, , ,

<<


-  >> 
Pages:     | 1 |   ...   | 8 | 9 ||

...

-- [ 10 ] --

pUC18, Arthrobacter sp., SmaI XbaI, 1%- . , xylA pJQ200KS, pMTL7-1, (Fermentas). pJQ200KS pMTL7-1 , , 4 18 . Escherichia coli XL1-blue, , (, pJQ200KS;

, pMTL7-1), (-1---D-) - (X-gal).

pJQ200KS, pMTL7-1 : GCGAATTCTCAGCGGGCGCCCAGCA (xylA-end) CATCATATGACTCTTCAGCCAACCC (xylA-start).

E.coli XL1-blue, . Arthrobacter sp . pJQ200KSxylA pMTL7-1xylA.

pJQ200KSxylA pMTL7-1xylA Erwinia, Pseudomonas, Escherichia, Bacillus, Sarcina . xylA .

, pJQ200KSxylA, pMTL7-1xylA , Erwinia, Pseudomonas, Escherichia, Bacillus, Sarcina.

1. Lobanok A.G., Sapunova L.I., Dikhtievski Ya.O., Kazakevich I.O. Screening of glucose isomerase producing microorganisms // World Journal of Microbiology and Biotechnology. 1998.- Vol. 14, 2.- P.259-262.



.., .., .., .. , 2.

xylA Arthrobacter nicotianae // . I : , 6-12 .- , 2004.- .1.- .417.

.., .., .., .. 3.

xylA Arthrobacter nicotianae // . . . , , 26-28 2004 .- :

, 2004.- .166-169.

.., .., .., .., ..

4.

xylA Arthrobacter species Escherichia coli HB101 // . . . XXI , , 22-24 2002 .- ., 2002.- .132-134.

.., .., .., .., ..

5.

, Escherichia coli // . III . : , , 14-18 2005 .- .:

.. , .. , .. , .. *, .. * , . , , natali@mbio.bas-net.by * , . , , evtushenkov@bsu.by - . , , , , - . Bifidobacterium , , . , .

[1]. , , . , [2, 3]. -.





, .

Bifidobacterium adolescentis MC-42 B.bifidum 791, B.adolescentis 91 , , B. adolescentis MC-42 B.bifidum 791. . 0,1 -. E.coli XL1-Blue :

F:: Tn10 pro A+B+ lac la (lacZ) M15/recA1 end A1 gurA96 (Nalr) thi hsdR17 (rk mk+) sup E44 relA1 lac, UC-18.

Pospiech [4].

Sgorbati [5]. , , , .longum B.breve. [6, 7]. (1,25 - 9,5 ...). , , , [8], , , , , . . , B. adolescentis MC-42 B.bifidum 791 , .

, . pUC-18 . B. adolescentis MC-42 B.bifidum 791 EcoRI. UC-18 EcoRI. .coli XL1-Blue. , B.adolescentis 91. , . , , B.bifidum 791.

1. ., .., .., .., .. // 2004. .

48, 4. 57-61.

2. Y ildirim Z., Jonson M.G. Characterization and antimicrobial spectrum of bifidocin B, a bacteriocin produced by Bifidobacterium bifidum NCFB 1454 // J. Food Prot. 1998. V. 61, 1. P. 47-51.

3. J ack R.W., Tagg J. R., Ray B. Bacteriocins of gram-positive bacteria // Microbiological reviews. 1995. - V. 59, 2. - P. 170-200.

4.Pospiech A. //Adversatile quick-prep of genomic DNA from Grampositive bacteria. // Trendsin Genetics, Technical Tips online. 1995. V.11. - P.217-218.

5. .., .., .., .. // . 1990. .35, 7. .21-22.

6.Sgorbati B., Scardovi V., Leblanc D. // Plasmids in the Genus Bifidobacterium. // J. General Microbiology. 1982. V.128. - P.2121-2131.

7.Park M. S., Lee K. T., Ji G. E. // Isolation and characterization of two plasmids from Bifidobacterium longum. // Lett. Appl. Microbiol. 1997. V.25. - P. 5-7.

8.

.., .., .., .. - // . 1989. . 34, 6. . 462.

: ..

, . , . yanenko@genetika.ru , ( ) .

, , , , , . . , ( ) . $ ( ), .. 2% . , , 50 . $, 1, $. 15% . , , 1$/.

. 100 . , , - . , , . , .

, , , , , .

AvrPto DspE III ERWINIA CAROTOVORA SUBSP. ATROSEPTICA .. , .. , .. , .. , .. , .. , .. , . , , nikolaichik@bsu.by Erwinia carotovora subsp. atroseptica (Eca) , . , , III ().

() .

, Avr- Dsp-, , . Erwinia carotovora ;

, Eca SCRI 1043 . Avr- Dsp- Eca, .

DspE, . AvrPto P. syringae, , , - HrpN HrpW. (JN42) c , hrpL ( 5), hrpJ ( 85), hrpW ( VKW).

