4 3– Онежское 9944 3–4 5–10 40–69 2–9 2–3 3– 2–4 30–71 125–433 8–67 5–16 15– Имандра 881 4–7 3–7 10–100 2–10 2–7 10– 4–5 6–13 280–403 2–3 2–5 4– Умбозеро 313 5–8 3–7 10–100 1–2 1–2 2– Результаты и обсуждение Первые исследования видового состава фитопланктона озер Онежского, Имандра и Умбозеро относится к началу прошлого века [Levander, 1905;

Вислоух, Кольбе, 1927;

Чернов, 1932;

Кольский диатомитовый…, 1934;

Воронихин, 1935;

Клубницкая, 1957;

Петровская, 1966;

Петрова, 1971].

Природные характеристики фитопланктона этих озер чрезвычайно схожи и в целом являются ха рактерными для глубоких олиготрофных озер с преобладанием диатомовых водорослей в течение всего вегетационного цикла. Количественные показатели фитопланктона фоновых (условно чис тых) районов и сегодня редко превышают 1 г/м3, а средние значения биомассы за вегетационный период находятся в пределах 0.3–0.5 г/м3.

В начале вегетационного сезона руководящий комплекс водорослей возглавляет диатомея Aulacoseira islandica. Наряду с ней, но в более поздний период весенней вегетации, увеличивается в планктоне роль Aulacoseira italica и A. alpigena. На поздней стадии существования весеннего комплекса A. islandica, продолжая лидировать в планктоне, вытесняется в эпилимнионе летними теп лолюбивыми видами диатомовых – Tabellaria fenestrata, Asterionella formosa, Fragilaria crotonensis.

Основная часть популяции A. islandica в течение лета опускается в нижние слои гиполимниона, где образует массовые скопления с сохраняющимся живым хлоропластом [Петрова, 1971].

Набор доминирующих видов в планктоне озер Онежского и Имандра за почти 40-летний пе риод наблюдений постоянно расширялся. Число массовых форм последних десятилетий прошлого столетия [Вислянская, 1998;

Яковлев, 1991;

Чекрыжева, 1993;

Чекрыжева, Сластина, 2002] значи тельно пополнилось за счет видов синезеленых, хлорококковых и криптофитовых водорослей, ак тивно развивающихся в озерах, подверженных процессам эвтрофирования, и часто оказывающихся там доминантами планктонных комплексов, как, например, в планктоне Ладожского оз. [Петрова, 1990]. Характерной особенностью является отсутствие десмидиевых водорослей в наиболее загряз ненных участках.

Начиная с 1990-х гг., в число доминантов поздневесеннего планктона вошла диатомовая во доросль Diatoma elongatum, в массе отмечаемая и в планктоне Ладожского оз. [Вислянская, 1998;

Петрова, 1990]. Представители рода Dinobryon (D. divergens, D. bavaricum) из золотистых, на исчез новение которых из планктона больших олиготрофных озер в период их эвтрофирования указыва ют многие авторы [Чекрыжева, Сластина, 2002], в Онежском оз. и в оз. Имандра продолжают оста ваться массовыми в период поздней весны и раннего лета.

Одной из характерных особенностей летнего и осеннего фитопланктона Онежского оз. 1990-х гг. является интенсивная вегетация синезеленых водорослей, начавшаяся уже в 1980-е гг. (Вислян ская, 1999). Среди наиболее распространенных синезеленых, в том числе и в оз. Имандра, следует отметить Oscillatoria tenuis, O. limosa, O. planctonica, Anabaena lemmermanii, A. hassalii, A. circinalis, Aphanizomenon flos-aquae и Microcystis aeruginosa, M. pulverea Заметно возрастает в последние годы роль хлорококковых, вольвоксовых и криптофитовых водорослей в летне-осеннем планктоне как Онежского оз., так и оз. Имандра. Среди постоянных форм, численность которых превышает прежний максимум [Петрова, 1971;

Вислянская, 1998], зна чительно распространены Sphaerocystis schroeteri, Ankistrodesmus pseudomirabilis, Scenedesmus quadricauda. К их числу присоединяется ряд новых видов – Dictyosphaerium pulchellum, Pandorina morum, Eudorina elegans, Pediastrum duplex, Chlamydomonas monadina, Planctococcus sphaerocysti formis, а также криптофитовые рода Cryptomonas.

