авторефераты диссертаций БЕСПЛАТНАЯ БИБЛИОТЕКА РОССИИ

КОНФЕРЕНЦИИ, КНИГИ, ПОСОБИЯ, НАУЧНЫЕ ИЗДАНИЯ

<< ГЛАВНАЯ
АГРОИНЖЕНЕРИЯ
АСТРОНОМИЯ
БЕЗОПАСНОСТЬ
БИОЛОГИЯ
ЗЕМЛЯ
ИНФОРМАТИКА
ИСКУССТВОВЕДЕНИЕ
ИСТОРИЯ
КУЛЬТУРОЛОГИЯ
МАШИНОСТРОЕНИЕ
МЕДИЦИНА
МЕТАЛЛУРГИЯ
МЕХАНИКА
ПЕДАГОГИКА
ПОЛИТИКА
ПРИБОРОСТРОЕНИЕ
ПРОДОВОЛЬСТВИЕ
ПСИХОЛОГИЯ
РАДИОТЕХНИКА
СЕЛЬСКОЕ ХОЗЯЙСТВО
СОЦИОЛОГИЯ
СТРОИТЕЛЬСТВО
ТЕХНИЧЕСКИЕ НАУКИ
ТРАНСПОРТ
ФАРМАЦЕВТИКА
ФИЗИКА
ФИЗИОЛОГИЯ
ФИЛОЛОГИЯ
ФИЛОСОФИЯ
ХИМИЯ
ЭКОНОМИКА
ЭЛЕКТРОТЕХНИКА
ЭНЕРГЕТИКА
ЮРИСПРУДЕНЦИЯ
ЯЗЫКОЗНАНИЕ
РАЗНОЕ
КОНТАКТЫ

Pages:     | 1 | 2 || 4 | 5 |   ...   | 7 |

«Международная Школа-конференция молодых ученых «Биотехнология будущего» организована Институтом биохимии им. А.Н.Баха РАН в рамках Симпозиума «ЕС-Россия: перспективы сотруд- ничества в ...»

-- [ Страница 3 ] --

allavl@usue.ru Ключевые слова: электрохимические сенсоры, вольтамперометрия, потенциометрия, тиол-дисульфидное соотношение, микроэлементный состав, антиоксидантная активность.

1. Введение Здоровье населения, диагностика опасных заболеваний человека на ранних стадиях, определение факторов, способствующих развитию в организме болезней, оценка влияния токсичных веществ на их возникновение и протекание – все эти проблемы особенно актуальны в настоящее время. Здоровье человека, наряду с другими факторами, определяется состоянием иммунной системы организма, антиоксидантным статусом, балансом или дисбалансом микроэлементного состава, наличием в окружающей среде патогенных загрязнителей и возможностями диагностики заболеваний на ранних стадиях.

Существующие методы оценки антиоксидантной активности (АОА), тиолдисульфидного соотношения (ТДС) и микроэлементного баланса (МЭБ) сложны, трудоемки, дорогостоящи, продолжительны во времени и, как правило, не могут использоваться для непрерывного мониторинга.

исследование и разработка новых потенциометрических и Целью работы является вольтамперометрических методов и сенсоров для определения:

- антиоксидантной активности различных объектов;

- тиол-дисульфидного соотношения крови и ее фракций;

- концентраций ионов меди, цинка, свинца, кадмия в крови и ее фракциях. Привлечение электрохимических методов анализа к решению упомянутых выше задач является весьма целесообразным.

Доказательством этому служит высокая чувствительность электрохимических методов, простота аппаратурного оформления, возможность их использования как в лабораторных, так и внелабораторных (on site) условиях, создания портативных приборов, низкая стоимость анализа по сравнению с другими методами.

2. Методы исследования В работе в качестве методов исследования использованы инверсионная вольтамперометрия, хроноамперометрия, циклическая вольтамперометрия, потенциометрия. Для проведения независимых параллельных экспериментов и проверки достоверности получаемых результатов использованы методы атомно-абсорбционной спектрометрии (ААС), масс-спектрометрии с индуктивно-связанной плазмой, хемилюминесценции, спектрофотометрии.

3. Результаты и обсуждение 3.1. Разработка измерительной системы для оценки антиоксидантной активности жидкостей.

В работе предложен потенциометрический метод определения антиоксидантной активности (АОА).

Принцип метода заключается во введении в анализируемую среду медиаторной системы и измерении потенциалов, устанавливающихся на платиновом электроде до и после введения анализируемой пробы.





Изменение потенциала при этом обусловлено протеканием химической реакции взаимодействия окисленного компонента медиаторной системы с антиоксидантами пробы.

В работе исследованы основные антиоксиданты, рассчитаны стехиометрические коэффициенты реакции их взаимодействия с окисленным компонентом медиаторной системы, оценены константы скорости этих реакций. Далее был исследован ряд продуктов питания и лекарственных экстрактов.

Для оценки достоверности определения АОА с использованием предлагаемым потенциометрическим методом было проведено сопоставление результатов, полученных этим методом, и широко используемыми методами хемилюминесценции, Randox и фотометрическим методом с использованием стабильного радикала 2,2-дифенил-1-пикрилгидразила (ДФПГ). Корреляция результатов составила 91, 72 и 94 % соответственно.

При изучении антиоксидантных свойств крови, были исследованы и выбраны следующие параметры:

способ разрушения клеточных мембран эритроцитов (гемолиз), условия хранения проб, анкикоагулянт, аликвота проб. Достоверность полученных данных оценивали, используя метод разбавления крови и метод стандартных добавок. Также результаты исследования АОА плазмы крови были сопоставлены с независимым фотоспектрометрическим методом на модели стабильного радикала дифенилпикрилгидразила. Корреляция между методами на 8 образцах составила 94%.

Таким образом, показана возможность использования потенциометрического метода для исследования АОА биологических жидкостей, пишевых продуктов, лекарственных экстрактов. Предложенный метод является быстрым, простым в исполнении и в тоже время весьма информативным.

3.2. Разработка сенсоров для определения тиол-дисульфидного равновесия.

Основная идея количественного вольтамперометрического определения тиолов, используемая в этой части работы, состоит в нахождении доли ионов металла, вступивших во взаимодействие с тиольными группами органических соединений в соответствии с уравнением реакции:

Men+ + nRSH Me(SR)n + nH+ Источником информации о концентрации тиолов может служить сигнал электрохимических превращений металла, непрореагировавшего с SH- группами в растворе. Для определения дисульфидов была использована реакция восстановительного расщепления S-S-связей сульфитом натрия:

RSSR + Na2SO3 + H2O RSH + Na2SO В ходе выполнения работы разработаны толстопленочные модифицированные графитовые электроды, выбраны условия обработки и хранения биологических образцов, разработаны алгоритмы анализа, исследованы модельные растворы и реальные образцы крови и ее фракций.

Предложенный вольтамперометрический метод оценки ТДС отличается от известных простотой, удобством, хорошей воспроизводимостью результатов.

3.3. Разработка сенсора для оценки микроэлементного статуса биологических объектов.

Разработаны толстопленочные модифицированные графитовые электроды (ТМГЭ), позволяющие исключить ртуть и токсичные соли ртути из процесса анализа, упростить процедуру анализа, снизить минимально определяемые концентрации свинца и кадмия в цельной крови и погрешность определения всех трех элементов, повысить экспрессность метода. Исследовано электрохимическое поведение меди, свинца и кадмия в присутствии поверхностно-активных протеинов крови, выбраны способы отбора и хранения крови, разработаны алгоритмы проведения инверсионно-вольтамперометрического (ИВА) анализа.





Результаты, полученные предложенным методом, хорошо согласуются как с результатами, полученными методом ИВА после химического разложения крови, так и с результатами, полученными традиционными методами: атомно-эмиссионного химико-спектрального анализа, атомно-абсорбционной спектроскопии.

4. Заключение Предложены подходы для комплексного исследования (оценки АОА, ТДС, МЭБ) биологических материалов с использованием новых электрохимических методов и сенсоров.

В ходе выполнения работы изучены: различные материалы трансдъюсеров для оценки антиоксидантной активности, тиолдисульфидного соотношения и микроэлементного статуса организма;

электрохимические и окислительно-восстановительные свойства различных медиаторных систем, выбран медиатор с необходимыми характеристиками;

кинетика реакций химического взаимодействия антиоксидантов с медиаторной системы.

В результате проведенных исследований разработаны:

• потенциометрический датчик для оценки антиоксидантной активности (АОА) биологических жидкостей, продуктов питания, лекарственных экстрактов;

• толстопленочные модифицированные углеродсодержащие электроды для оценки тиол-дисульфидного соотношения (ТДС) биологических жидкостей и микроэлементного статуса организма;

• алгоритмы и методики проведения анализа для оценки АОА, ТДС и МЭБ.

• Проведенные исследования служат основой для создания новых доступных электрохимических диагностических комплексов для анализа различных биообъектов, потребность в которых на мировом рынке велика.

5. Благодарности Работа выполнялась при финансовой поддержке МНТЦ, INTAS, Министерства науки и образования РФ.

БЕСФЕРМЕНТНЫЕ СЕНСОРЫ В АНАЛИЗЕ БИОЛОГИЧЕСКИХ ОБЪЕКТОВ Козицина А.Н.

Уральский государственный экономический университет, 620219, Екатеринбург, 8 Марта 62, Россия kan@usue.ru Ключевые слова: бесферментный сенсор, иммуносенсор, клещевой энцефалит, мочевина, рецептор, наночастицы серебра 1. Введение В современной медицине для контроля состояния здоровья человека, используются приборные методы, в которых в качестве чувствительных элементов применяются биосенсоры. Достоинствами биосенсоров являются высокая чувствительность и селективность. Существенными недостатками - нестабильность и высокая стоимость. Кроме того, используемые методы анализа требуют специального дорогостоящего оборудования, которое могут позволить себе далеко не все медицинские учреждения.

Целью работы являлось создание электрохимических бесферментных сенсоров (на примере иммуносенсора для диагностики клещевого энцефалита и сенсора для определения мочевины в биологических объектах), не уступающих по чувствительности и селективности ферментсодержащим сенсорам, что позволит преодолеть известные недостатки последних, связанные с нестабильностью ферментов.

В случае опасных вирусных инфекций особенно важной является диагностика на ранних стадиях заболевания, в идеальном случае – на местах, в полевых условиях, поскольку это является залогом успешного лечения и полного выздоровления больного.

В представляемой работе разработан способ электрохимического иммуноанализа, заключающийся в использовании бесферментных биосенсоров, отличающихся тем, что в качестве информационно генерирующего соединения служит белок, меченный наночастицами металла, а трасдьюсором углеродсодержащий материал.

В клинике внутренних болезней определение концентрации мочевины приобрело наибольшее значение для диагностики заболевания почек. Особенно актуальной в настоящее время является проблема определения адекватности гемодиализа (о которой судят по уровню мочевины в диализной жидкости) для больных почечной недостаточностью. Необходимо следить за динамикой изменения концентрации мочевины в процессе процедуры. Из всего многообразия способов определения уровня мочевины основным является метод на основе определения ионов аммония, которые являются продуктами каталитической реакции гидролиза мочевины в присутствии фермента уреазы.