, 5 Bordetella pertussis, . , , . Eca, DspE-Cya (pZH416), HrpW-Cya (pZH419), HrpN-Cya (pZH426), AvrPto-Cya (pZH 432), Nicotiana tabacum. 8 ().

(JN42) , DspE-Cya AvrPto-Cya, . , , hrpL ( -, ) . , DspE-Cya AvrPto-Cya hrpL- - .

N. tabacum , hrpL-, hrpJ-, hrpW-, HrpW-Cya HrpN-Cya. , HrpW HrpN , , , .

hrpW- . , hrpW DspE-Cya AvrPto-Cya N. tabacum.

hrpJ DspE-Cya, AvrPto-Cya , , hrpJ DspE. , HrpJ , . hrpJ DspE-Cya AvrPto-Cya HrpJ . HrpJ HrpW, , , DspE-Cya, AvrPto-Cya. HrpJ , HrpN .

/ VKW 25 TA 20 TA 15 JN pZH 416 pZH419 pZH426 pZH (DspE-Cya) (HrpW-Cya) (HrpN-Cya) (AvrPto-Cya) N. tabacum, Eca JN42 ( ), VKW (hrpW), TA85 (hrpJ) TA5 (hrpL), , DspE-Cya (pZH416), HrpW-Cya (pZH419), HrpN-Cya (pZH 426), AvrPto-Cya (pZH 432).

..................................................................................................................... STREPTOMYCES AVERMITILIS X-1.

.. , .. ............................................................................................................ STREPTOMYCES GRISEOVIRIDIS -264 R STR+ BAUVERIA BASSIANA 23 .

.. , .. , *. -, . ..................................... .

.. , .. ....................................................................................................... .

.. , .. , .. , .. , .. , .. ... TRICHODERMA .

.*., - .., .., ..., .., ........................................................................................................................................ - .

. . , . . , . . , . . ...................................................... .

............................................................................................................................................. .

.. ........................................................................................................................................... IRPEX LACTEUS FR. .

.. , .. .................................................................................................................... .

............................................................................................................................................ S- BACILLUS SPHAERICUS AP2 .

.. , .. , . *, .-. *.................................................................... FADH 2- .

.. , .-. *................................................................................................................... . .

.. ...................................................................................................................................... .. , .. , .. ......................................................................................... dspE ERWINIA CAROTOVORA SUBSP. ATROSEPTICA .., .., ........................................................................ , .. ...................................................................................................................................... INCP- .. , .. , .., .. ............................................................. - .., .., ...................................................................................... һ - - ............................. FUSARIUM SAMBUCINUM .. , .. , .. , .. , .. , .. B.SUBTILIS -334 .., ............................................................................................................ .. , .. , .. , .. , .. , .. , .. , .. , .. , .. ................................................ NICOTIANA . . , . . , . . , . . ,....................................................... . . ............................................................................................................................... .. , *. , .. , .. , .. , .. ..... .. , .., .. , .., .. ................. ........................................................................................................................................... , .., ..*, ..**................................................................................... .. .................................................................................................................................... LACTOBACILLUS PLANTARUM .. , .. , .. , .. ................................................ ECHINACEA PURPUREA .., .., ....................................................................................... . . , . . , . . , . . ...................................... , . . , . . , . . , . . , . . , . .

.............................................................................................................................................. .

.., .., .., ...................................................... GLP . ., .. .., .. ............................................................................ .. , .. , .. .................................................................................................. -:

.. , .. ............................................................................................................... DE NOVO ...................................................................

.. , .. , .. , .. , .. ............................ , BLAKESLEA TRISPORA .

......................................................................................................................................... BLAKESLEA TRISPORA .

......................................................................................................................................... ESCHERICHIA COLI ERWINIA CAROTOVORA SUBSP. ATROSEPTICA 3- .. , .. , .. ................................................................... , 1.........................................................................................

.. *, .. *, .. *, .. **, .. *............... STREPTOMYCES AVIDINII - .. , .. , .. , .. , .. , ... -2 PANTOEA AGGLOMERANS . . , . . , . . *, . . ........................................ ARTHROBACTER SPECIES .., .., ...................................................................................... .

.., ............................................................................................................ .., .-. , ........................................................................................... , - .., .............................................................................................................. . . , . . , . . , . . ................................................ : .. , .. .............................................................................................................. - .

.., .., .., ............................................................... - .. , .. , .. , .. , .. , .. ................................................................................................................................. ͻ, .. , . , .. , .. , *.. ...................... .................................................................................................................................... B5 / B .. .............................................................................................................................. . . ...................................................................................................................................... . ....

. . ........................................................................................................................... .., .., .., .., ...... hrpA-hrpY hrp/hrc ERWINIA CAROTOVORA SUBSP. ATROSEPTICA . . , . . , . . , . . ........................................ F1 .., .., .. ...................................................................................... . ., . ., . ............................................................................. - .