Наиболее значительные изменения количественных показателей фитопланктона произош ли в Кондопожской и Петрозаводской губах Онежского озера. Начиная с конца 1980-х гг., отме чалось значительное развитие весеннего фитопланктона, во много раз превышающее величины биомассы, полученные для этих заливов в прежние годы (Вислянская, 1999, Чекрыжева, 2008).

В настоящее время обилие планктонной флоры и отмеченная структурная перестройка в видо вом составе, выразившаяся в увеличении числа видов, характерных для эвтрофных вод (Pandorina morum, Eudorina elegans, Diatoma elongatum и виды рода Cryptomonas, Chlamydomo nas), свидетельствуют о продолжающемся развитии антропогенного эвтрофирования. Количест венные характеристики фитопланктона характеризуют данные районы как мезотрофные (таб.

2). Согласно эколого-санитарным классификациям, воды Петрозаводской и Кондопожской губ по средним показателям фитопланктона в целом можно отнести к классу удовлетворительной чистоты.

Таблица Основные интегральные характеристики (средние значения и среднеквадратичные отклонения) фитопланктонных сообществ Индекс Биомасса, Численность, Cryptomonas, Chl «a», Озера Сапробность Шеннона В% г/м3 млн.кл/л мг/м 3.7±0.6 10.6±2.5 2.7±2.2 1.2±0.4 6.2±0.6 1.7±0. Онежское 2.9±0.3 1.5±0.4 0.7±0.5 0.2±0.1 2.9±0.4 1.4±0. 3.1±0.5 35.5±7.1 3.6±3.7 9.2±3.1 4.6±1.8 2.1±0. Имандра 3.4±0.2 0.8±0.1 0.8±0.4 0.8±0.2 1.2±0.2 1.3±0. 2.7±0.2 0.1±0.01 1.7±0.5 0.9±0.2 1.5±0.9 1.3±0. Умбозеро 2.5±0.2 0 0.9±0.3 0.7±0.2 0.8±0.1 1.2±0. Районы Центральное и Южное Онего дают интегральную характеристику состояния вод озе ра. По показателям фитопланктона они характеризуются как олиготрофные. Значения биомассы во дорослей в течение вегетационного периода редко превышают 1 г/м3. Антропогенное эвтрофирова ние отразилось на сообществе фитопланктона незначительным увеличением среднесезонного оби лия водорослей.

Биомасса и структура фитопланктона северной части Онежского оз. (Повенецкий зал.) за по следние два десятилетия практически не изменились, несмотря на поступление ежегодно 5 млн. т сточных вод, из которых лишь 5% подвергаются очистке [Экосистема Онежского…, 1990]. Это объясняется большими глубинами (до 100 м) и соответственно низкими температурами воды. Рас чет индексов сапробности на основе индикаторных видов фитопланктона показал значения S = 1.4– 1.7, что позволяет отнести водные массы губы к разряду достаточно чистых (олигосапробных и мезосапробных) вод.

Оз. Имандра испытывает антропогенное загрязнение преимущественно в северной части (Большая Имандра). Количественные и структурные изменения фитопланктона прослеживаются на расстоянии свыше 20 км от мест поступления сточных вод. В районах поступления сточных вод фи топланктон характеризуется большими колебаниями биомассы, которая может достигать 20 г/м3.

Индекс видового разнообразия (Шеннона) также изменяется в широких пределах: от 1.5 до 4.2 бит.

Изменения структуры биомассы фитопланктона связаны с увеличением доли криптофитовых водо рослей (иногда до 50%), зеленых (до 60%), среди диатомовых водорослей обилие видов рода Stephanodiscus достигало 50%. В зоне влияния подогретых вод Кольской АЭС зарегистрирована мак симальная численность динофитовой водоросли Ceratium hirundinella (20 тыс. кл/л). Юго-западная часть озера остается наиболее близкой к природному состоянию (табл. 2). Здесь средние значения общей биомассы фитопланктона 1 г/м3, численности – 0.8 млн.кл/л. Структура биомассы – типич ная для северных глубоких олиготрофных озер с преобладанием диатомовой флоры (70%).