В последние годы в литературе появились работы, посвященные электрокаталитическому окислению фенолов, спиртов, а также и мочевины в присутствии никелевых макрокомплексов за счет окисления Ni(II) / Ni (III) (1).

В представляемой работе разработан электрохимический метод анализа, в котором в качестве чувствительного элемента использован бесферментный сенсор на основе искусственных металлсодержащих рецепторов.

2. Материалы и методы Применяемые метода анализа: циклическая вольтамперометрия, линейная вольтампермотрия, хроноамперометрия.

В качестве трансдьюсеров использовали различные толстопленочные углеродсодержащие электроды.

Применяли инактивированный антиген вируса клещевого энцефалита (ВКЭ) (штамм «Софьин»), антитела против вируса клещевого энцефалита (НИИ вирусных инфекций, г. Екатеринбург), белок А, меченый наночастицами серебра (образцы синтезированы и любезно предоставлены коллегами кафедры энзимологии МГУ, г. Москва).

Использовали мочевину, диэтилдитиокарбаминат никеля, анионообменную колонку (Hyperser IC-OH) («Metrohm» (Швейцария)). Рецепторы 4-тетрапиразинпорфиразин никеля (II);

3-(3.5-Диметилпиразол-1-ил)-6 N (аминобензтизолил)-s-тетразин•Ni(AcAc)2;

3,6-бис(3,5-диметилпиразол-1-ил)-s-тетразина с кластером Ni9(HOOCCMe3)4(4-OH)3(OOCCMe3)12 были синтезированы и любезно предоставлены коллегами ИОС УрО РАН.

3. Результаты и обсуждение Для диагностики клещевого энцефалита разработан электрохимический иммуносенсор, в котором в качестве метки применяется коньюгат- белок А - наночастицы серебра.

Были исследованы коньюгаты, содержащие наночастицы серебра в концентрации 3x10-4 М, а белок в концентрациях 10 мкг/мл, 15 мкг/мл, 50 мкг/мл, 70 мкг/мл, 100 мкг/мл. На основе электронно микроскопических и электрохимических исследований был выбран оптимальный препарат, имеющий концентрацию белка А 50мкг/мл, который и использовали в дальнейшей работе.

Антиген иммобилизировали на поверхности с применением известного метода (2). Иммуноанализ проводили в две стадии: на первой стадии сенсор с иммобилизированным антигеном инкубировали в буферном растворе антител против ВКЭ при температуре (37±1)0С в течение 20 минут с целью создания иммунокомплекса антиген-антитело;

на второй стадии инкубировали в растворе белка А, меченого наночастицами серебра с целью локализации его на иммунокомплексе. В качестве холостого использовали опыт, когда сенсор с иммобилизированным антигеном ВКЭ инкубировали на первой стадии в сыворотке крови неинфицированного человека растворе. Сигналообразующей реакцией являлось окисление серебра. Полезный сигнал регистрировали при потенциале 0,07В. Была получена градуировочная зависимость определения антител против ВКЭ. Предел обнаружения составляет 2x10-7 мг/мл.

Результаты, полученные при анализе сыворотки крови (в этом случае сенсор с антигеном инкубировали на первой стадии в растворе сыворотки крови пациента) на наличие антител против вируса клещевого энцефалита, удовлетворительно согласуются с результатами, полученными с использованием стандартного ИФА метода. Сравнительный анализ был проведен в «Центре лабораторной диагностики здоровья матери и ребенка» г. Екатеринбурга.

Для определения мочевины в сыворотке крови и диализной жидкости разработан бесферментный сенсор, основанный на твердофазной каталитической реакции.

Модифицирование графитсодержащего слоя трансдьюсера осуществляли путём введения в объем графитсодержащей композиции органического раствора, содержащего водонерастворимый модификатор (рецептор), полученный экстракцией или растворением в органическом растворителе. Для устранения влияния мешающих соединений, содержащихся в биологических объектах, сыворотку крови, диализат (объект) пропускали через анионообменную колонку, затем вносили в ячейку.

В анализе применяли метод добавок.

Регистрировали хроноамперограммы при U= 0,56В. Фон 0,25М NaOH. Коэффициент корреляции 0,999.

Предел обнаружения составляет 0,007 mM.

Результаты определения мочевины с использованием предложенного метода, полученные при анализе сыворотки крови и диализной жидкости, удовлетворительно согласуются с результатами, полученными и стандартным уреазным методом.

4. Заключение Разработаны подходы для оценки важных диагностических параметров с использванием новых электрохимических бесферментных сенсоров:

– для определения антител против клещевого энцефалита – для определения мочевины в биологических объектах.

Благодарность Работа выполнена при финансовой поддержке МНТЦ, INTAS.

Литература (1) Ferrer S.J., Granados S.G., Bedioui F., Ordaz A.A. (2003) Electroanalysis, 15, 70-73.

(2) Brainina Kh., Kozitsina A., Beikin J. (2003) Analytical and Bioanalytical Chemistry 376, 481-485.

РАЗРАБОТКА ТЕСТ-СИСТЕМЫ ПЦР ДЛЯ ИНДИКАЦИИ ВИРУСА БЫЧЬЕГО ИММУНОДЕФИЦИТА И ВЫЯВЛЕНИЕ ВБИ - ИНФЕКЦИИ У КРУПНОГО РОГАТОГО СКОТА В РОССИИ Колотвин В.В., Валихов А.Ф.

Московский Государственный Университет Прикладной Биотехнологии, 109316, Москва, ул. Талалихина, kolotvin_v@mail.ru Ключевые слова: ретровирусы, вирус бычьего иммунодефицита, полимеразная цепная реакция, бычий лейкоз.

1. Введение Вирус иммунодефицита крупного рогатого скота (вирус бычьего иммунодефицита, ВБИ) (Van der Maaten et al., 1972) относится к семейству Retroviridae, роду Lentivirus. Он родственен вирусу иммунодефицита человека – возбудителя СПИД.

Для выявления ВБИ - инфекции КРС используют полимеразную цепную реакцию (ПЦР), позволяющую обнаруживать ДНК-провирус этого вируса в лейкоцитах исследуемых животных, или серологические методы исследования для выявления антител. При использовании этих методов было установлено, что ВБИ распространен в разных странах и инфицирует от 1 до 10% поголовья КРС. Коммерчески доступных тест систем для выявления ВБИ не существует, и данные о наличии ВБИ - инфекции в российских хозяйствах отсутствуют. В связи с этим главной целью нашего исследования было разработать тест-систему ПЦР для индикации ВБИ и выявить распространение этой инфекции в России.

2. Материалы и методы Создание тест – системы ПЦР включало в себя создание адекватных позитивного и негативного контролей, подбор специфичных олигонуклеотидных праймеров, обладающих сродством к определенным участкам провируса ВБИ, оптимизация процесса амплификации по температурному и временному профилю реакции, изучение специфичности и чувствительности разработанной тест – системы.

Для культирования ВБИ была получена оригинальная линия диплоидных клеток легкого эмбриона быка (FBL). Для получения инфекционного ВБИ клетки трансфицировали плазмидой pBIV127, содержащей полный провирус ВБИ (Gonda et al., 1987). В трансфицированных клетках развился типичный цитопатический эффект, а в культуральной жидкости появился инфекционный вирус.

При анализе последовательностей изолятов генома ВБИ содержащихся в базе данных EMBL, GenBank и DDBJ были обнаружены высококонсервативные участки в генах gag и pol, на основании которых были подобраны специфические праймеры (gag 1 – gag 2 и pol 1 – pol 2). Термодинамический анализ праймеров и ампликонов был произведен с помощью пакета программ Oligo 5.0.

Изучение чувствительности и специфичности тест-системы ПЦР было проведено с использованием плазмиды pBIV127, ДНК выделенных из клеток FBL (отрицательный контроль) и FBL-BIV (положительный контроль).

Были получены 250 проб ДНК, выделенные из цельной крови КРС трех скотоводческих хозяйств Московского региона. Пробы были исследованы разработанной тест-системой ПЦР на предмет выявления ДНК провируса ВБИ и коммерческим набором компании “Изоген” для выявления ДНК провируса вируса бычьего лейкоза (ВБЛ).

3. Результаты и обсуждение При постановке ПЦР с праймерами gag 1 - gag 2 и pol 1 - pol 2 на электрофореграмме выявляются ампликоны ожидаемого размера (382 п.н. и 167 п.н.) при использовании в качестве матрицы плазмиды pBIV127 и ДНК, выделенную из культуры клеток FBL-BIV (рис. 1). Проверка чувствительности метода показала, что обе пары праймеров способны выявить около 1000 копий плазмиды в 1 мл крови.

После отработки чувствительности и специфичности созданной системы ПЦР было исследовано 250 проб ДНК, полученных от индивидуальных животных из трех хозяйств Московского региона. На рисунке представлена электрофореграмма продуктов ПЦР проб ДНК, выделенных из крови 16 животных, с парой праймеров gag 1- gag 2. Четко видны положительные и отрицательные результаты реакции. Результатом исследований оказался высокий процент инфицированных ВБИ животных (44 и 67%) в двух отдельных хозяйствах, в третьем хозяйстве провирус ВБИ обнаружен у 11% исследованных животных. Пробы ДНК от тех же животных были исследованы методом ПЦР с праймерами, направленными на выявление вируса бычьего лейкоза (табл. 1). В среднем, из 250 проб 100 (40%) дали положительный результат на наличие ВБИ, что в 1,5 раза уступает зараженности тех же животных ВБЛ (63,5%).

Следует отметить, что положительный результат на присутствие провирусной ДНК ВБИ был получен только в тех пробах, где были использованы праймеры gag 1 - gag 2, тогда как в пробах, где использовались праймеры pol 1 – pol 2 результат везде оказался отрицательным (данные не показаны). Это означает, что ВБИ, распространенный в исследованных хозяйствах, отличается по гену pol от известных изолятов вируса, нуклеотидная последовательность которых учитывалась при подборе соответствующих праймеров.

Рисунок 1. Результаты ПЦР при использовании подобранных праймеров, плазмиды pBIV127 и ДНК клеток, хронически зараженных ВБИ (FBL-BIV) 1 – маркер молекулярной массы;

2, 6 – отрицательный контроль (Н2О);

3 – ДНК, выделенная из культуры клеток FBL (праймеры gag1-gag2);

– ДНК, выделенная из инфицированной культуры клеток FBL-BIV (праймеры gag1-gag2);

5 - плазмида, содержащая клонированную ДНК провируса ВБИ (праймеры gag1-gag2);

7 - ДНК, выделенная из культуры клеток FBL (праймеры pol1-pol2);

8 - ДНК, выделенная из культуры клеток FBL-BIV (праймеры pol1-pol2);

9 - плазмида, содержащая клонированную ДНК провируса ВБИ (праймеры pol1 pol2) Рисунок 2. Результаты исследования ДНК из образцов крови КРС в ПЦР с использованием праймеров gag1-gag 1 – отрицательный контроль амплификации (Н2О);

2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 – ДНК, выделенная из крови животных;

18 – положительный контроль (плазмидa pBIV127, содержащая клонированную ДНК провируса ВБИ) Таблица 1. Выявление ВБИ - и ВБЛ - инфекции у КРС трех хозяйств Московского региона методом полимеразной цепной реакции Количество % животных, % животных, № хозяйства исследованных животных положительных на ВБИ положительных на ВБЛ 1 100 11 2 100 67 3 50 44 Итого 250 40 63, 4. Заключение Таким образом, была разработана тест-система ПЦР для индикации провирусной ДНК ВБИ в пробах крови КРС и впервые выявлена высокая распространенность этой инфекции в стадах Московского региона, существенно превышающая таковую в большинстве стран мира, где были выполнены подобные исследования.