.., .., ...............................................................

...................... m, Pseudomonas putida M . . , ..................................................................................................... PM PSEUDOMONAS PUTIDA .., ..................................................................................................... .. , .. , .. , .. , .. ................................. PBS72 B. SUBTILIS .. , ., , .. ................................................................................. , .. , .. *........................................................................................................... , .

.. , .. , .. , .. , .. ............................ ̻ . . ,................................................................................................................................ .. , .. ........................................................................................................... - , .., .., .., .., ........................ . . , . . , . . ....................................................................... - . . , . . , . . , . . , . . .................................. .. , .. , .. , .. , .. ........................ B.SUBTILIS -262 FUSICLADIUM DENDRITICUM STR.

.. , .. ........................................................................................................... .

.., .., .., ............................................. ERWINIA CAROTOVORA SUBSP. ATROSEPTICA , . . , . . ........................................................................................................ .

.., ............................................................................................................. .. , .. , .. , .. .................................................. .

.......................................................................................................................................... : .., .., .., .., .., .., ......................................................................................................................................... .., .., .., ................................................... . . , . . , . . , . . , . . , . . , . . ...................................................................................................... .. , .. , . *, . *.................................................................. , .., .., .., .., .., .... ʻ - - ........................................................................................................................................ .., ..................................................................................................................... - Phellinus robustus K . . , . . , . . ................................................................................. , .. , .. *, .. *.......................................................................... ̻ .. , .. , .. , .. , .. , .. .................. .

.. , .. , .. ................................................................ .


. . , . . .......................................................................................................... . . , . . , . . , . . , . . ........ - . . , . . , . . , . . .................................................... ASPERGILLUS NIGER 97/2 . . , . . *, . . , . . , . ................... .. ........................................................................................................................................ C - RHODOCOCCUS ERYTHROPOLIS - .., .., ................................................................................... 2- 2-6- .., ........................................................................................................................ . . ..................................................................................................................................... , .., ............................................................................................................ - Pleurotes ostreatus HeLa .. , .. , .. , .. , .. , .. ...... , , .. ............................................................................................................................. NICOTIANA TABACUM . . , . . , . . ........................................................................... Mycobacterium SP. 9- . . , . . , .. , . E. *, . ............................... - .., ................................................................................................................ .., .., .., .............................................................. .. , .. , .. , .. , .. ................................. .., ............................................................................................................ .. , .. , .. , .. , .. .................................. , . ., .. , .. , .. , .. .......................... .., .., ................................................................................ - , .. , .. ................................................................................................................ .. , .. , .. , .. , .. ...................................... .. ., .. ................................................................................................. : .. .................................................................................................................................. .................................................................................................................................. PANTOEA AGGLOMERANS .. , . *, .., *, . *, .. ........................ PENICILLIUM FUNICULOSUM .. ..................................................................................................................................... -1- .. , .. , .. , .. , .. .............................. - .. ................................................................................................................................... .. ................................................................................................................................... .., .., ............................................................. Trichoderma P.Bacillus.

.., .., .. ................................................... . , .. , .. , .. ...................................... .. *, .. *, .. .............................................................................. N- .. , .. , .. , .. ................................................. , , .. ................................................................................................................................ .. , .. , .. , .. ....................................... , .., .., .., ..,.., .... (TRITICUM AESTIVUM L.) .., .., .., ................................................ 450 .......................................................................................................................................... .., .., .., .., .................................. PSEUDOMONAS AURANTIACA B-162 .., .................................................................................................... , .. , .. , .. , .. , .. , .. , ..

.............................................................................................................................................. IN VITRO .

.. , .. ................................................................................................. - BACILLUS THURINGIENSIS .. ......................................................................................................................... .., .., .., - ......................................... deoD - p .. , .. , .. , .. ............................................................. . . , . . , . . ................................................................................. (NICOTIANA TABACUM) . . , . . , . . , . . ................................................... RAPHANUM SATIVUM - .. , .. , .. ................................................................................... , .. , .. , .. , .. , .............. I Rhizopus oryzae 1403 . . , . . , . . .................................................................... - ...................................................................................................................................... .. , .. , .. .. *, .. *...................... ARTHROBACTER SP. .., .., .............................................................................. .. , .. , .. , .. *, .. *..................... : .......................................................................................................................................... AvrPto DspE III ERWINIA CAROTOVORA SUBSP. ATROSEPTICA .. , .. , .. , .. , .. , ..

, .. ................................................................................................ - 25-28 2005 . , .

.. 23.05.2005. 6084/16. .

. . . 35,25. .-. . 28,76. 200 . .

02330/0133359 29.06. 220001, , . ,

Pages:     | 1 |   ...   | 8 | 9 ||
 
-  >> 

:





 
<<     |    
2013 www.libed.ru - -

, .
, , , , 1-2 .