По сравнению с другими озерами региона фитопланктон оз. Умбозеро имеет бедный видовой состав. Сопоставление наших данных с результатами более ранних исследований [Levander, 1905;

Клубницкая, 1957;

Петровская, 1966] показало, что состав диатомовой флоры практически не изме нился. Исключение представляют виды рода Aulacoseira, которые в последнее время становятся массовыми. Десмидиевые водоросли из доминирующих перешли в разряд редких.

Согласно существующим шкалам классификации трофического статуса водоемов, основанным на величине биомассы фитопланктона и содержании хлорофилла «а» [Трифонова, 1990], наиболее за грязненные участки акватории исследованных озер относятся к мезотрофному типу, а отдаленные от мест поступления сточных вод районы остались до настоящего времени олиготрофными. Использова ние модели В.В.Бульона [2005] для прогнозирования биомассы и потоков энергии ключевых функ циональных групп организмов в больших озерах Европейского Севера России показало, что годо вая продукция фитопланктона составляет 82-93 % общей продукции экосистемы, что в количест венном выражении соответствует 104-137 ккал/м2 в год.

Известно, что между индексом видового разнообразия, числом видов в сообществе и качест вом воды отсутствует линейная зависимость [Баринова и др., 2006]. Это подтверждают и наши ис следования планктонных водорослей. Однако такие показатели фитопланктона, как состав домини рующих видов, значения биомассы и индексов сапробности хорошо отражают состояние и тенден ции изменения водных экосистем.

В настоящее время список водорослей континентальных вод, имеющих индикаторное значе ние, достигает 6900 видов, в том числе 3127 видов-индикаторов сапробности [Баринова и др., 2006].

В исследованных озерах нами выделено несколько основных наиболее массовых индикаторных ви дов (рода Cryptomonas, Pandorina morum, Eudorina elegans, Ceratium hirundinella, Stephanodiscus rotula).

Выводы Характерной особенностью изменения видовой структуры фитопланктонных сообществ ис следованных озер является расширение круга массовых форм за счет видов зеленых и криптофито вых водорослей, являющихся индикаторами органического загрязнения природных вод и активно развивающихся в заливах озер (Кондопожская и Петрозаводская губы Онежского оз., губы Монче и Белая на оз. Имандра), наиболее подверженных антропогенному эвтрофированию. Несмотря на ло кальный характер загрязнения больших озер, изменения количественных показателей фитопланкто на прослеживаются на большом расстоянии от места поступления сточных вод. Массовое развитие водорослей приводит к увеличению первичной продукции. При этом гидрологические особенности (глубина, течение и температура воды) водных объектов служат основными лимитирующими фак торами их эвтрофирования.

Преобразования фитопланктонных сообществ в оз. Имандра, связанные с антропогенным за грязнением, прослеживается приблизительно на 80% всей акватории озера. Некоторый спад произ водства в 1990-х гг. и снижение объемов загрязняющих веществ не изменили количественные пока затели водорослей планктона, их значения остаются достаточно высокими для северных олиго трофных водоемов.

Несмотря на то, что в состав фитопланктона входит лишь часть водорослей, обитающих в во доеме, он служит хорошим индикатором качества воды в больших глубоких озерах и может ис пользоваться в оценке распространения загрязнения от локальных источников и исследовании про цессов самоочищении вод.

Литература Баринова С.С., Медведева Л.А., Анисимова О.В. 2006. Биоразнообразие водорослей-индикаторов окру жающей среды. Тель-Авив, 498 с.

Бульон В.В. Моделирование потоков энергии в озерных экосистемах как инструмент гидробиологиче ских исследований // Водные ресурсы. 2005. Т. 32, № 3. С. 361–370.

Вислоух С.М., Кольбе Р.Р. 1927. Материалы по диатомовым Онежского и Лососинного озер // Тр. Оло нецкой научной экспедиции, Вып. 1. Ч.5. 76 с.