Будут продолжены исследования по изучению особенностей ВБИ - инфекции в России.

Благодарность Работа выполнена при поддержке гранта РФФИ N 05-04-08170 ОФИа. Авторы благодарят фирму “Лаборатория – Изоген” и лабораторию генетики вирусов Института Биологии Гена РАН за помощь в работе.

РАЗРАБОТКА СИСТЕМЫ ДЛЯ ИССЛЕДОВАНИЙ ДНК-МИКРОСАТЕЛЛИТОВ КРУПНОГО РОГАТОГО СКОТА Коновалова Е.Н.

Всероссийский государственный научно-исследовательский институт животноводства 142132 Московская обл., Подольский р-н, пос. Дубровицы.

konoval-elena@yandex.ru Ключевые слова: микросателлиты, ISAG, крупный рогатый скот, ПЦР.

1. Введение Исследование ДНК-микросателлитов представляется одним из перспективных приемов для индивидуального контроля происхождения и оценки генетической структуры популяций. Главной целью наших исследования было разработать тест-систему для контроля происхождения крупного рогатого скота отечественных пород, используя ДНК-микросателлиты. Согласно данным последний конференции ISAG (Международного сообщества генетиков животных) был установлен интернациональный набор микросателлитов для крупного рогатого скота (девять миркросателлитных маркеров, обязательных для исследования всеми лабораториями). В ходе нашей работы мы попытались разработать микросателлитную панель, позволяющую исследовать шесть из девяти рекомендованных маркеров.

2. Материалы и методы Исследования были проведены на одной из популяций крупного рогатого скота холмогорской породы (плем.завод-совхоз им. В.И. Ленина). Из проб кожи (ушные выщипы) была выделена ДНК по методу Зиновьевой Н.А., Брема Г., 2003. Семь микросателлитных локуса были исследованы в одном мультиплексе методом ПЦР. Праймеры, используемые для ПЦР-амплификации, были мечены флуюоресцентными красителями (FAM and R6G). Характеристика разрабатываемой панели представлены в табл. 1.

Таблица 1: Характеристика панели микросателлитов.

Маркер Минимальный размер аллеля Максимальный размер аллеля Краситель TGLA227 75 105 FAM BM2113 122 156 R6G ETH225 131 159 FAM BM1824 176 197 R6G ETH10 207 231 FAM SPS115 234 258 R6G BM1818 248 278 FAM ПЦР проводилась в объеме 15 мкл в смеси, содержащей: 1 мкл геномной ДНК;

по 0,1 (ETH225, TGLA227, BM1824), 0,05 (ETH10, SPS115, BM2113) и 0,15 (BM1818) мкл каждого праймера;

по 1,5 мкл 10x ПЦР-буфера и динитрофосфатов и 1 ед. ДНК-полимеразы (Taq). Амплификация проводилась на Techne TC-412 (Biostep GmbH) и состояла из следующих шагов: (1) начальная денатурация двойных связей при 94°C в течение 1 мин, (2) денатурация при 94C - 30 с, (3) отжиг праймеров при 58°C - 20 с, (4) элонгация при 72°C - 5 с, (5) денатурация при 94C - 15 с, (6) отжиг при 58°C - 20 с, (7) элонгация при 72°C - 1 мин и (8) конечная элонгация при 72C - 30 мин. Шаги 2-4 были замкнуты в цикл, повторяющийся 3 раза, а этапы 5-7 были циклом, повторяющимся 33 раза.

Анализ амплифицированных ПЦР-продуктов проводили с помощью капиллярного электрофореза на приборе MegaBace1000 (Amersham Bioscience).

3. Результаты и обсуждение Результаты наших исследований, представленные на рис. 1, показывают возможность мультиплексного анализа семи выбранных маркеров и дальнейшего использования данной панели для контроля происхождения и исследования генетической структуры популяций.

BM1818 BM A01 cattle310306 1 Q Score : 10.0 Allele 1 : 262.7 ( 262 ) Allele 2 : 267.0 ( 268 ) A01 cattle310306 1 Q Score : 10.0 Allele 1 : 184.3 ( 184 ) Allele 2 : 186.4 ( 186 ) 0 250 260 270 180 BM2113 ETH A01 cattle310306 1 Q Score : 10.0 Allele 1 : 128.7 ( 130 ) A01 cattle310306 1 Q Score : 10.0 Allele 1 : 214.7 ( 214 ) Allele 2 : 218.5 ( 218 ) 0 130 140 150 210 220 ETH225 SPS A01 cattle310306 1 Q Score : 10.0 Allele 1 : 134.8 ( 135 ) A01 cattle310306 1 Q Score : 10.0 Allele 1 : 248.2 ( 248 ) Allele 2 : 252.3 ( 252 ) 10000 0 140 150 240 TGLA A01 cattle310306 1 Q Score : 10.0 Allele 1 : 96.6 ( 97 ) Allele 2 : 105.0 ( 105 ) 80 90 Рисунок 1: Электрофореграмма мультиплексного анализа микросателлитов крупного рогатого скота.

По данным литературы, посвященной микросателлитам крупного рогатого скота, в настоящее время уже имеется панель микросателлитов, разработанная фирмой Applied Biosystems и состоящая из микрователлитных локусов. Но использование данной системы для исследования микросателлитов крупного рогатого скота России является невыгодным для нас по двум причинам. С одной стороны, мы предлагаем использование двух флюоресщентных красителей вместо трех, предлагаемых Applied Biosystems. С другой стороны, панель Applied Biosystem запатентована и, разработав собственную тест-систему, нам не придется платить отчисления данной фирме за использования ее набора маркеров.

4. Заключение Новая панель микросателлитов была разработана. Она позволяет проводить анализ семи микросателлитных локусов в одной пробирке, исследовать контроль происхождения и генетическое разнообразие крупного рогатого скота отечественных пород в соответствии с международным стандартом.

Благодарность Данная работа выполнена при финансовой поддержке Российского Фонда Фундаментальных Исследований, проект № 06-04-49269.

Список литературы (1) Product Bulletin Animal Genotyping Systems. www.appliedbiosystems.com.

(2) Rogrio Abdallah Curi;

Catalina Romero Lopes. Evaluation of nine microsatellite loci and misidentification paternity frequency in a population of Gyr breed bovines. Braz. J. Vet. Res. Anim. Sci. vol.39 no.3 So Paulo 2002.

(3) Hanslik S., Harr B., Brem G. and Schlotterer C. 2000 Microsatellite analysis reveals substantial genetic differentiation between contemporary New World and Old World Holstein Friesian populations. Anim. Genet. 31, 31–38.

(4) O. Hanotte and H. Jianlin. Genetic characterization of livestock populations and its use in conservation decision-making.

The role of biotechnology. Villa Gualino, Turin, Italy – 5-7 March, СОЗДАНИЕ ВЫСОКОПРОДУКТИВНЫХ ГИБРИДНЫХ ШТАММОВ ВЕШЕНКИ Копыльцов С.В., Иванов Г.И.

Кубанский государственный аграрный университет, 350044 Краснодар, ул. Калинина 13, Россия serge1983y@rambler.ru Ключевые слова: Вешенка обыкновенная, селекция грибов, лакказа, целлюлаза 1. Введение Современное агропромышленное производство направлено на применение безотходных технологий, обеспечивающих получение дополнительной продукции и повышающих рентабельность производства.

Промышленное культивирование вешенки обыкновенной позволяет получать высокобелковый продукт, используя лигноцеллюлозные субстраты, являющиеся отходами растениеводства. На сегодняшний день производству предлагается небольшой ассортимент штаммов вешенки, в основном зарубежной селекции (1).

Длительное размножение культуры путем пересева мицелия приводит к вырождению сорта. Поэтому возникает необходимость получения новых сортов, удовлетворяющих требованиям интенсивных технологий, путем селекционно-генетического улучшения в направлении повышения урожайности и качества плодовых тел.

В связи с вышеизложенным целью работы являлось: 1) разработка новых методов определения ферментативной активности лакказы и целлюлазы, продуцируемых мицелием гриба;

2) получение гибридных штаммов, обладающих большей ферментативной активностью и урожайностью плодовых тел, чем исходные родительские промышленно культивируемые штаммы.

2. Материалы и методы В качестве объектов исследования были выбраны пять штаммов вешенки, которые используются в промышленном производстве (мицелий был любезно представлен ФГУП «Краснодарский биотехнологический центр, г. Краснодар): НК-35, Флорида, Пенсильвания, Р-77, Львовский, а также дикариотический изолят, выделенный нами из плодовых тел, собранных в районе 1-го отделения опытного хозяйства КубГАУ в 2004 году.

Выращивание плодовых тел промышленно культивируемых штаммов и дикого изолята гриба вешенка осуществляли путем культивирования мицелия на стерильном зерновом субстрате в полипропиленовых пакетах. Проращивания споровых изолятов и культивирование моно-и дикариотического мицелия проводили на глюкозо – дрожжевой среде следующего состава, г/л: Глюкоза – 5.5;

(NH4)2SO4 - 4.0;

КН2РО4- 0.5;

MgSO4 * 7H2O – 0.3, дрожжевой экстракт – 5.0;

агар – 15;

рН = 6.

Определение целлюлозолитической активности проводили путем инокуляции мицелия исследуемого штамма на вышеуказанную питательную среду, с добавлением вместо глюкозы бумажной пульпы. Через суток проводили измерение зоны просветления, образовавшейся в результате гидролиза целлюлозы.

Для определения лакказной активности нами был разработан метод, заключающийся в инокуляции мицелия на основную питательную среду, содержащую дополнительно 0,01% –нафтола. После 3 суток инкубирования проводили измерение диаметра образовавшихся окрашенных зон на питательной среде и определение интенсивности их окрашивания денситометрически. Денситометрия включала сканирование обратной стороны чашки Петри с последующей обработкой в программе Sorbfil TLC Videodensitometer на компьютере.

Для анализа содержания клетчатки в субстрате использовали методику ГОСТ 13496.2-91. А для оценки целлюлозолитической активности субстрата после культивирования мицелия – методику ТУ «Препарат ферментный Целловеридин 3х».

Выгонку плодовых тел для оценки урожайности осуществляли в производственных условиях на лигноцеллюлозном субстрате, в качестве которого была использована солома озимой пшеницы.

Сравнение средних значений и распределений частот изучаемых показателей осуществляли с помощью критериев Стьюдента (t). Статистическую обработку результатов выполняли с применением методов корреляционного и дисперсионного анализов (3).

3. Результаты и обсуждение Одним из условий эффективной биоконверсии растительных отходов в процессе производства грибов является степень доступности целлюлозы для целлюлозолитических ферментов гриба. Однако в растительных субстратах целлюлоза прочно связана с лигнином (2), что препятствует ее эффективной утилизации культивируемыми штаммами. Поэтому, в качестве факторов для селекции были выбраны активность целлюлозолитических и лигнолитических ферментов. Мы считаем, что исследование вариабельности скорости роста мицелия и активности ферментов у монокариотических изолятов, выделенных из спор плодовых тел различных штаммов гриба вешенка необходимо проводить на гаплоидном (монокариотическом) уровне по первичным продуктам генов - белкам (ферментам). Именно эти признаки определяют степень биодеградации лигноцеллюлозного субстрата, скорость колонизации субстрата и, в конечном счете, урожайность плодовых тел.

В результате проращивания спор, собранных с пяти промышленно культивируемых и одного дикого штамма, было получено более 300 монокариотических изолятов. Все они были оценены по лакказной и целлюлазной активности. После обработки полученных результатов мы отобрали лишь 14 изолятов, достоверно превышающих родительские формы по активности лигноцеллюлазных ферментов. Эти монокариотические изоляты использовали в межштаммовой гибридизации. Полученные гибриды также оценивали по активности лигноцеллюлазных ферментов вышеуказанными методами. Всего было отобрано штаммов, превышающих родительские формы по целлюлозолитической и 6 штаммов по лакказной активности. При культивировании исследуемыхых в работе штаммов было установлено, что между степенью деградации клетчатки и активностью лакказы имеется высокая корреляционная зависимость (r=0.8).

Полученные нами гибриды сравнивали по урожайности плодовых тел с промышленно культивируемыми штаммами. Плодовые тела гибридов отличались по форме, окраске и урожайности. Из 14 полученных гибридов были отобраны 4 (Г2, Г3, Г6, Г7), которые достоверно превышали по урожайности родительские промышленно культивируемые штаммы (рис.) на 40 процентов.

Выход плодовых тел от массы субстрата, % НК- Р- Г Г Пенсильван ия Названия штаммов Рисунок. Сравнение урожайности промышленно культивируемых штаммом и полученных гибридов 4. Заключение В результате проведенного исследования из пяти промышленно культивируемых штаммов гриба вешенки были выделены монокариотические изоляты с высокой лигнолитической активностью ферментов и скоростью роста мицелия. Скрещивание этих изолятов и отбор дикариотического мицелия по этим признакам позволили создать 4 гибридных штамма гриба вешенки с повышенной способностью к биодеградации субстрата и формированию урожая плодовых тел, превышающего родительские формы на 40%.

Литература (1) Дьяков Ю. Т. Гибридные сорта культивируемых съедобных грибов / Ю. Т. Дьяков // Наука и практика грибоводства: материалы IV Международной конференции, Москва, Россия, 16-17 июня. 1997. - М, 1997. - С.

1-6.

(2) Карманов А. П. Лигнин. Структурная организация и самоорганизация / А. П. Карманов // Химия растительного сырья. - 1999. - №1. - С. 65–74.

(3) Лакин Г. Ф. Биометрия / Г. Ф. Лакин // -М.: Высш. шк., 1990. -352 с.

ПОЛИМОРФИЗМ ГЕНА NCOA1 У СВИНЕЙ РАЗЛИЧНЫХ ПОРОД Костюнина О.В., Зиновьева Н.А.

Государственный научно-исследовательский институт животноводства Российской академии сельскохозяйственных наук, 142132, Московская область, Подольский район, пос. Дубровицы, Россия kostolan@yandex.ru.

Ключевые слова: маркер, многоплодие, полиморфизм 1. Введение Использование ДНК-маркеров плодовитости является эффективным методом повышения многоплодия свиноматок. В настоящее время выявлен целый ряд таких маркеров, в большей или меньшей степени оказывающих влияние на многоплодие свиноматок. Для нас представляет большой интерес ген коактиватора- ядерных рецепторов (NCOA1).

Выбор данного гена в качестве гена-кандидата репродуктивных качеств свиней обусловлен его функциями.

Комплекс NCOA1 взаимодействует с эстрогеновым рецептором, стимулируя его транскрипционную активность [Leo, Chen, 2000]. Белок NCOA1 проводит ацетилирование гистонов и заимодействует с другой ацетилтрансферазой p300/CBP, в процессе воздействия на недоступный иными способами хроматин [Spencer et al., 1997]. Таким образом, белок NCOA1 усиливает активность эстрогенового рецептора, что стимулирует транскрипцию специфических эстроген-чувствительных генов и обуславливает, тем самым, последующий физиологический ответ [Nephew et al., 2000].

Различные генетические варианты гена NCOA1 обусловлены молчащей точковой мутацией TC. Аллель А1 соответствует нуклеотиду Т, в то время как аллель А2 – нуклеотиду С в месте мутации. Целью настоящей работы являлось разработка системы диагностики полиморфизма гена NCOA1 свиней с использованием технологии пиросеквенирования и изучение полиморфизма гена коактиватора-1 ядерных рецепторов (NCOA1) как маркера многоплодия.

2. Материалы и методика исследований Исходным материалом для анализа служили пробы ткани (ушной выщип) свиней. В исследованиях были использованы свиньи пород ландрас, дюрок, йоркшир канадской селекции (ЗАО «Агро-Индустрия»

Орловской обл.) и свиньи пород крупная белая и дюрок отечественной селекции (ГПЗ «Талдом» Московской обл.). ДНК выделяли по ранее разработанным методикам [Зиновьева и др., 2002]. Для разработки аналитической системы использовали последовательность гена NCOA1 (генный банк, № NM001025228).

После амплификации биотинилированного на 3’ конце фрагмента гена длиной 217 п.о., содержащего область мутации, проводили идентификацию мутации TC посредством пиросеквенирования на PSQ96MA. Контроль достоверности результатов пиросеквенирования проводили ПЦР-ПДРФ анализом.

3. Результаты и обсуждение Проведенные нами исследования частот встречаемости аллелей гена NCOA1 у свиней четырех пород канадской и отечественной селекции выявили относительно высокие частоты встречаемости желательного аллеля A1 (рис. 1) и генотипа А1А1 (рис. 2).

дюрок канадский йоркшир канадский ландрас канадский дюрок ландрас Крупная белая 0 10 20 30 40 50 60 70 80 90 A1 А Рисунок 1: Распределение частот встречаемости аллелей гена NCOA1 у свиней различных пород.

Частота желательного аллеля А1 варьировала от 87,04% у свиней крупной белой породы до 97,22% у животных породы дюрок отечественной селекции. Частота желательного генотипа A1А1 варьировала от 77,8% у свиней породы ландрас канадской селекции до 94,44% у животных породы дюрок отечественной селекции.

У свиней породы дюрок и йоркшир канадской селекции на долю генотипа А1А1 приходилось 91,4% и 83,3%.

Частоты встречаемости генотипа А1А1 у свиней крупной белой породы составили 80,25%.

дюрок канадский йоркшир канадский ландрас канадский дюрок ландрас Крупная белая 0 10 20 30 40 50 60 70 80 90 A1A1 A1A2 A2A Рисунок 2. Распределение частот встречаемости генотипов гена NCOA1 у свиней различных пород.

Нами были выполнены исследования влияния генотипов гена NCOA1 у свиней пород йоркшир канадской селекции, крупная белая и ландрас отечественной селекции. Результаты исследований представлены в таблице 1.

Таблица 1: Продуктивность свиней пород йоркшир, крупная белая и ландрас с различными генотипами по гену NCOA-1.

При рождении В 21 день Отъем Гено- Много- Масса Число Количество Масса Количество Масса тип плодие гнезда, кг Живых поросят, гнезда, кг поросят, гнезда, кг поросят гол гол Йоркшир А1А1 9,25±0,60 12,50±0,78 8,75±0,62 6,96±0,5 37,13±2,70 6,38±0,46 47,12±2, А1А2 8,20±0,58 10,50±1,16 7,40±0,68 6,00±0,9 31,70±6,65 5,75±1,11 53,13±10, Крупная белая А1А1 10,32±0,3 - 10,19±0,2 10,2±0,2 52,10±0,99 9,93±0,21 152,86±2, А1А2 10,11±0,5 - 9,89±0,54 8,83±1,8 44,00±8,84 8,83±1,78 129,33±26, А2А2 7,60±0,93 - 7,60±0,93 8,40±2,1 40,00±10,02 8,40±2,11 123,60±30, Ландрас А1А1 9,44±0,33 12,28±0,48 9,33±0,33 8,33±0,3 44,28±1,93 7,67±0,37 80,22±4, А1А2 8,04±0,76 9,16±0,77 7,48±0,69 7,30±0,5 34,60±2,43 6,32±0,81 54,24±7, Анализ показал, что свиноматки породы йоркшир канадской селекции с генотипом A1A1 превосходили животных с гетерозиготным генотипом, как по числу поросят при рождении (+1,05 поросенка на опорос), так и по числу живых поросят (+1,35 поросенка на опорос). Свиноматки крупной белой породы с генотипами А1А1 и А1А2 достоверно превосходили по числу поросят при рождении животных с генотипом А2А2, соответственно, на 2,72 и 2,51(p0,01) поросенка на опорос, а по числу живых поросят – соответственно, на 2,59 и 2,29 поросенка на опорос. У свиноматок породы ландрас с генотипом А1А1 наблюдается превосходство над матками с генотипом А1А2 по числу поросят при рождении (+ 1,4 поросенка на опорос), а также по числу живых поросят (+1,85 поросенка) (p0,01).

4. Заключение Приведенные в настоящей работе данные свидетельствуют, что ген NCOA1 представляет потенциальный интерес для свиноводства России. Для того чтобы сделать окончательный вывод о влиянии данного маркера на многоплодие, необходимо продолжение исследований в этом направлении с привлечением большего поголовья животных различных пород.

Литература (1) Leo C., Chen J.D. (2000) Gene, 245, 1-11.

(2) Nephew K.P., Ray S., Hlaing M., Ahluwalia A., Wu S.D., Long X., Hyder S.M., Bigsby R.M. (2000) Biol. Reprod., 63, 361-367.

(3) Spenser T., Jenster G., Burcin M.M. et al. Nature, 1997, 389, 194-198.

(4) Зиновьева Н.А., Гладырь Е.А., Эрнст Л.К., Брем Г. (2002) Введение в молекулярную генную диагностику сельскохозяйственных животных, ВИЖ, 128 с.