Вислянская И.Г. 1998. Фитопланктон // Современное состояние водных объектов Республики Карелия.

По материалам мониторинга 1992-1997 гг. Петрозаводск: Изд-во Карельского научного центра РАН, С. 57– 60.

Вислянская И.Г. 1999. Структура и динамика биомассы фитопланктона // Онежское озеро. Экологиче ские проблемы. Петрозаводск: Изд-во Карельского научного центра РАН, С. 146–158.

Воронихин Н.Н. 1935. Водоросли и их группировки в озерах Имандра и Нотозеро (Кольский полуост ров) // Тр. Ботананического ин-та АН СССР. Сер. 2. Вып. 2. С. 107–150.

Гусева К.А. 1959. К методике учета фитопланктона // Тр. Ин-та биологии водохранилищ АН СССР. Т.

2. С. 44–51.

Давыдова Н.Н. 1985. Диатомовые водоросли - индикаторы природных условий водоемов в голоцене.

Л.: Наука, 244 с.

Клубницкая Г.Д. 1957. Гидробиологическая характеристика южной части Умбозера. Дипломная рабо та. Ленингр. гос. ун-т. Рукопись. Л., 79 с. (Фонды Кольского НЦ РАН).

Кольский диатомитовый сборник // Тр. Геоморфологического ин-та АН СССР. 1934. Вып. 8. 214 с.

Петрова Н.А. 1990. Сукцессии фитопланктона при антропогенном эвтрофировании больших озер. Л.:

Наука, 200 с.

Петрова Н.А. 1971. Фитопланктон Онежского озера // Растительный мир Онежского озера. Л.: Наука, С. 88–127.

Петровская М.В. 1966. Характеристика зоопланктона озер Мурманской области // Рыбы Мурманской области. Мурманск, С. 84–90.

Трифонова И.С. 1990. Экология и сукцессия озерного фитопланктона. Л.: Наука, 184 с.

Чекрыжева Т.А. 1993. Оценка качества вод Кондопожской губы Онежского озера по фитопланктону // Матер. III Всеросс. конф. по водной растительности внутренних водоемов и качество их вод. Петрозаводск:

Изд-во Карельского научного центра РАН, С.18–19.

Чекрыжева Т.А., Сластина Ю.Л. 2002. Индикация по фитопланктону зон загрязнения Кондопожской губы Онежского озера // Современные проблемы водной токсикологии. Тез. Всеросс. конф. Борок. С. 181.

Чекрыжева Т.А., Шаров А.Н. 2006. Современное состояние фитопланктона Онежского озера // Матер.

междунар. конф., посвященной 60-летию КарНЦ РАН. Северная Европа в XXI веке: природа, культура, эко номика. Петрозаводск: Изд-во Карельского научного центра РАН, С. 320–323.

Чернов В.К. 1932. Фитопланктон Шальской губы Онежского озера // Тр. Бородинской биологической станции в Карелии. Т. 6. Вып. 1. С. 25–26.

Экосистема Онежского озера и тенденции ее изменения. 1990. Л.: Наука, 264 с.

Яковлев В.А. 1991. Гидробиологические исследования внутренних вод Кольского Севера. Апатиты:

Изд-во Кольск. НЦ АН СССР, 53 с.

Levander K. 1905. Zur Kenntniss des Planktons einiger Binnenseen in Rusisch -Lapland // Festschrift f.

Palmrn. Bd 1, № 11. P. 1–40.

Sladecek V. 1973. System of water quality from the biological point of view // Archiv fur Hydrobiologie.

Beiheft Ergebnisse der Limnologie. №7. S. 1–128.

Tikkanen T. 1986. Kasviplanktonopas. Suomen Luonnonsuojelun Tuki Oy. Helsinki, 277 p.

Willen E. 1974. Metodik vid vaxtplanktonundersokningar // Naturvardsverkets limnologiska undersokning. В 76. S. 1–45.