РАЗРАБОТКА ОФТАЛЬМОЛОГИЧЕСКИХ ПРЕПАРАТОВ НА ОСНОВЕ ЭНДОГЕННЫХ ПЕПТИДОВ Краснов М.С., Ямскова В.П., Гурмизов Е.П.1, Ямсков И.А. Институт биологии развития им. Н.К. Кольцова РАН, 119334 Москва, ул. Вавилова 26, Россия МНИИ глазных болезней им. Гельмгольца МЗ РФ, 105062 Москва, ул. Садово-Черногрязская 14/19, Россия Институт элементоорганических соединений им. А.Н. Несмеянова РАН, 119991 Москва, ул. Вавилова 28, Россия embrmsk@mail.ru Ключевые слова: регуляторные пептиды, ткани глаза, офтальмология 1. Введение Среди биологически активных веществ регуляторные пептиды (РП) занимают особое место, поскольку они обеспечивают в биологических системах поддержание гомеостаза на всех уровнях - от отдельной клетки до организма в целом (1). К ним относится группа РП, биологически активных в сверхмалых дозах (2–5).

Молекулы данных РП характеризуются проявлением ярко выраженной тенденции к образованию высокомолекулярных ассоциатов (6). В сверхмалых дозах РП оказывают влияние на основные биологические процессы: адгезию и миграцию клеток, клеточную пролиферацию и дифференцировку. РП стимулируют процессы восстановления и репарации в патологически измененных тканях (7). Было установлено, что биологическая активность РП изучаемой группы характеризуется отсутствием видовой, но наличием тканевой специфичности (8).

2. Материалы и методы В процессе выделения РП использовали методы изоэлектрофокусирования, электрофореза в ПААГ, обращено-фазовую ВЭЖХ. Для выявления локализации РП в тканях были получены поликлональные кроличьи антисыворотки и использованы методы иммуногистохимии. Для изучения специфической биологической активности РП были использованы модели органотипического культивирования тканей глаза, отражающие основные глазные патологии.

3. Результаты и обсуждение Из тканей глаза крупного рогатого скота (нейральная сетчатка, пигментный эпителий сетчатки, хрусталик, склера и др.) были выделены РП по разработанной ранее методике (6, 8). Все изучаемые РП имели «кажущиеся» молекулярные массы ниже 8кДа. При разделении РП тканей глаза методом ВЭЖХ были идентифицированы два основных биологически активных компонента, время удерживания которых, соответственно, около 3,6±0,2 и 13,4±0,4 мин (Рис. 1).

DAD1 E, Sig=280,16 Ref =360,100 (BEREZIN\BER10165.D) 3. Norm.

1.

.:

щ ло П mAU АР-Сетчатка(зелен) пик 5.

П13..:

щ ло пик - - - 0 5 10 15 20 25 min Время удерживания (мин) Рисунок 1. Обращено-фазовая ВЭЖХ фракции кислых РП, выделенных из сетчатки глаза быка.

Предполагается, что оба компонента представлены одинаковой пептидной составляющей и отличаются посттрансляционными модификациями. В настоящее время правильность данного предположения проверяется методами масс-спектрометрии. Изучаемые РП локализованы во внеклеточном пространстве тканей, из которых они были выделены. Были разработаны новые экспериментальные модели, отражающие основные глазные заболевания, на которых было показано, что РП тканей глаза проявляют способность в сверхмалых дозах (10-8 -10-14 мг/мл) оказывать влияние важнейшие биологические процессы. РП стимулировали восстановительные и репаративные процессы в патологически измененных тканях: РП сетчатки увеличивал жизнеспособность клеток Мюллеровской глии, а также способствовал поддержанию адгезивных взаимодействий в сетчатке глаза, обладал сосудорасширяющим действием;

РП пигментного эпителия стабилизировал состояние дифференцировки клеток пигментного эпителия, увеличивал жизнеспособность данных клеток, а также биполярных и Мюллеровских клеток, проявлял сосудосуживающее действие (Рис. 2);

РП хрусталика препятствовал катарактогенезу (Рис. 3);

РП склеры увеличивал жизнеспособность ткани сосудистой оболочки, пигментного эпителия и склеры глаза.

Рисунок 2. Стабилизация адгезии и дифференцировки пигментного эпителия при культивировании заднего отдела глазного бокала тритона Pl. waltl. в течение 2-х суток (слева – контроль, справа – воздействие РП, выделенного из пигментного эпителия глаза быка) Стрелками показан монослой пигментного эпителия.

1 Рисунок 3. Протекторный эффект РП, выделенного из хрусталика глаза быка, на катарактогенез в хрусталике глаза крысы, индуцированный воздействием пероксида 2 водорода in vitro. № 1 – питательная среда 199;

№ 2 – питательная среда 199, содержащая H2O2;

№ 3 – питательная среда 199, содержащая H2O2 + раствор исследуемого белка.

4. Заключение Исследуемые РП являются регуляторами органо-тканевого гомеостаза, выполняют роль модуляторов восстановительных и репаративных процессов в поврежденных тканях глаза. На основе данных РП разрабатываются офтальмологические препараты для лечения таких распространенных глазных заболеваний как катаракта, миопия, витреоретинальные патологии, дистрофии и отслойка сетчатки, пигментный ретинит и др.

Благодарности Работа выполнена при финансовой поддержке гранта президента РФ № МК-3839.2005. Авторы выражают благодарность снс ИНЭОС им. А.Н. Несмеянова РАН, кхн Березину Б.Б.

Литература (1) Хавинсон В.Х., Кветной И.М., Южаков В.В., Попучиев В.В., Коновалов С.С. Пептидергическая регуляция гомеостаза (2003) СПб.: «Наука». 194с.

(2) Ямскова В.П., Модянова Е.А., Левенталь В.И., Ланковская Т.П., Бочарова О.К., Маленков А.Г. (1977а) Биофизика, 22, 168-174.

(3) Ямскова В.П., Модянова Е.А., Резникова М.М., Маленков А.Г. (1977б) Молекулярная биология, 11(5), 1147-1154.

(4) Ямсков И.А., Ямскова В.П., Даниленко А.Н., Клеменкова З.С., Антипов Б.Г., Черников Ф.Р., Гусынина М.М., Рыбакова Е.Ю. (1999) Российский химический журнал (ЖРХО им. Д.И. Менделеева), 43(5), 34-39.

(5) Краснов М.С., Маргасюк Д.В., Ямсков И.А., Ямскова В.П (2003а) Радиационная биология и радиоэкология, 3, 269-272.

(6) Ямскова В.П., Резникова М.М. (1991) Журнал общей биологии, 52(2), 181-191.

(7) Гундорова Р.А., Хорошилова - Маслова И.П., Ченцова Е.В., Илатовская Л.В., Ямскова В.П., Романова И.Ю.

(1997) Вопросы офтальмологии, 113(2), 12-15.

(8) Краснов М.С., Григорян Э.Н, Ямскова В.П. (2003), Изв. Акад. наук серия биологическая, 1, 22-36.

КАРТИРОВАНИЕ ГЕНА Crt, ВЛИЯЮЩЕГО НА ВЗАИМОДЕЙСТВИЕ ГОРОХА С СИМБИОТИЧЕСКОЙ МИКРОФЛОРОЙ Кузнецова Е.В., Борисов А.Ю.

ГНУ ВНИИ сельскохозяйственной микробиологии РАСХН, 196608, Санкт-Петербург, Пушкин-8, шоссе.

Подбельского, 3, Россия kuznetsovaev@yandex.ru Ключевые слова: симбиотические взаимоотношения, картирование генов, ДНК-маркеры 1. Введение Мутант по гену Crt был получен в лаборатории Генетики растительно-микробных взаимодействий ВНИИСХМ в результате химического мутагенеза и характеризуется нарушением морфогенеза корня (формирование компактной корневой системы в условиях плотного субстрата) (Tsyganov et al., 2000), а также снижением количества симбиотических клубеньков (по сравнению с исходной линией SGE) и более высокими темпами микоризации. Таким образом, ген Crt является ключевым геном, вовлечённым как в морфогенез растения, так и во взаимодействие гороха с симбиотическими микроорганизмами. Клонирование и секвенирование гена позволит определить кодируемый им молекулярный продукт, а, следовательно, лучше понять функцию, выполняемую геном, в растении. Точное картирование гена является обязательным первоначальным этапом для его позиционного клонирования.

2. Материалы и методы Для картирования гена Crt были использованы морфологические маркеры (r, tl), а также разработаны ДНК маркеры на основе данных нуклеотидных последовательностей экспрессирующихся генов (Paal2, Enol).

Специфичные праймеры для амплификации гена фенил-аланин амоний лиазы (Paal2), а также использованного RAPD маркера P603B были любезно предоставлены док. Н. Виденом (университет штата Монтана, США). Для дизайна праймеров для амплификации гена Enolase были использованы данные нуклеотидых последовательностей гена у Medicago truncatula, Glycine max, Lupinus luteus, Ricinus communis and Arabidopsis thaliana. Анализ косегрегации был проведён в F2 популяции, полученной в результате скрещивания мутантной линии SGEcrt и генетической множественно маркированной линии NGB1238.

Амплификация Paal2 и Enol была осуществлена в соответствии со стандартным протоколом ПЦР (94oC- мин.;

35 циклов: 94oC- 30 сек., 60o C и 58oC, соответственно, - 45 сек., 72oC - 1 мин.;

72oC - 25 мин.;

4oC – часа) при конечном объёме реакционной смеси 20-l. Протокол ПЦР для P603B: 94oC- 4 мин.;

35 циклов: 94oC 30 сек., 37oC – 1 мин., 72oC- 1 мин.;

72oC -7 мин.;

4oC – 72 часа.

Нуклеотидные последовательности использованных праймеров:

Paal2: прямой - 5’CAATAACATCAAAGTGAGTGACT, обратный -5’GCTGAAGTTATGCAAGGGAAACC;

Enol: прямой - 5’AGGATGACTGGGAGCACTATG, обратный- 5’CCAAGCTCCTCCTCAATTC P603B: 5’TGGAGTATATTCGAAGCTCG ПЦР продукты были клонированы с использованием набора для клонирования ПЦР продуктов InsT/Aclone PCR product cloning kit (Fermentas). Для приготовления реакционной смеси для секвениерования был использован набор CEQ DTCS quick start kit (Beckman Coulter), секвенирование осуществлялось на секвенаторе CEQ 8000 Genetic Analysis System (Beckman Coulter). Анализ нуклеотидных последовательностей проводился с использованием Vector NTI Suite 8. Анализ косегрегации между маркерами – используя программу CROSS С.М. Розова.

3. Результаты и обсуждение Анализ нуклеотидных последовательностей амплифицированной части гена Paal2 у мутантной линии SGEcrt и отобранных для скрещивания генетически маркированных линий выявил наличие полимофизма по сайту рестрикции Hae III между линиями NGB1238, RT9 и SGEcrt, что явилось основанием для использование гена в качестве CАPS маркера. Также было показано, что линия RT9 имеет делецию размеров 47 п.н. в экзонной части гена Paal2. Полимфизм по ДНК-маркеру P603B был обнаружен только между линиями SGEcrt и NGB1238. Это стало причиной выбора для анализа косегрегации F2 популяции SGEcrt NGB1238. Анализ нуклеотидных последовательностей амплифицированной части гена Enolase выявил отсутствие сайта рестрикции Hpa II у мутантной линии SGEcrt.

Ген Crt был картирован относительно морфологических (r, tl) и ДНК-маркеров (Paal2, Enol, P603B).

Таблица 1: Анализ косегрегации в F2 популяции SGEcrt NGB1238.

Расстояние, cM общий Численность классов P(0.5) Пары генов AB AHz Ab aB aHz ab Total 2.01 ± 1. r - tl 78 - 2 0 - 23 103 92.39 P0. 12.14 ± 4. P603B - r 47 - 1 7 - 14 61 35.82 P0. 10.41 ± 3. P603B - tl 47 - 1 6 - 15 61 39.44 P0. 1.64 ± 1. Crt - Enol 21 40 1 0 0 13 75 64.40 P0. 1.25 ± 1. Enol - r 14 39 1 0 0 20 74 69.17 P0. 10.44 ± 4. Enol -P603B 9 28 1 0 6 15 59 33.36 P0. 6.74 ± 4. Paal2 - r 21 - 0 2 - 7 30 21.30 P0. 6.74 ± 4. Paal2 - tl 21 - 0 2 - 7 30 21.30 P0. 16.33 ± 7. Paal2 - P603B 18 - 3 2 - 7 30 11.43 P0. Рисунок 1: Расположение гена Crt относительно использованных для его картирования маркеров.

Paal2 crt r Enol tl P603B 1. 6.7 2.0 10. cM 4. Заключение В результате проведённого исследования ген Crt гороха, контролирующий морфогенез корня и влияющий на взаимодействие растения с симбиотической микрофлорой был локализован с большей точностью. Это является важным и необходимым этапом для последующего позиционного клонирования гена с использованием синтении между геномами гороха и модельного бобового растения Medicago truncatula Gaertn.

Благодарности Исследование поддержано грантами РФФИ 04-04-48457-а, РФФИ 04-04-48462-а, НШ-1103.2003. Литература Tsyganov V. E. et al. (2000) Annals of Botany 86: 975-981, 2000.

СРАВНЕНИЕ КАТАЛИТИЧЕСКИХ СВОЙСТВ НИТРИЛГИДРАТАЗ ШТАММОВ РОДА RHODOCOCCUS Кузнецова М.В.

614081, г. Пермь, ул. Голева, 13, Россия, Институт экологии и генетики микроорганизмов УрО РАН, mar@iegm.ru Ключевые слова: нитрилы, нитрилгидратаза, акриламид 1. Введение Способность утилизировать нитрилы карбоновых кислот широко распространена среди микроорганизмов.

Промышленная биотрансформация нитрилов с использованием ферментативного катализа с успехом применяется как альтернативный вариант химическому методу в ряде производственных процессов.

Продуценты нитрилгидратаз - Rhodococcus rhodochrous J1 и М8 используются для крупнотоннажного производства акриламида на предприятиях Nitto Chemical в Японии и ЗАО «Компания Москва-Штокхаузен Пермь» в России (1, 2). Для использования микроорганизмов в промышленном катализе необходима высокая скорость гидролиза нитрила, при этом большое значение имеет также pH- и термостабильность фермента.

Цель настоящего исследования – сравнение каталитических свойств трех штаммов родококков, рассматриваемых как потенциальных биокатализаторов для получения акриламида.

2. Материалы и методы В качестве объектов исследования использованы полученные ранее в результате селекции штаммы R. erythropolis 84, R. ruber gt1 (3) и новый штамм R. erythropolis А0, обладающие высокой (более 100 ЕД) нитрилгидратазной активностью. Трансформацию нитрилов с использованием биомассы выделенных штаммов проводили при 25С в 1 мл 10 мМ калий-натрий фосфатного буфера, pH 7,2 в течение 10 минут.

Нитрилгидратазную активность измеряли по изменению концентрации нитрила и амида в реакционной среде за 10 минут трансформации с помощью методов ГХ и ВЭЖХ. Единица нитрилгидратазной активности (1ЕД) соответствует 1 мкМ амида/мг сухих клеток/мин.

Влияния ингибиторов, температуры и рН среды на активность нитрилгидратазы проверяли на бесклеточном экстракте, полученном пятикратной обработкой ультразвуком (УЗДН-4) по 20 секунд с последующим центрифугированием. Бесклеточный экстракт (50 мкл) вносили в соответствующие буферные растворы (pH 2,0-13,0) и температурные режимы (10 до 80С) выдерживали 10 минут и определяли нитрилгидратазную активность спектрофотометрическим методом, используя в качестве субстрата акрилонитрил.

3. Результаты и обсуждение Определены основные свойства нитрилгидратаз штаммов R. erythropolis 84, А0 и R. ruber gt1: субстратная специфичность, зависимость активности от температуры и pH, влияние ряда стандартных ингибиторов ферментов.

Нитрилгидратазы штаммов R. erythropolis 84, А0 и R. ruber gt1 обладали широкой субстратной специфичностью, в том числе к ароматическим и циклическим нитрилам. Наилучшими субстратами являлись ацетонитрил и акрилонитрил. Активность нитрилгидратазы штаммов R. erythropolis А0 и R. ruber gt сопоставима с активностью ферментов штаммов, используемых в промышленном синтезе акриламида, таких как R. rhodochrous J1 (78 %) и М8 (68 %) (4, 5).

Таблица: Субстратная специфичность нитрилгидратаз Относительная нитрилгидратазная активность, % Субстрат R. erythropolis 84 R. erythropolis А0 R. ruber gt Ацетонитрил 100 100 Пропионитрил 34,1 63,7 55, Бутиронитрил 50,4 45,1 52, Изобутиронитрил 17,5 8,5 5, Акрилонитрил 26,3 67,4 62, Лактонитрил 6,3 0,2 5, Адипонитрил 48,5 8,6 13, Малонодинитрил 8,3 9,4 11, Бензонитрил 0,8 55,0 18, 3-цианопиридин 1,6 20,2 10, За 100% принята скорость гидролиза ацетонитрила Биотрансформация с использованием мезофильных нитрилгидратаз обычно протекает при температуре 0-20°С из-за низкой стабильности ферментов (6). Максимальная активность фермента R. erythropolis А0 была при температуре 60°С (374 ЕД), R. ruber gt1 - 55°С (752 ЕД). Активность нитрилгидратазы R. erythropolis была максимальной при температуре 30°С (72 ЕД) и снижалась в 2 раза при 40°С (Рис. 1).

800 700 активность нитрилгидратазы 600 активность нитрилгидратаз штаммов А0, gt1, ЕД штамма 84, ЕД 500 400 300 200 100 0 0 10 20 30 40 50 60 70 80 °C Рисунок 1: Зависимость активности нитрилгидратазы штаммов R. erythropolis 84 (1), А0 (2) и R. ruber gt1 (3) от температуры.

Из данных, представленных на рис. 2, штаммы R. erythropolis 84, А0 имеют узкий пик нитрилгидратазной активности, достигающий максимального значения при pH 7,0. Нитрилгидратаза R. ruber gt1 проявляла высокую активность (более 30 % от максимальной) в диапазоне pH от 5,0 до 9,5. Активность фермента, близкая к максимальной зарегистрирована в широком интервале pH: от 6,0 до 8,0.

Анализ влияния ингибиторов на активность ферментов показал, что карбонильные реагенты – гидроксиламин и фенилгидразин снижают каталитическую активность нитрилгидратазы у трех штаммов.

Фермент R. erythropolis 84 сильно ингибировался перекисью водорода, 2-меркаптоэтанолом и FeCl3 в концентрации 1 мМ. Добавление хлорида железа (III) до 1 мМ снижало активность нитрилгидратазы R. ruber gt1 на 63 %. Нитрат серебра (1 мМ), связывающий тиоловые группы, полностью подавлял активность нитрилгидратазы штамма R. ruber gt1.

500 450 400 активность нитрилгидратаз активность нитрилгидратазы штаммов gt1, А0, ЕД 350 штамма 84, ЕД 300 250 200 150 100 50 0 0 1 2 3 4 5 6 7 8 9 10 11 12 13 pH Рисунок 2: Зависимость активности нитрилгидратазы штаммов R. erythropolis 84 (1), А0 (2) и R. ruber gt1 (3) от pH среды.

4. Заключение Относительно широкая субстратная специфичность, высокая стабильность нитрилгидратаз при субоптимальных температурах и большой диапазон pH свидетельствуют о том, что штаммы R. erythropolis 84, А0 и R. ruber gt1 могут успешно применяться в процессах промышленного биокатализа.

Работа выполнена при поддержке молодежного гранта УрО РАН.

Литература (1) Kobayashi M., Nagasawa T., Yamada H. (1992) Trends in Biotechnol., 10,402-408.

(2) Аликин В.Н., Кузьмицкий Т.Э., Забелин Л.В. (1999) Конверсия специальной технической химии: М. 176 c.

(3) Кузнецова М.В.: Утилизация нитрилов штаммами Rhodococcus sp. (2001) в: Матер. IX межвуз. конф., Пермь, 2, 35-38.

(4) Вейко В.П., Яненко А.С., Алексеева М.Г. и др. (1995) Биотехнология, 5-6, 3-5.

(5) Nagasawa T., Takeuchi K., Yamada H. (1991) Eur. J. Biochem., 196, 581-589.

(6) Cowan D. et al., (1998) Extremophiles, 2(3), 207-216.

ПЛАЗМИДЫ СЕМЕЙСТВА PBS72 КАК ОСНОВА ДЛЯ СОЗДАНИЯ ВЕКТОРНЫХ СИСТЕМ Лагодич А.В.

Белорусский государственный универитет, биологический факультет, кафедра генетики, 220050 Беларусь, г.

Минск, Пр. Независимости 4, LagodichAV@bsu.by Ключевые слова: плазмиды тета-типа, pBS72, репликация, вектор 1. Введение Настоящая работа посвящена изучению молекулярно-генетической организации плазмид бактерий B. subtilis, выделенных из различных природных источников на территории Беларуси, и их использованию при создании векторов для молекулярного клонирования в клетках этих биотехнологически ценных микроорганизмов.

2. Материалы и методы Были использованы: 287 штаммов грамположительных спорообразующих бактерий, выделенных на территории Беларуси;

коллекционные штаммы: E. coli XL1-Blue, JM105, B. subtilis 168 trpC2, 1A224 и 1A226, плазмиды pMTL21C, pMUTIN4, pGEM-T Easy, pLS20, pE194, pT181, p1414, pHV1436. Бактериальные культуры выращивали в жидких и на плотных питательных средах LB (5) и минимальной среде [(2)], использовали коммерческие препараты антибиотиков.

Выделение спорообразующих бактерий из почвы производили методом кипячения [(1)], видовую принадлежность выделенных микроорганизмов определяли на основании их чувствительности к специфическим фагам B. subtilis, результатов рекомбинационного теста и метода ARDRA.

Плазмидную ДНК выделяли методом щелочного лизиса [(3)]. Трансформацию бактерий E. coli и B. subtilis, предварительно переведенных в состояние компетентности, проводили согласно рекомендациям, приведенным в руководстве J. Sambrook et al. [(5)] и работе S. Bron [(4)].