СОВРЕМЕННОЕ СОСТОЯНИЕ ИХТИОФАУНЫ КУЙБЫШЕВСКОГО ВОДОХРАНИЛИЩА И ФАКТОРЫ, ВЛИЯЮЩИЕ НА ЕЁ ИЗМЕНЕНИЯ Ф.М. Шакирова Татарское отделение ФГНУ «ГосНИОРХ», г. Казань, Россия e-mail: gosniiorh@telebit.ru;

objekt_sveta@mail.ru Создание водохранилищ и сегодня вызывает много споров о целесообразности их строитель ства. Так как зарегулирование стока рек приводит к превращению речных экосистем в озерные, с совершенно другими гидрологическими, гидрохимическими и гидробиологическими характеристи ками, которые, в свою очередь, создают иные условия для жизни гидробионтов и определяют их со став, структуру и распределение. Однако, не отрицая негативного воздействия водохранилищ на речные экосистемы, в том числе их гидрофауну, с одной стороны, невозможно опровергнуть их не обходимость для социально-экономического развития общества с другой (Павлов и др., 1994).

Формирование ихтиофауны Куйбышевского водохранилища, являющегося водоемом много целевого назначения и созданного в густонаселенном промышленном районе Среднего Поволжья в 1955–1957 гг., шло за счет исходной фауны рыб бассейна Волги. Однако стихийное формирование ихтиофауны водохранилища в период его становления и самопроизвольное проникновение ряда ви дов препятствовали созданию в водоеме больших промысловых запасов ценных видов. Тогда как второстепенные и малоценные рыбы, обладая высокой экологической пластичностью, увеличили здесь свою численность. Этому способствовало также практически полное отсутствие работ по ре конструкции ихтиофауны путем увеличения численности хозяйственно значимых высокоценных видов.

Экосистема Куйбышевского водохранилища за 50-летний период своего функционирования прошла ряд последовательных этапов формирования искусственно созданных водоемов многоцеле вого назначения (Ballon, 1974;

Изменение структуры…, 1982;

Сальников, Решетников, 1991;

Шаки рова, Таиров, 2005). Известно, что при зарегулировании стока реки и создании водохранилища эво люция водоема затрагивает все его компоненты. В первые годы после залития водохранилища на блюдается высокий рост численности и биомассы всех гидробионтов, который затем снижается, ус танавливаясь на новом, более высоком уровне по сравнению с той, что была в условиях реки. При этом увеличивается видовой состав сообщества гидробионтов за счет лимнофильных видов, снижа ется состав реофильных видов, и появляются значительные возможности для повышения численно сти хищных рыб, выполняющих стабилизирующую роль в экосистеме. Дальнейшая картина функ ционирования экосистемы зависит от целого ряда факторов, воздействующих на водоем в результа те хозяйственной деятельности человека, к числу которых относятся:

-загрязнение водохранилища сбросными водами промышленных, коммунальных и сельскохо зяйственных предприятий, приводящее к ухудшению качества воды и, нередко, к снижению биоло гических показателей гидробионтов и уровня их развития;

-резкий сброс воды во время нереста или инкубации икры, приводящий к значительному сни жению численности основных фитофильных рыб;

-целенаправленная или случайная акклиматизация, воздействующая на ихтиофауну водоема и в значительной мере определяющая её развитие и многое другое.

До зарегулирования Волги на этом участке обитало 46 видов рыб, после создания водохрани лища число их практически не изменилось и достигло 48 по В.А. Кузнецову (1978, 2005). В настоя щее время в составе ихтиофауны Куйбышевского водохранилища выявлены значительные измене ния (табл.) за счет сокращения числа проходных и реофильных видов и перехода их в группу «ред ких» или «исчезающих». Сохранение и даже увеличение общего числа видов, произошло за счет целенаправленных вселенцев (белый и пестрый толстолобики, белый амур, пелядь и др.), видов, случайно завезенных в период акклиматизационных работ и самопроизвольно проникших (Шаро нов, 1972, Шакирова, 2007).



Pages:     | 1 |   ...   | 25 | 26 || 28 | 29 |
 



 
© 2013 www.libed.ru - «Бесплатная библиотека научно-практических конференций»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.