Электрофоретический анализ ДНК осуществляли общепринятыми методами [(5)], манипуляции с ДНК осуществляли в условиях, рекомендуемых фирмой изготовителем ферментов “MBI Fermentas” и “New England Biolabs”. Для идентификации плазмид использовали метод гибридизации по Саузерну.

ПЦР проводили с использованием набора реактивов TaKaRa Ex TaqTM (Япония).

Для реакции секвенирования применяли CycleReader™ Auto DNA Sequencing Kit производства “MBI Fermentas” (Литва). Плазмидную ДНК выделяли и очищали с использованием Kit Wizard® plus SV Minipreps DNA Purification System (Promega, США). Сиквенс ДНК осуществляли с помощью автоматического секвенатора (ALFexpress II). Результаты анализировали с использованием компьютерных программ BLASTP2.2.1 (NCBI сайт: http://www.ncbi.nlm.nih.gov), ALFwin™ Sequence Analyser (version 2.10).

3. Результаты и обсуждение С использованием метода щелочного лизиса с последующим электрофоретическим анализом изолированной ДНК для 20% штаммов, идентифицированных как B. subtilis, было показано наличие внехромосомных генетических элементов размером более 90 kb. Были изолированы мини-репликоны и определены размеры клонированных rep-областей трех плазмид, выделенных из штаммов 19, 57 и 72 (табл. 1).

Для клонирования rep-областей выявленных плазмид использовали вектор pMTL21C.

Таблица 1: Размер полученных мини-репликонов.

Номер штамма Плазмида Размер вставки, (kb) Размер конструкции, (kb) Название репликона 19 pBS19 5,5 9,0 pMTLBS 57 pBS57 2,9 6,4 pMTLBS 72 pBS72 3,1 6,6 pMTLBS Полученные мини-репликоны эффективно трансформировали клетки типового штамма B. subtilis trpC2, стабильно поддерживались в ряду поколений (утрачивались с частотой 4-6% за 60 генераций). Их репликация не зависила от функции ДНК-полимеразы I.

Метод гибридизации по Саузерну позволил установить, что исследованные плазмиды имеют сходные rep области, но не относятся ни к одному из охарактеризованных семейств плазмид грамположительных бактерий, в частности, pAM1, рТВ19, pLS20 (плазмиды тета-типа) и pT181, pE194, pC194 (плазмиды RCR-типа).

Отсутствие фракции однонитевой ДНК, характерной для репликации плазмид RCR-типа, а так же размеры исходных плазмид, указывали на их принадлежность к плазмидам тета-типа.

Выяснение молекулярно-генетической организации rep-областей выявленых плазмид осуществлялось путем определения их нуклеотидной последовательности и функционального анализа делеционных и инсерционных изменений, полученных в пределах клонированных мини-репликонов. Результаты ПЦР rep областей исследованных плазмид с последующим рестрикционным и сиквенс-анализом продуктов амплификации (рис. 1) позволили продемонстрировать сходство их организации и отнести данные внехромосомные генетические элементы к новой систематической группе, включающей как минимум десять представителей.

Рисунок 1: Организация мини-репликонов плазмид pBS72 (3081 bp), pBS57 (2892 bp) и pBS4 (2076 bp). Обозначения:

промотор, последовательность Шайн-Дальгарно, терминатор;

повторы ( – правая, – левая ориентация);

DnaA связывающие последовательности ( ). Для репликации плазмид необходимы repA и область, содержащая в своем составе ориджин вегетативной репликации - oriV.

На основе базового репликона плазмиды тета-типа pBS72 и плазмиды pMTL21C была создана серия двурепликонных векторов (рис. 2).

В частности, путем клонирования продукта амплификации rep-области плазмиды pBS72 в сайт AflII вектора pMTL21C были получены векторы общего назначения pMTL7-1 и pAL1, пригодные для клонирования и секвенирования чужеродных фрагментов ДНК. Путем замены последовательности tac-промотора на синтетический олигонуклеотид, представленный промотором lac, были получены векторы pLAV1 и pLAV2, предназначенные для изучения экспрессии клонированных генов под контролем собственных регуляторных элементов. В векторах pLAV4 и pAL2 последовательность tac-промотора была заменена на область, способную обеспечить высокий уровень экспрессии чужеродного генетического материала в клетках грамположительных микроорганизмов.

Рисунок 2: Молекулярно-генетическая организация векторов.

Пояснения: oriEc – ColE1-репликон (E. coli);

oriV и RepA – rep-область pBS72 (B. subtilis);

MCS - полилинкер 72 78 bp, несущий 11-16 сайтов, (в pMTL7-1 и pAL фланкирован для праймеров M13/pUC), перед геном lacZ расположены tac-промотор (pMTL7-1, pAL1), lac промотор (pLAV1, pLAV2), spac-промотор (pLAV4, pAL2);

t1t2t0 – терминаторы транскрипции;

маркеры устойчивости к ампициллину (Amp) и хлорамфениколу (Cm) в клетках E. coli и B. subtilis, соответственно.

4. Заключение Созданные векторные молекулы эффективно трансформировали клетки бактерий E. coli и B. subtilis (с эффективностью 106 и 105 клеток на 1мкг ДНК, соответственно), обеспечивали поддержание чужеродного генетического материала размером до 10 kb и характеризовались структурной и сегрегационной стабильностью (сохранность репликона 95% в течение 60 генераций), что позволяет рассматривать данные внехромосомные генетические элементы как оптимальный исходный материал при создании векторных систем.

Литература (1) Козловский Ю.Е., Прозоров А.А. (1981) Докл. АН СССР, 258, № 6, 1457–1459.

(2) Anagnostopoulos C., Spizizen J. (1961) J. Bacteriol., 81, № 5, 741–746.

(3) Birnboim H. L. Doly J. (1979) Nucl. Acids. Res., 7, № 6, 1513–1523.

(4) Bron S. Plasmids // Molecular Biological Methods for Bacillus. Ed. Harwood C.R. - John Wiley and Sons Ltd, Chichester. – 1990. – P. 75–174.

(5) Sambrook J., Fritsch E., Maniatis T. Molecular cloning: a laboratory manual. 2nd ed./Cold Spring Harbor Laboratory, Cold Spring Harbor Publications, NY.-1989.-468 p.

АНАЛИЗ ЭКСПРЕССИИ ГЕНОВ РАННИХ НОДУЛИНОВ PsENOD5 И PsENOD12A У МУТАНТОВ ГОРОХА PISUM SATIVUM L., ХАРАКТЕРИЗУЮЩИХСЯ БЛОКОМ В РАЗВИТИИ СИМБИОЗА НА РАЗЛИЧНЫХ СТАДИЯХ Леппянен И.В.1,2, Долгих Е.А.2, Цыганов В.Е. 2, Борисов А.Ю. 2, Тихонович И.А. Санкт-Петербургский Государственный Университет, Санкт-Петербург (Россия), ГНУ ВНИИ Сельскохозяйственной Микробиологии, Санкт-Петербург (Россия).

leppyanen_irina@rambler.ru Ключевые слова: бобово-ризобиальный симбиоз, Nod факторы, механизмы рецепции Nod факторов и пути передачи сигнала.

1. Введение Взаимодействие между почвенными бактериями и бобовыми растениями приводит к формированию новых симбиотических органов – клубеньков, в которых бактерии дифференцируются в бактероиды, способные фиксировать молекулярный азот. Избирательность взаимодействия ризобий и бобовых растений определяется обменом сигнальными молекулами между партнерами. Липохитоолигосахаридные сигналы, выделяемые ризобиями, Nod факторы (НФ), запускают комплекс специфических ответных реакций в корневых волосках, перицикле и кортексе корня растения, обеспечивая таким образом последующее проникновение бактерии и распространение инфекции. (1,2). Связывание НФ, вероятно, осуществляется недавно открытыми у бобовых растений рецептор-подобными киназами, содержащими LysM домены в экстраклеточной части. Однако, механизмы работы рецептора in vivo остаются не ясны. У модельного бобового растения Lotus japonicus рецепторы к НФ могут формировать гетеродимер, который включает две рецептор-подобные киназы, содержащие LysM домены (RLKs) - LjNFR1 и LjNFR5. Мутации по обоим генам вызывают отсутствие всех ранних ответов, что указывает на то, что оба белка одинаково необходимы для связывания НФ. Кроме того, у LjNFR5 отсутствует активационная петля в киназном домене и этот белок, вероятно, формирует комплекс с белком LjNFR1, который содержит такую петлю. У гороха были найдены два гена, которые кодируют рецептор-подобные белки. Ген Sym10 гороха является ортологом гена NFR5 Lotus japonicus, а Sym37 – ортологом NFR1. мутанты гороха по гену sym10 не чувствительны к НФ. Напротив, у мутанта по гену sym (ортологу LjNFR1) было блокировано только развитие инфекции, но не другие реакции. Несмотря на это, механизмы функционирования рецептора к НФ у гороха все еще не ясны.

Для того, чтобы объяснить механизмы работы рецептора к НФ у P. sativum, мы использовали молекулярные маркеры, активация которых связана с определенной стадией бобово-ризобиальных взаимодействий. Ранее нами было показано, что гены ранних нодулинов PsENOD12a и PsENOD5, индуцирующиеся у гороха в ответ на инокуляцию ризобиями, по-разному регулируются. PsENOD экспрессируется исключительно в клетках корня, содержащих инфекционные нити, тогда как PsENOD12a сначала экспрессируется в клубеньковом примордии и позднее в инфицированных и не инфицированных клетках. (1). Следовательно, экспрессия PsENOD5 и PsENOD12a связана с различными стадиями развития симбиоза. Чтобы понять как функционирует рецептор к НФ in vivo мы изучили экспрессию двух генов ранних нодулинов, специфически активируемых НФ, PsEnod5 и PsEnod12a, у симбиотических мутантов гороха, дефектных по восприятию и передаче сигнала от НФ.

2. Материалы и методы В наших экспериментах была использована коллекция мутантов гороха с нарушенным клубенькообразованием, полученных на сортах Finale, Sparkle и линии SGE, блокированных на различных стадиях развития симбиоза: SGENod- -6 (sym7), SGENod- -3 (sym35), SGENod- -8 (sym38), Sparkle, E69 (sym7), E135N (sym14), R50 (sym16), Е2 (sym5) и Finale, RisNod2 (sym19), RisNod8 (sym35), RisNod26 (sym36), RisNod (sym37), а также Rondo K24 (sym37). И сорта дикого типа – Nod+ (SGE, Sparkle и Finale). Уровень экспрессии генов нодулинов изучали методом ПЦР с обратной транскрипцией в корнях проростков гороха через 48 часов после инокуляции Rhizobium leguminozarum bv. viceae.

3. Результаты и обсуждение Было установлено, что для экспрессии PsEnod12a необходимы продукты генов sym19 и sym7. В результате этого предполагается, что индукция экспрессии этого гена происходит после скручивания и колонизации корневых волосков - на стадии, предшествующей проникновению ризобий в клетки корневого волоска.

Следовательно, экспрессия этого гена может являться маркером ранних симбиотических реакций, предшествующих инфекции. Также было установлено, что экспрессия гена PsEnod5 отличается от PsEnod12a, она отсутствовала у мутантов sym19, sym7, sym14, sym35 и sym16, и наблюдалась у мутантов sym38, sym36, sym5 (характеризующихся блокированием развития симбиоза на стадии роста инфекционных нитей в корневых волосках). На основании чего предполагается, что экспрессия PsEnod5 связана с проникновением ризобий в корневой волосок и может служить маркером этого процесса.

Исходя из того, что экспрессия гена PsEnod5 связана с проникновением ризобий в корневой волосок и развитием примордия клубенька, нам было интересно посмотреть как этот ген экспрессируется у мутанта по гену sym37, предположительно кодирующего рецептор к НФ у гороха. Мы исследовали экспрессию генов ранних нодулинов у двух мутантов по гену sym37, полученных на линиях Finale (RisNod4) и Rondo (K24).

Известно, что у RisNod4 sym37 мутагенез привел к появлению замены в экстраклеточном домене, а у К24 – к стоп-кодону в киназном домене. Отсутствие экспрессии гена PsEnod5 у мутантов обоих линий говорит о том, что продукт гена sym37 действительно участвует в связывании НФ. PsEnod12a – маркер ранних симбиотических реакций, экспрессировался у разных мутантов по-разному: у К24 экспрессия была, у RisNod – нет. Исходя из этих данных, мы предполагаем, что для экспрессии PsEnod12a активный киназный домен не требуется, а для экспрссии PsEnod5 необходим активный киназный домен, вероятно, взаимодействующий с дополнительным фактором. На основании анализа экспрессии двух генов-маркеров предложена схема функционирования гетеродимерного рецепторного комплекса in vivo.

4. Заключение По результатам проведенных исследований можно сделать следующие выводы:

1. Экспрессия генов ранних нодулинов PsEnod5 и PsEnod12a регулируется по-разному. PsEnod12а экспрессируется после колонизации корневых волосков, на стадии, предшествующей проникновению ризобий в эти клетки. Напротив, экспрессия PsEnod5 индуцируется после проникновении ризобий в корневые волоски и связана с развитием инфекционной нити и формированием примордия клубенька.

2. Установлено, что гены двух нодулинов могут являться маркерами различных сигнальных каскадов:

одного, запускающего развитие ранних симбиотических реакций, предшествующих инфекции (PsEnod12a) и другого, ведущего к развитию инфекции и формированию примордия клубенька (PsEnod5).

3. Рецептор-подобный белок, кодируемый геном sym37, необходим для индукции экспрессии PsEnod5 и PsEnod12a. Для запуска экспрессии PsEnod5, вероятно, требуется третий дополнительный компонент.

Литература (1) Spaink H. P., Sheeley D. M., van Brussel A. A. N., Glushka J., York W. S., Tak T., Geiger O., Kennedy E. P., Reinhold V. N. and Lugtenberg B. J. J. (1991). A novel highly unsaturated fatty acid moiety of lipooligosaccharide signals determines host specificity of Rhizobium. Nature. V. 354. P. 125-130.

(2) Heidstra R., Bisseling T. (1996) Nod factor-induced host responses and mechanisms of Nod factor perception//New Phytol. V. 133. P. 25-43.

СИНТЕЗ АНИОННЫХ ПРОИЗВОДНЫХ МИО-ИНОЗИТА И ДРУГИХ ПОЛИОЛОВ И ИССЛЕДОВАНИЕ ИХ АНТИВИРУСНОЙ АКТИВНОСТИ Лившиц В.А.

Институт биохимии им. А.Н.Баха РАН, 119071 Москва, Ленинский проспект 33, Россия livshic@zelnet.ru Ключевые слова: мио-инозит, ВИЧ, анионные производные, поли--гидроксибутират 1. Введение За последние десятилетия достигнут значительный прогресс в изучении патогенеза ВИЧ и разработке эффективных подходов к анти-ВИЧ-терапии. Достаточно высокая токсичность одобренных для клинического применения лекарственных препаратов, а также образование резистентных к ним штаммов вируса приводит к необходимости поиска новых стратегий осуществления антиретровирусной терапии. В качестве потенциальной молекулярной мишени для разработок и дизайна новых терапевтических агентов может служить процесс проникновения вируса в клетку. В последние годы расширяются исследования различных по структуре полианионсодержащих соединений в качестве ингибиторов проникновения вируса в клетку.

Однако данный класс соединений обнаруживает низкий ингибиторный эффект в экспериментах in vivo, что обусловлено рядом фармакокинетических недостатков. Они плохо всасываются после внутреннего применения и даже при прямом попадании в кровоток могут быть подвергнуты влиянию различных белков плазмы крови до достижения участка их действия, частично инактивируясь компонентами плазмы. Один из подходов к увеличению активности полианионсодержащих веществ заключается во введении в их структуру гидрофобных фрагментов. Изменение соотношения гидрофобно-гидрофильных фрагментов в структуре соединения позволяет сохранить антивирусную активность, способность к проникновению в инфицированные клетки, а также снизить побочное токсическое действие таких соединений.

Еще одним способом увеличения активности полианионных соединений может служить включение их в матрицу изделий (микросферы, микрокапсулы, пленки) на основе биоразлагаемых полимеров, таких как поли -гидроксибутират. Направленная доставка наряду с контролируемым высвобождением веществ из матрицы этого биосовместимого и биоразлагаемого полимера позволяет улучшить антивирусную активность, снижая при этом побочное действие полианионных соединений.

2. Материалы и методы В целях осуществления данной задачи нами был осуществлен синтез различных полианионных соединений на основе полигидроксильных, в том числе инозитсодержащих, матричных структур: 2,3,4,5 тетра-О-бензил-D,L-идита 1, 1,12-додекандиола 2 и димерного аналога инозитсодержащих фосфолипидов, состоящего из двух циклитных колец мио-инозита, связанных спейсером 3 (Рис.1). В работе был осуществлен синтез указанных полигидроксильных соединений 1-3. Полученные диольные соединения были использованы для синтеза дисульфатов 4-6, методом сульфатирования в пиридине с помощью комплекса серная кислота уксусный ангидрид. Завершающей стадией синтеза дисульфата димерного производного мио-инозита стало удаление изопропилиденовых защитных групп в полностью замещенном производном 6. Также был синтезирован дифосфат тетрабензилового эфира идита 7 в две стадии фосфиттриэфирным методом. Структура синтезированых соединений доказывалась данными 1Н-ЯМР-спектроскопии и масс-спектрометрии.

Полученные полианионные соединения были протестированы на антивирусную активность в отношении различных вирусных штаммов. Данные цитотоксичности (Табл.1) и антивирусной активности (Табл.2) были получены в сравнении с плеконарилом в качестве стандарта.

3. Результаты и обсуждение В работе были синтезированы диольные производные 1-3 для получения полианионных производных.

Проведен синтез дисульфатов 4-6 с хорошим выходом удобным методом сульфатирования, а также дифофата тетрабензилового эфира идита 7. При выделении дифосфата 7 возникли трудности, связанные с достаточно высокой липофильностью этого соединения, что сказалось на выходе реакции.

При исследовании антивирусной активности оказалось, что все протестированные вещества были неактивны против риновирусов (RV2, RV14, RV1A). Дисульфат 2,3,4,5-тетра-О-бензил-D,L-идита 4 и моносульфат 1,12-додекандиола 8 проявили активность в ингибировании вируса Коксаки, штаммов CVB3Nancy, CVB3 97927, СVB1, CVB2 и CVB4. Но только для штамма CVB3Nancy активность была сопоставима с таковой для стандарта. Дисульфат 1,12-додекандиола 5 оказался неактивным против всех исследовавшихся вирусов, а дифосфат 2,3,4,5-тетра-О-бензил-D,L-идита 7 проявил активность против вируса герпеса HSV1 и HSV2. Если говорить о токсичности, то дисульфат 2,3,4,5-тетра-О-бензил-D,L-идита оказался наиболее токсичным, превышая токсичность стандарта.

OBzl OBzl RO OR O N NC P Cl + HN 1.

OBzl OBzl NC N N 25% NH3, MeOH O 7R=PO3H 1 R=H 1. H2SO4, Ac2O, Py 2. tBuOOH 2. 25% NH3 aq 4 R=SO3H O O O O (CH2) R 1O OR2 OR OR O O 2 R1,R2 = H 1(3) 1(3) 1. H2SO4, Ac2O, Py 2. 25% NH3 aq 5 R1,R2=SO3H + O O O O OBzl OBzl 8 R1=H, R2=SO3H HO PO OH O P O O OBzl OBzl 3 R=H 1. H2SO4, Ac2O, Py 2. 25% NH3 aq 6 R=SO3H Рисунок 1: Синтез полианионных соединений с гидрофобными фрагментами, проявляющий антивирусную активность.

Таблица 1. Цитотоксичность полианионных соединений (мкг/мл):

HeLa MDCK GMK Соединение \ клеточные линии CC50 CC10 CC50 CC10 CC50 CC Плеконарил 27.8 12.8 – – 26.4 3. 12.0 2.8 – – 50 50 11.2 – – 50 50 50 50 50 50 50 14.4 – – 50 HeLa – клетки меланомы матки;

MDCK – клетки почек собаки;

GMK – клетки почек зеленой макаки;

«-» - опыт не проводился.

Таблица 2. Антивирусная активность полианионных соединений (IC50, мкг/мл):

Соединение \ вирус CVB3Nancy CVB3 97927 CVB1 CVB2 CVB4 HSV1 HSV2 IV Плеконарил 27.8 0.01 0.03 0.006 3.04 – – – 16 6 14 50 10 50 50 50 50 50 50 50 50 50 50 50 50 50 50 8 26 36 12 24 40 40 40 12 CVB – вирус Коксаки;

HSV – вирус простого герпеса;

IV – иридовирус.

4. Заключение Синтезирован ряд полианионных соединений, содержащих гидрофобные фрагменты в их структуре.

Синтезированные соединения практические не токсичны и обладают антивирусной активностью против различных вирусов. Для сохранения in vivo активности и уменьшения токсичности исследованных соединений планируется включение их в матрицу биосовместимого и биоразлагаемого полимера поли- гидроксибутирата.

Благодарности Работа выполнена при поддержке ГК № 02.467.11.3004.

ОКИСЛЕНИЕ УСТОЙЧИВЫХ СОЕДИНЕНИЙ ГИБРИДНОЙ MN-ПЕРОКСИДАЗОЙ В ПРИСУТСТВИИ МЕДИАТОРОВ Лисов А. В.

Институт биохимии и физиологии микроорганизмов им. Г. К. Скрябина РАН, 142290, Московская обл., г. Пущино, ул. Институтская, д.5.



Pages:     | 1 | 2 || 4 | 5 |   ...   | 7 |
 





 
© 2013 www.libed.ru - «Бесплатная библиотека научно-практических конференций»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.